Ornithorhynchus_anatinus Locus Mono:SNORD101
snOPY snoRNA Orthological Gene Database
Ornithorhynchus_anatinus Mono:SNORD101
Ornithorhynchus_anatinus
Mono:SNORD101
Contig214997
SNORD101
194..265
765
AAAGGTGGTGGTACTTGGGCCGGTGCACTAGCTAACAGTTTGAAAAGGTGGCCAGCGGT
AGGCGGGAGGGGTGTAACAAACCTTGATGCCTTTTTGGAGGGTCTGTGTAACTAGGTACA
GTTAATGGTAAGGCAAGAAGGGAATTAGTGGAAGAATAAAGGCATCGGATCTTACGTGAG
GCAGTCACCTACAGGACTTGAATGATGACTAGATTGTCGGATACCCCTACACTCCAACGT
ATGAGTGAAAAAAAAGTCTGACAATCCTGTAGGATTATTGTGTGGCAGGAACGTGGCGAG
GGAGAAATGAAAACGTTGATCTTGGCACAAGCTGTGTTCAACAGGTTTTTCAGATTATTG
CATCTCCTTGTCGTTTTTATCCACTGACAGTGGGGGCTTTTCCTTGGAAAACTGACTACA
AAGTTATGAAAAGTGTATGGAAAAATGATGAATTAGATTCAGGTGTGAGTTATAAAGGGG
ACTAACTATCTTCTGGACTGGAGATGGGAGTTTATTTTCTACTTCTGGTTTTGATTTAGC
TTTTTGGAAACTGGTAATACGAATATTCACAAGCTTCACTCTAGTGAAGCTTAAGTCTTT
CGTGCTAGCTTTTATGGAAAAGTAGTAGGAAAGTCTCTAGTAATGAAGAAAATGTTCCAT
TTAATGAATACTAGCATTTTGTTTATATATACTATATATCAAGCGTTGTATTAAGGTAGA
TGAAAGATCAGGGGTAAGCAGATGGGGAAATAGACATGGACTTGGT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved