Ornithorhynchus_anatinus Locus Mono:SCARNA6
snOPY snoRNA Orthological Gene Database
Ornithorhynchus_anatinus Mono:SCARNA6
Ornithorhynchus_anatinus
Mono:SCARNA6
Contig223497
SCARNA6
46..311
891
AGCCCTTAGTTCGGTGCTTTGCACATAGTAAGCTCCCCACACTAAGGCTCCTATTGAAT
GAAAGACAGTCCCTTTATTGCTCTTAGGGACTCCCAGCAGCTCCTCCGTGAAAATCTCTC
AAAGAGTGAGGTTGTTTGGTATTTGTGTGCTGGTGTTGCGCATAGCTTGTGATGCACTCA
GGCTGGGATAGCGAGAGAGGAATGGAGAGACAACCGCCCCTTGAGCATCCAACAAAATTA
ATCACAAAGGAGGTATTATTGGGGCCGTGAGGACTGTGGTCGTACATGATTCTAAGTTTT
CAAGCTGAAATCTCTTGGGGACTTAAGACAGGAATCATGGAGTGAAAAAGCATATTGAAC
AACTACTCTGAATGACCACATTCCTCTTTCTATAAAATATGCCACGCTCATCAACCCGCT
TCCCTAATAAAACACTTTTGCCATATATTGGTTATGAAATGGATTTTCTTTTTGCTCTGG
TATTGTAGTGTCCTATGTGTATACTTACCTATATATCCTTAATTTATGTATATTAATGTG
TCTCCCCCTGACAACTCATTGTGGGCTAGGAACATATCTGCCAACTCAGATACATGGCCA
TAGAGTACTCTCCCAAATTCCTTTGACAATGCACTGCACACATTAATCCCTCTATAAATA
TGACTGACTGGGGCTTTTTCCTAGGCACTGTAAATATATTTGGCCTGTAAAAGAGGTGGG
TTTTCGTCCATCTACTGCATCATAAAATCCCCAAAACTTCAACAAAAATGCCTCCACTCA
ATCTTAGCTAGTTATTGAGTGCTTACTATGTGCTAAGCTCGTAACTATGCGCTTGTGACA
GTATCATACAAAAATATTCTCTAACTCTTTTGCTGACTGCACTGTCCGTCCC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved