Ornithorhynchus_anatinus Locus ENSOANG00000021773
snOPY snoRNA Orthological Gene Database
Ornithorhynchus_anatinus ENSOANG00000021773
Ornithorhynchus_anatinus
ENSOANG00000021773
Contig24898
SNORA44, SNORA61, SNORD99
2615..2748, 2975..3102, 3364..3434
4238
CCCTCAGCACCGTACTCGTCTGCTCAACTGTATATATCTTCATTACCCTATTTATTTTG
TTAACGAAATGTACATCGCCTTTATTCTATTTAGTTGCCATTGTTTTTACGAGATGTTCT
TCCCCTTGACGCTGTTTAGTGCCATTGTTCTCGTCTGTCCGTCTCCCCCGATTAGACCGT
AAGCCCGTCAAACGGCAGGGACTGTCTCTATCTGTTGCTGACTTGTTCATTCCAAGCGCT
TAGTACGGTGCTCTGCACATAGTAAGCGCTCAATAAATACTATTGAATGAATACTTGGGG
GCTAGAAAGCACAAAACCAAGGCCTCAACTCTTCGCCAGGAAGGCGCTTACACTAACGTC
TGCTTCGGCCTCGCCCCAGTTTAATAATAACGATTATGGTACTTGTTAAGTGCTTTAAAG
TGCCAAACACCGTTCCAGGCGTTGGGATGGATAATAATAATAATGTTGGTATTTGTTAAG
CGCTTACTATGTGCCGAGCACTGTTCTAAGCGCTGGGGTAGATACAGGGTCAACAGGTTG
TCCCACGTGAGGCTCACGGTTAATCCCCATTTTCCAGATGAGGTACCTGAGGCCCAGAGA
AGTGAAGTGACTTGTCCAAGGTTGACACAGCAGGGTCACGTGGCCGAGCTGGGATGGCAA
CCCAGGTCCTTCCGCCTCCCAGGCCCGTGGCTTTCTCCACTGAGTCAGTTTGGAGCAGGC
CAGCAAGGGAGAGGCGGCTCCCCCAACGTTTCGCAGAAGGTTTGGAGGGTCCCGGGAGGT
GGGGGGCGGGGTCAGTGGCCGGCCGACCAATCAGTGGCCGGGGCTGGCGCGCTCCGCGGA
CTACAATTCCCAGAGGGCTGTGCAGGTCGTGCGCTCCGCGGACTACAATTCCCAGAGGGC
TGTGCAGGTCGCGCGCTCCGGACCAGCCAATCAGCGAGCGCCACCGGAGGGAGGCGCGAG
CATAAAAGCGGGCGCCAGGGGGCGTTTCTTTCTTTCTCTGTGGACCCCGCAGCGAGGCGC
CGGGTGAGTAGCAGAGCGTTGGTTGCAGGGCCCGACTTCCCTGGCCTGCGGGGGCCGGTC
CTCGGGCAGGCACCTTGCTTTCGTCCCCCCACTCGGGATGCCGCGCCGTCGCTTGGAATT
CGGAAAAGGATGGAAAAAGCAAAGGACTTGGGCCTGAAGGCGACCTGGGTTGCATCCCCA
GCTCCGCCATTTGCCTCCTCGGTGACCTTGGGTGGCTTGATTTCCTCGCCTTTTCTCATC
GAGAGCCTGAGATTTAAATACCCTCTAAGACCCCCCCCCAGCCCCTTGTGGGGCAGAGGC
TGTAACCGACCAGGTTATTTTTGTATTAACCTGAGCTTTTAATAGAGTGGTTGGGATATA
ATGATAATGATGACAATGATGATGTTGGTATTTGTCAACCGCCTACTATGTGCAGAGCAC
TGCTCTTAGCGCTGGGGGAGATTTGTGTGATTGTNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NGAATGAATGAAATGAAAGTGACTCGCCCAAAGGTGACAAGTGGGCAGAGCCGGGATTTG
AACCCAATGATCTCTGACTCCCAGGCCCGGGGCTCTTTTCCACTGAGCCTGTAGGGCCCA
TCAGTGGGCAGGGGATTGTCTCTGTCTGTTGCCGAATTGTCCATTCCAAGCGCTTACTAC
AGAGCTCTGCACATAGTAAGCGCTTAATAAGTACTATTGAATGAATATGCGGAGATGGGT
AGGTTCAGAGCTCAGCTTTAGAGAAAGTTGGACACCGCAATCGCTCATGAGTCTTCAGTT
GCATTTATGTTTGAGCTGTGAGTCTCCTCGAAAACTTGTTTGCGTTTTCTGTCTGGTTTT
CGACCTCATAGCCAGTCTTCTCCCTTCTGCATCGCCTATGAGCTTGGACTTTTTAGCATT
TGATAATAATAATAAGAATAATAATAATAATAATGTTGGTATTTGTAAAGCGCTTACTAT
GTGCCGCAGGCCCCAGAACACGCCGTCAGCATGAAGCGGAGAGCGGATCCCTCCCGGCCT
CCCGGCCAGGAGTCCAGGTGAATCGCGGGATAATAACTTTAGCATCGGTTAGGCACTTAC
CATGTGTTAGGCACTGTACTAAGCGCCATCTTCATCACCCTGTTTTGTTTAATGAGATGT
ACATCACCCTGATTCTATTTATTTGCCATTGTTTTTAGGAGATGTTCTTCCCCTTGACTC
TATTGCCATTGTTCTCGTCTGCCCGTCTCCCCCGATTAGACTGTAAGCCCGTCAAAGGGC
AGGGACTGTCTCTATCTGTTGCCGATTTGTCCATTCCAAGCGCTTAGTACAGTGCTCTGC
ACATAGTAAGCGCTCAATAAATACTATTGAATGAATGAATAGAAGCGAGTCGGGCCGGAA
TCGGGTCTGGATGGGCGGCGGTAGGTGGGCTCCCTCGGCATGTTCTTCAAGGGCCGAGGC
TGGACGCAGTAGCCTCGGCGTCTCCAACTGCATGCCACAACAGCCTGGAGAGACTTTGAC
AGCGCAGAGCCTGCCGTGCCTGGTGCTGCCACTCGGCTCTCCCACAGTTGCCCGCGGGCC
GCAAACCTTCTCCCGGATTTGCCCCCGGACCCCCCTCCCCAACGCCCCCTGACCCGCCTC
TCCTGACCTAGGGCCAACGCGCCGGAGCCCGGCTAGCGCCGATGGGGCCTGACCACAGAC
CCAACTTGTCAAGGAAAAGAGTGCAGACTTTGCCACCAGCCACCGGCACAGGTGAGAGGC
GAATGGCCGTTGCCCCCTACCCATCCACCCTACCCACCCTCTGGATCCCTTTCCCATCAG
GTCTGCACACCGACCTGGGTGGTCGTAAATGGAGGGAAAGGAACTGGATGCGGGCCCGAG
TGTCTGGTGTGGAGACAGCGGACCAGGCCCGGTCCTCACAATCACCTGAGAGCCTTTGTC
CGGTAGTGGGAGGGCCTCAGAGCTGCTTCCTAATTTGCGTTCCCATCCTGACAGAGGCCT
GAGCGTTGGCAGTGGAGGCACCAGACCCGGCTGCTGCTGTTGGCGGTAGCCATGTGCTGG
GTAAGTCGGCTGGCAGCAGTGCCGCAAGGGGCAGGACCTTGGGAAGGCCTTCCCCATGAC
AGTGGGGCAGGGGTGGGGCTGTTTCAGTACAGCCTTGGGATGGGATGGACACTACTCTGG
TCTTGCTGGTTAAGGATGACACTCAATGGTGGACATGTATGGATGACACTTGCGGATATG
GGACTGAGACCAGCTGTGAATTAACCCTGGGTGGGCTGGGGCCCTGGGGCTACCCTCACA
GGTCCTCCTCCCCTACCCTCCCTCTAGGCGTGAAGAACCGTGATAAGTTGGAGCCCTGTG
TCTTCCTGAGCTGGAAAGCAAGCAGAAGGATTTGTTGTGCTTGTACATGTCTACAACTGA
CCTTAGGGCCAGAAAGGATTCCTATTGTATATTCTCAACCACCTAATAATAAAGAACCTA
AATAAATATCATTCTTTGTTTGGACTTATGACTGAGGGTACTTAGGGGCAAGGGGCAGGA
ATATTAAGCACTGTACTTACTACTAGGTAGAAATAGGTGGGACAAGGCCTAGTTGGAAGA
AGAGGTATTGAATCCACCATGACCTAAGTTTTAATCCCAGCTCAGCCACTTGTCTGTTGT
ATGGCCTTCATTATTCTGCCTCAATTACCTCATCTGTCAAATGGGGATTAAGACTGAGCT
CCATATGGGACAGAATGCCCAACCTGGTTTGCCTGTATCGCAGGGCTTAGTCCATTTCTT
TACCTATATTTTGCTCTGGAGTCTGCAGGGCAGGACTATTTGGTTGAAGGCAGGGGGCAG
ATGGAAGATGGGAGTTTCTCTTGTCTGCTTCAGTCAATCTATTGTGTGGAGAGCCCTGAA
GTACAATAAAACACCAGGAATTCTCTTCCCACAATGAGTCTAGAGGGGGAGAAAGACATT
AAACTACAGCTTCCTTGGGTGGCAGGGCCTTACCAGGAGGCTGCAGTTGTGGAAGAGGCT
GGACCTCAGTGCATTTGGGCTTTTAACCAAAAGGGCTCT
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1022, 2170..2236, 2831..2930, 3174..3238
1003..1022, 2170..2236, 2831..2930, 3174..3181
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved