Ornithorhynchus_anatinus Locus ENSOANG00000014958
snOPY snoRNA Orthological Gene Database
Ornithorhynchus_anatinus ENSOANG00000014958
Ornithorhynchus_anatinus
ENSOANG00000014958
Contig21556
SNORD16, SNORD18, SNORD16, SNORD18
829..930, 1288..1360, 1726..1827, 2218..2288
3410
AATTACAGATACATAAGGGCCTAGACAATCGATGGTATTTACTGAGCGCTTACTTTGTG
CAGAGCACTGTACTAAGCACTTGGGAAAGTTCAATCCAATAGAGTCGGTATACATGTTCC
TGGCCCACAACAAGCTTAGACGGCTTGCTGTGTGGGGGGGACCGTACTAAGCGCTTGGGA
GAGGGCAGTAGAGTAGACACTTCCTGCCCACAGTGAGCTCGCCGTGTAGCCAGACTACCC
AGTCTAAGGGCAGAGGCAAGGTGTTTTAATCCTCATTTCACAGATGAGGAAGCAGAGGCC
ATGAGGGACTAGCCCAAGGTCAGACACGCTAGGCAAGTGGCGGGGCTGGGATTAGAACCC
AGGTCTCCTGACTCAGTCCTGTGCTCTTTCCACTAGGCCACGCGGCTTCTCCTTAAGGGG
GCCCAGGAGCCTCTGGACAGCGACTGGTTGGGGTGCCTGGAGGTGAAATTGCCCACCCCC
CCGGGAGGGAGAAACATCTTTAAATCAGCTTTTCCTGGCCATTCGCTACCCAGGCAAAGG
TTGGGGTCTGCCCGATTCTCTAAAGTAAAAGGTATATCAGTTTTTGAATGAATGTCTTCT
TCCTCCCTAACAGAATTGGTATTTATGATTAAGAGTTAGCTGGGCCGTATGGCTACCATT
TTAAATAACTGACTTTGTCGTTTGGACAAACTGAATGATTAGGGAAACTAGGTGCTACTG
TGGGCCTGAGGTCGTAACCTGCTGAGCATAGACGCGTGAAAGGGGAAGAATTAGAAGATT
CTTTGGAAACGAACCCCAAGCCATCTCTCCGTAATAGGATTGGGAACATTGCTATGATGC
TGTAATTTGCGTCTTATCCAAGCGTTCGGCGGCAGTTGCCTGCTGCCAGAAAGCTGGCGC
TCTTTGGATGACGATTACTCGTGACTGAGCAATGCTTAGTGAAGCTGTTGAAATGGGATC
CGCTGCCGAAGAAACTCATCTCTCCATTTCTTTTTTCCCCCCAGGCTTGTACACGTCCGC
TAATCTCGGTGTACTCCGAAAAGGGGGAGGTGTCTGGCAAAAATGTTACGATGCCCGCAG
TCTTCCGGGCTCCCATCCGTCCAGACATCGTTAACTTTGTTCACACCAACCTGCGCAAAA
ACAACAGACAACCTTATGCCGTCAGTGAACTTGCAGGTACTGTCTGTATACTAAGACTGG
ATTTGAAAAGTAGCTTCAAGTCTGGAAGCTGCGTTATGGGAGGGGGTGTGTAGCCGGGAA
GGTCTGGCTACAAAAAGGTTATGCCTCACGGTAATGATGAAATTCCACCTCATTGGTCCG
TGTTTCTGAGCCACATGATTTGTTCTGGAAGTTCTGACACTGGGCATGAGTACGGTGTTC
AGGGATGATTTCTTCTGGGGGTCTTGGGGAGTAAATGTGCTCTCTTCTCTTTCCCCAGGT
CATCAGACCAGTGCTGAGTCCTGGGGTACCGGCAGGGCTGTTGCCCGTATTCCCCGGGTG
AGGGGCGGTGGAACTCACCGCTCTGGCCAGGGTGCTTTTGGAAACGTATCCTTTAGCTTT
GCCGCCTAGATGCCGACCGTAGAGAATTGGTGGTCAGAATGGCCCTGGGGAAATGTTCTT
ATTGGGGGGGTGTTGGGGAAAGGGGGAGTGAGGCTCACTCACTAGCACTGTGTGGTTGGT
GGGGATGAGGGTAGAACCTTCTGAGATTAAGGGAAATATAGTAGCTTGCCATGATGTCGT
AATTTGCGTCTTACTCTGTTCTCAGTGACAGTTGCCTGCTGTCAAGAAGCTGGTACAGAA
GGTTGACGAAAAGAAATCTCACTGAGCTAAGCTTTAACGGTCTCGCCGCTGTTCATTTAA
AAGCTGGAAGCGTCATTTCTTAACTGGGGAAATAGATGTGCCGAGGCGGTCGCATGTTTG
CGCCAACCAAGACTTGGCGCCGCTGGCACCGTAGAGTGAACACCACTCAGAAGCGCTATG
CCATCTGCTCGGCTCTGGCGGCTTCTGCCCTGCCAGCCCTGGTCATGTCGAAAGGTGAGT
GGTGATGGTCGTCGGATTCTGAAGATCAAAATGTGCGGGCCGCGTGAACACCAGTTTCGG
AGCAGCCAGCCATTGAGAAGTGGCGTGGATTTATAATTTGGGAGGACCCAGAGATGTTTC
CGGTTCATCTCCTGAGGTCGTTACCTTTGCGCCTTCACCAAACTCATTGTTCCTGCTGCT
AAAGTGATGAGATTCCACTTCATTGGTCCGTGTTTCTGAAACTCATGATATGGTGGAAGT
TCTGATTTGGCAGAATCCTAAGGCGCAGAATGATCCAGTGAAAAGATTTCAGTGTTCAGT
TGTGGAAACTGATGTCAGAGAACTTGGGGAGATTAACTTCCCAGGTGGCCATGGCTTCCA
TATTCCATGTCGGTGGGGGGAAAGCAGCCTGACTTTTGGGCAAAAGGCTTAATTTTAACA
TTCACATGCTTAATCAGACCGGGGTTAATGGTAATCAATAAATTAGAGAAGCAGCGTGGC
TCAGTGGAAAGAGCCCGGGCTTGAGTCAGAGGTCATGAGTTCGAATCCCAGCTCTGCCAC
TTGTCAGATGTGTGACTGTGGGCAAGTCACTTCACTTCTCTGTGCCTCAGTTCCCTCATC
TGTAAAATGGGAATTAATTGTGAGCCTCACGTGGGACAACCTGATAATCCTGTATCTACC
CCAGCTATTAGAACAGTGCTCGGCACATAGTAAGCGCTTAACAAATACCAACATTATTAT
TAACATTATTAAATGGGTCTTTATTGAGCACCTACTGTGCAGATCACTATATTGAGCTCT
TGGGAGAGGACAGTATAACAGCGCTGATAGACACGGTCCCTGACCCCAAGGAGCTTACTT
AGAGTCTAGAGGTAACCAGTGTAATGCTTCTGTCCAGGACACCGAATTGAGGAAATCCCA
GAACTTCCTCTGGTGGTCGAAGACAAGGTTGAGGGATACAAGAAGACCAAGGAAGCCGTT
CTCCTTCTCAAAAAGCTTAAGGCTTGGAACGACATCAAAAAGGTGAGCTTGGACTGATGT
AATGGTGGAGGATCAAGTGCTGGGGCAATGTTGACGTGAGACGATTGCTGCCGTCTTCTT
CCCCCCGGGGCTTCTGTGTGGACATGCAGAAAAAGGATTTGAACGAGGCGGGAGTGAGAA
CCAGGAAGGGATGGCAACAAGAACTGCAGGTTAATGAGCTGTGAGGTTGTCTTTGACCTC
CCAGGGTGGCTAAGGAATTCTTCCTTGTAGCCTCACCAGAAATTTTTCTTTTTATTTTTT
GACACTTGTAAAGTGCTTAGTATGCCAGGTGCTGGGGTAGATACAAGCTAATCAGGTGGT
AGACTGGTTGTGAGCAGGGATCGTTTCTGTTATATTGTACTCTCTCAAGCA
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1175, 1438..1544, 1895..2033, 2917..3260
1001..1175, 1438..1544, 1895..2033, 2917..3044
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved