Ornithorhynchus_anatinus Locus Mono:SNORD88
snOPY snoRNA Orthological Gene Database
Ornithorhynchus_anatinus Mono:SNORD88
Ornithorhynchus_anatinus
Mono:SNORD88
scaffold_70
SNORD88
1001..1089
3759
GGCACGAATCCGCATGCTCCCTCAGATTGAGCTTGGGTTTCTCCCGCGGGAGAGTGGAA
GCTCCTGGGGTAGGAGAGCCCCGGCCCGAATTAGGCAGCCCGGGACGCTCTCTCCCTCTG
TCCGCGCCATGTCGGCTGCACGCCGCCCGGGCCTCTTGACCATTTTGGGGGCGAGAGTGA
GGTCAGCAGGGGCGTGGTAGTGGATTCGTCAGGAGGATTTCCAGTCCAGTGCTGGCCACG
GGCTCTCAGATCTTTAGGAAACCGCTGCTGGGTTTTTTTGCCCTCCCGTTTGTGGGAAGC
TGGCTTGTTTGTGCAAGTGAAACAGGCTCTGATGGAAAGGGCCCAGTGTGCGCGTTTTCC
TGTAGAACGGGAAGAAAACATAAGGCTACCAAGGAACCAGCGAGTCTCCAAGTGAATTAC
AGGGTTGTTTCTGCGAACCAGGTAGGAGCAGACTTGGCAGACGAGGCCTGTGTTCAATCC
TGACAGTCATTGTTGTTAGAATCGGTGTTAATAGCCGGGCGTGGTGGCTCACGCCTGTAA
TCCCAGCACTCGGAAGGCTGAGGTGGGAGGATCGTTGCGAGTTCGAGACCAGCCTGGGCT
ACAAAGTGAGCTCGAGGCCAGCCTGTACTGCATAGCGAGACCCCGTCTCAAAAAAGAGAA
TCAGTGTTAATAACTTTTTTTTGGCATAAATCATTGAGGATGTCACGACCCAGCCCAAAG
CTATCACATCTTGGCTTTGTTTTTTACTAGAACAGTACCTTTTCTCCTCGTTTCTTTGAG
GACGTAATTTCTCAGCAGCCTGCACACAGTGAAGCCAGAACAGGCAAACACCAGGGTTCT
TTTCCCGTAGTGGGTGTGGAGCGCAGCCCATGGGGGCGGGGGGGGGACTCCCCTCTGATA
CTGGGGCTGTTGAGGTCTTCTGGTGTGTGTTTGTGTGCTCTCTTCACTTGGCATGTGTCT
GTCCCTGAAGGCAAGTGGATCTGGTTTCAAAGAGGCTGAGGGGACCCCCCCATGATGTCC
AGCACTGGGCTCTGATCCATGAGGATACAGTGCCCCCCAGGACCTTTGACACCTGGGGGT
CTGAAGGGCCCCAGTATTGGTGTTCTGTGTCCATGGACTACACCCACACACGCCCTTAGC
AGGTACTTTTGTTACAGGTGTCTCTAATAGCCGTTTGCCGTCTCCCCATCGAGGTAAGAA
CCCCTGCTTTCACTGCTGGTCACTCCGCATTTAAAAATATTTCACCCTCATCTTGGTCAA
CAGTAGGAGAGGTGTATGGGTCCTGAGTTTATGTGCCAACAATTGCACTTAGAATTTGCA
TAAAAAAACTGTCTCAAGGCTGTGGAAACCACGTTAATTAGACCTGGATTCAGATCCCTA
CCCTCCCTTTTTTAGACCTGGAGATGCTGAGAGGTGACCTCCTGAGCCTGTCAGGAGGGC
ATGAGCAAATCCTTCATACAGGGACGGGGATGGTTCCTAACCTTCAGAGAGAAAGATTAA
TACATGGGATGGAAAAAGTGTCATACAAACCTAGTTTTCAAAATCCTGACAGTAGTGTTG
GGACAGAGACAAAATGAGTTTGACCACTGCAGTCGGTCGCATGGTGGGTTTTTTTTTTTT
TTTTTTTTTTTTTTTTTGGCTTTTTCCTTTTTATCGGTACGGGGTGGAACTCACAACTGC
CTGCTTGCAGGCAGGTGCTTATGCCGCTGAGCTAAATCCCCAGCCCCTGCATGGTGGCTT
TTGTGAGCTGAATGTGCCGAGTACCCAAGTGAGGCTTAGTTGGGTCCCAGTGAATCAACT
ATTTGAATGTTACTAAAAAGCAGCCATGGATATACACAGTGAGCGATGGAAAGTGAGAGG
GTTTTTGCTGCTGTTTGAAAGAGCTGGGTTGGGAGACAGTTACATGTGTTAGAAAAAAAG
GACACTGGGAGGGTTCCCTCTGTGGCTAGGGTGCACAGAGCAGGGGGGACAGTGGCCTTG
AGAAAGGGCATCCTCTGCAGCTGCCAGGCTAGGGAGTTCCTAGAGGAGGTGCCAGTTGGG
GCACTGGTTGCTGGGTGAGTGGTGGTTGTCATTTTATTTAGTGGCAGCAACAATAGATGG
CACACAATACATGGGGTATTTATGGTTGCCAACTGGTAGTGAATGCTTGTTAAGAACAAA
CTGCAGGGTGGAACCGGATGGGAGCCATGGCCTGGTCACTTTCTGGCGTCATTCTCTGCA
TGGCTTGTGCTATATCCTGCAGGTGGCAGGGGCTGGGGATTTAGCTCAGCGGCATAAGCG
CCTGCCTTGCAAGCAGGCAGTCTTGAGTTCAATCCCCGGTACAGATAAAAAGGAAAAAGA
CCAAAAAAAAAAGACTGCAGGTGGCCCTGGGACCTATGGGGCTAGTGAGCAGCAGGGTCC
CTGTGATGTCCAGCACTGGGCTCTGACCATGAGGACATGGTGCCTCCTGGGACCTTTGAC
ACCTAGGAGTCTGAGGAGCCCTGGCTCCAGAGAGGGGCCGGGTGATGTGGTTTCCCTGCA
CCCCACCAGTCTCTTCCCCCACCCACAGCCGATCTTCTTGAAGCTGAAAGTTCCCACCTG
TGCAACTGCAGGTAAGGGTAAGGGGAGCGGGACCCTGATGCTAGGTGAGCGGTGCACTCC
CCAGAAAGCCCTCACTCAGGGCTATGCCTGGGGCCTCTGTGATGTCCAGCACTGGGCTCC
GAGCTCTGTGAGGACATGGTGCCCCCCGGGACCTTTGACACCCGGGGGTCTGAGGGGCCC
CACTCCAGGGAGATGCTGGGGTGGGTAGTGGCCCTTTCTGCTTCCCAGTGCCCTCTCTCT
CTGTCGCCCCCACAGCTTCTGAAGCAGCACTCCCGAGGGGCCTTGCCTCTGGGCCGGCGT
GACCGGGACTGAGCAAGCACTAGCATCCACCCAAGCCAGCTGGAGAGAGCTCACCATCAC
CCCTATCCTGCTGGTGTGCAGTCGGGCCAGACCCTGTCCTTGAATCGAGAGCTGGGGCTG
CCGAAGGCCTGGCCCTGGTGCCAGGAGTCCGACCCTCTGCAGATACGTCCAGTGCACTGT
CCTGCTCTTCTGGCCCTTGACCTGGGGGGTGGGTGGGCAGCATCTTCCATGTCTGCCTTG
AGCTGCCCTCACCCTGCCTTGCAGCAACGACCACCTGCTATTGAAGGAAGTGACCTGTGA
GTGACCAGGCCCACCCACAAGGACCTCTTAGACTGGGTGCTGTCTCACACCCGCCCCAGG
AGAGGGTGGATGAGCAGCTCGAAGACCTTGTAGGGCTGCACCTGGAAGAGGCCTTTCCTG
TGTGTCCACCCCTGGAGCCCCACTGCCCCACTAGGGTGTGCTGTCTGCTGCATTCAGCCC
TGCCACAGGGCTGAGCTATAGACCCCTCTGGTCCCCAAGGTGAAAGCATCTTAAGTTCTC
ACTTTTAAAAGTTTTTTAATGCGTGTTCTTAATCCTTGTCCTGATGGACACCAGCCTCAG
CAGGCTCATCTACCTCTTTAACAGCTTGCCTCTCACAGCCCTATCTGGCTCTTTGTCTGG
TTTTTTCTTGCGGGTGGTTCCCCTCCCTCTGCGAGCCAGCTTTGGGGCGCGCTGACCCCT
CCCAGCGGCTCTGGCCATCCCCGGGCCTGGGTCCCGGGGGATCTGCACAAACAGGGTTCC
GACGACTCTGCTGTCACAGGCACTGCTAAATGGGTGCTGTGCCCTTCCTGAGCCGAGGTG
TTTGGTGCGGTCCGTGTGCAGGCGGGGCGCCGGTCCGGGC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved