Ornithorhynchus_anatinus Locus Mono:SNORA65
snOPY snoRNA Orthological Gene Database
Ornithorhynchus_anatinus Mono:SNORA65
Ornithorhynchus_anatinus
Mono:SNORA65
Contig220234
SNORA65
415..545
844
TGATTGGGCCCGGAGTTCAACAGGTGCCTTAACTAATCTTTTTGTCTTGCTTCAGATTG
AGGTGGTGCCCTCTGCCTCGGCCCTGATTATCAAAGCCCTTAAAGAACCACCACGTGACA
GAAAGAAGCAAAAAAACAGTAAGTTTTCTCCCCAATGAATTGGGCTATGAGAGTTTATGA
GATACCCAGGCTGGATGGCTGTATATACACCACACTGCACACTGAATGTGTTCCCAGTTA
AGGACAGAGGTGCCAAGGTGGGGTGCAGGGAGGGGCATATTTCTTTGATCTGTATGGGGA
TCAGTGGAAGGGGAAAGTTCTTCAAGGACTTGGTGGATGGCTTAGACCCTTGGGAAGGAT
CACTTACCTGCCCTTCGAAATGAATGTCACAGATATTGTTTTTTTCATTTAGCCACCCGC
CACTGTGCCTAATCACTAATAACGTTGGTGGGCACAATCCAGTGGTGAGCTGATATAAAA
CCCCAGCTTAGGAAACAGGGTTATTCTGCTTGTGGATGACTCTGTGCCGAAAGCATGGGA
ACAACCCATGGTGAAACCAATAAATTGGTGAAGGGGTGCAGTCCACTTGGTGGGATCTTT
CACCGTGTGAGTGGCATTCTAGGGTCTAACTGATGGGCTGTGGTTTCTTTTCTGCAGTCA
AACACAGTGGCAATGTCAGCTTTGACGAATTTGTCAGTATTGCTCGTCAGATGAGGCATC
GATCCTTGGCCAGGGACCTTTTCTGGTAAGTTAGACAACTCCTGTTCCTCAAAGCTAATA
AATAACTGGACTTTGTTAAGCACTGGGGGTTTGATCCCAGGTAATTAGCTTGGAGGCTGT
CCCTG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved