Ornithorhynchus_anatinus Locus ENSOANG00000035801
snOPY snoRNA Orthological Gene Database
Ornithorhynchus_anatinus ENSOANG00000035801
Ornithorhynchus_anatinus
ENSOANG00000035801
Contig23414
SNORA26
1405..1522
3978
GTGATTGTGGGCAAGTCACTTCACTTCTCTGGGCCTCAGTGACCTCATCTGGAAAATGG
GGATTAAGACTGTGAGCCCCACGTGGGACAACCTGATACCCTTGTGTCTACCCCAGCGCT
TAGAACAGTGCTCTGCACATAGTAAGCGCTTAACAAAAACCAACATTATTATTCTCTGGG
CCTCAGTCCCCTCATCTGTAAAATGGGGATGAAGACTGTGAGCCCCATGAGGNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTTGTCCATTCCAACCGGTTAGTCC
AGTAGTCGGCACAAAGTAAGCGCTCAATAAATACTCTTGAATGAATGAATCGGGCCAGAA
GGGCTGGGCATGGAGGAATCCTCGACAGAATTCCCAGAATTTCCAGCGCAGCTTTCCCGC
CAGGAGCCCAATCCCAAGGACTTTAGGGTCTGAGTCAGGGTCGGGCCAAGAGAAACCCGA
AACTGTCGGCAGGCCAATGAATAATATTCCTGCTTGACTTATTTCTCTCTTTTACACTCA
TTTCAGTTGTCGCCCCCCCGGACCAAGCTTGTTGCGAGCGGGGAACGTGCCCACCCAACT
TTAAGTTGTACTCATTCATTCCATAGTATTTATTGAGCGCTCAGAACGCACAATTTGGGG
TGCATTCATCTAAGCGCCTAGTACAGTGTTCTGTACCCAATAAGTGTGATCGACTGGGGA
AAACTGCACGGGAGTAACGCGATTTGAATCTCTTGTAGGGTGCCCAAGGGCAGGCCTGCC
CACCCCTTTCGACTGTAGGATGGAGGAGAAGCTGCTGAAAAAGGACCTGAGCGGGTACGG
TGCCACCCGTGCATATATACCCAGGCCGCCAGGGCACGGGATTGGGGTTTTGGGGGTGCA
GAATGGTAACGCGACCCCTTTAATTGTGCTCCCTTAGAGCTGCTTGTGCTCTAAGGGGCA
ACACAGGAGGGAATAACATTCCTCTCTTAAACCCAGAGCTGAGGCTAAAAACTCTCCTCT
GGATCCTGTCGGGAGGCACACTGGTTTGCTGCTGGCCGCTTGAATTTTAAATGACATTGA
ATAAGAATGGGATTTAATAATAATGTTGGTATTTAAGTGCTTACTAGGTGCAGAGCACGG
TTCTAAGCGCTGGGGTAGATACTGGGTCATTAGGTTGTCCCACGTGAGGCTCCCAGTCTT
GACCCCCCCATTTTACAGATGAGGGAACTGAGGCACAGAGACGTGAAGTGACTTGCCCAG
GGTCACATAGCTGACATTCGAACCCATGACCTGACTTCCAAGCCCGGGCTCTTTCCACTG
AGCCACGCTGCTTCTCTGTTTAATAATAATAATAATAATGTTGGTATTTGTTAAGCGCTT
ACTATGTGCCGAGCACCGTTCTAAGCGCTGGGGTAGACACACAGGGGAATCAGGGTGTCC
CACGTGGGGCTCACAGTCTTCATCCCCATTTTACAGATGAGGGAACTGAGGCACAGAGAA
GTGAAGTGACTTGCCCACAGTCACCCAGCTGACAAGTGGCAGAGCTGGGATTCGAACTCA
TGAGCCCTGACTCCAAAGCCCGTGCTCTTTCCAATGAGCCACGCTGCTTCTGTCTTTATT
ACGTGCAAGGCACTGTTCTAAGCGCTGGCGGGTGGATACAAGGTGATCAGGTTGTCCCAC
GTGGGGCTCGGTCTTCATCCCCATTTGACAGATGAGGGAACTGAGGCCCGGAGAAGTGCT
TGCCCCAAATTACACAGCTGGACAAGTGGCGGAGCTGGGATTAGAACTCATGACCTGACT
CCCAAGCCTGTGCTCGTTCCACTGAGCCATGCTGCTTCTCTTAATGGTTTTAGGTCACCG
TTTATTTGTGTATTTATTTGTGGGGAAGGAACCTGAGTACAAATCGTGACACCAGTGTAA
CGGGGCTTAGTGTAGCAGTTCCCATGCGCTTTTTCGCGTGGCATTGTTGGGTGCTTACTA
TGTGCCAGGCGCTGTGCACGGTGGTTGGGTAAAGAAGCGGCGTGGCCTGGAAGTTAGGAG
GACCCGAGTTCTAACCCCCGGCTCTGCCACTGCGACCTAGAACAAGTCAGTTCTCTGGGC
CGCACTTTGCACAGCCCCATCATGTCCCCCATGGAGCCCCGTCTTAATCCCCATTTTGCA
GATGAGAAAACGGGCACAGGGAAGTGACAGGCTCAAGGACACCCAGCAGATGAATGCTGG
AGTCCGGATTATCTCCATTTGCTTCCTGGTGTATTTCACCAAATACCAAGCATCTTTTCA
ATTTAAACTGTGCCAGTGTTTCCATGGCAGACACAAGACAGGACTTTACTTCTCTCTTCC
CCCCCTCTTTTTTTTTTCTTTTAGGAGGAATTCCCTTCCAACTAGGATTATCAGTTGTGA
CGTCCTATGATTTTCATCTCGGAAAGTTTAGAGCTGTCTTGAAGAGCAGCTTAGGTTTGT
AATAATAATAACGTTGGTATTTGTTAAGCGCTTACTATGTGCCGAGCACTGTTCTAAGCG
CTGGGGTAGCCACAGGGGAATCAGGTTGTCCCACGTGGGGCTCACAGTCTTCATCCCCAT
TTTCCAGATGAGGGAACTGAGGCACCGAGAAGTTAAGTGACTCGCCCAAAGTCACACAGC
TGACAAGTGGCCGAGCCGGGCCACTTGGAGGTGAACGTCTCGGAAAGGACTCCCTTCCTT
GGGACGGGCCACCGAAAGGGGTCTAGGTGGGGTGAAGTGTGAAGAGGAGGGAAGAAGATG
TGGGGGGGTCTGTGTATCATTCATTCACTAGTATTTATTGAGCGCTTACTGTGTGCAGAG
CACTGTACTAAGCGAGAAGCTTCTGGGGAAAATGCGTATCCTTGCAGTGAAAGCTCTTCA
AAAAGGATCTTCTGTTCTCCTAGGGCAGCTATGGAGATTCTGTTGCTAATCTTGTTTCAC
TGAAAGATAATACTGTGTACTTTGTATTTTAAATGTATTGCCTGTTTATAGCTGAATGTA
ATAAAGTATAGATTGCTGCCTCTAAGTGTGTCGGATCAGTTCTTCACGGCTGTGGATTTC
CACCAAGGATTTTCCTAATAATAATTGGTAAGCCTGGTCCCTTCTTACAAGGAGCCTATG
ATCTACCATTAATTCAGTCGTATTTGTCGAGCACTTAGTGTGCCAAGCACTGTACTAAGT
GCTTGGGAGAATACAATCTAACAAACACATCCCCTGCCCACAGTGAGCTCTAGAGGGGGA
GACAGACACTAATAAAATGATTTATAGATGTGTATACGTACACATGCTGTGGGGTTGGGA
GGGAGGATGAATGAAGGAGCAAGTAAGAGTGGTACAGAAGGGAGTGGGAGGAGAGGAGGG
CTAGTCAGGGAAGGCTTCTTGGAGATGTGCCTTAAAAAAGGTTTTGAAGGGGGAGAGCAA
TTTTCTGTTGGATATGAGGGAGGATGTTCCAGGCTAGTGGTAGGATGTGGGTGAGAGATA
CAAGGGGAAGAATGCTAGG
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1313, 2844..2978
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved