Ornithorhynchus_anatinus Locus Mono:SNORD123
snOPY snoRNA Orthological Gene Database
Ornithorhynchus_anatinus Mono:SNORD123
Ornithorhynchus_anatinus
Mono:SNORD123
Contig22
SNORD123
1001..1069
2069
TAAATAAAAAGCCCCTAAAGTTGTATGCATTCAATTGCTGATAATGATAATTCATTCAT
TCATTCAATAGTATTTATTGAGCGCTTACTATGTGCAGAGCACTGTACTAAGCGCTTGGG
ATGAACAAGTCGGCAACAGATAGAGACAGTCCCTGCCGTTTGACGGGCTTACGGTCTAAT
CGGGGGAGACGGACAGACAAGAACAATGGCACTAAACAGCGTCAAGGGGAAGAACATCTC
GTAAAAACAATGGCAACTAAATAGAATCAAGGCGATGTACAATTCATTAACAAAATAAAT
AGGGTAACGAAAATATATACAGTTGAGCGGACGAGTACGGTGCTGTGGGGATGGGAAGGG
AGAGGTGGAGGAGCAGAGGGAAAAGGGGAAAATGAGGCTTTAACTGCGGAGAGGTAAAGG
GGGGATGGCAGAGGGAGTAGAGGGGGAAGAGGAGCTCAGTCTGGGAAGGCCTCTTGGAGG
AGGTGATTTTTAAGTAAGGTTTTGAAGAGGGAAAGAGAATCAGTTATAGTGGTGTTCGTT
AAGCACTTCCTCTATGCCAGGGACTGTACTAAGCTCTGGCGTAGACACAAGCAAATCGGG
TTGGACACAGTCCCTGTCCCACCTAGGGCTCACAGTCTCAATCCCCATTTTTCGGATAGG
TCACTGAGGCCCAGAGAAGGGAAGTCATTTGCCCAAGGTCACACAGCAGACAAGTGGCAG
GATTAGAACCCATGACCTTCTGACTTCCAGGCCCTTGGTCTAGCCACTAGGTCACGCTTC
TCCCGGGCCATGCTGCTTAGGCATTCTCTGTCATAAGACTCTGATGAATTATGGAGATGC
ATCAGAGAACTACTACGTCTTTAGATTTCTCAGTTTTGAAGTACATATTTTAAGAAAATT
TCTTTTTTTTATAAACTCTTATTAAACAATTAATCAATAACTTTCCACATGAGCACTTAA
AGCACAATTTAAGTCTCTAAGGAAAAAAAATCTAAATGCTTGGTGAAAATGATGAATATT
GGGGAACTGATTTATGCGACTTGAAAAGGCCATCCATTTCCTGATTCACCTTGATTTCTT
TTAGAAGGAATACAAGCTTAATCAACCACTTCTGTGAATTGATTTAACCATTTTTTGTCT
TTACTCTTCTCATACCACTTTCATTTCAGCCGTTTTCCTAAATTGACATCTTGGAGAAGC
AGAACAAAGATGGGGAGAAAGTGAAAAGTGCCTTGAAGAAATCCACGAGCTGCCTGGGAT
CCTGATTGACATAAAAAGGAAATTTGAATTCTTTGTCTGGAGTCTTTTTTAAAAAAAAAA
AGGAGCAATGAGATGGTGTTAAAATGATAAAAAGAAAAAAAAATCTACTACCTACAGACC
GGAGGCTGTGGCCTCTTCACACTTAAATCTTAATTGGTCGGTTCTGCATATCAAAGAGAT
CTAGGAAAGCCTAGGAGATCTAGGGTCTTGGGTGGCTCTGTTATCACCTATTTTCTTTTA
GTGTGCTTCTTACAAAGGCAAAGTGCTACTCATTTGGTGGTTTGTTTATTTTGGGGGTGG
GGAGGGAGGGCGTCGGAGAGTTTTGCTTCTGAGTGTTCCAAGATGCAGCAATATTAAAAC
TCTCACTTCTGAGTGTAGGTATGCTGTACTGCGAATTTGATACACTATGGGTATCAATGT
GTCCTACATTCATCTACCTTTGAATCTTTAAAAAAAGATGTTAATTGCTGTTTAACTGTG
TAATCACAACAACAGTTGTGCCAAGGGATAACCAATTTATTTGCTACATCATATAGACCG
ATGAACATACAGTGACCTTCAGATAAAAGAATAAATCTATTGAATAGATCAACCTGATGT
GGAATATTTCCTTTAAAGTACAGAGAATCGCTGCCAATGAAGCGTGTTATCTGCATGCCA
AGGTTTTGTTTTGAGCAGATGTCCAATTTATTAAGGATATTTAGCAATAATTATCTCGGG
CAAAGAACTTATTACATTTTTGCATCAATAGGTTGGGTTTCTTCGCTAACACCGTGCCAT
TTGACAATGAAAATGGCAAACAACAACAAA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved