Ornithorhynchus_anatinus Locus Mono:snoR38
snOPY snoRNA Orthological Gene Database
Ornithorhynchus_anatinus Mono:snoR38
Ornithorhynchus_anatinus
Mono:snoR38
Contig21402
snoR38
1001..1075
2075
TATTATCTGTGCTTAAACTATCTCATCTGTAAATTAGGGATTTAAGACTGTGAGCCCCA
TGTGGGACAGGGGTTGCGTCCAATCTGGTTAGCTTGTATCCACCCTAGCGCTTATTACAG
TCCCTGGGTCACAGCGCTTAACAAATACCATCACTATTAATTATTCGTGCAGATCAGAGA
CCTCGATTTCCCCATCTGGAAAAAAAGGATGAAATCCTTGCTGTCTTGTGGCCTGCGAGT
CCCGTGATGTATCCGATCTGATTATCAGGGAGAATATGTCTGATTATATTAATGTCCGTC
TCCCCCTTCTAAACGGTAAGCTTGTGGGCAGGGAACATGTCTACCGACTCTGTTGTAGTG
GATTCTCCCAAGCGCTCAGTATAGTGGTCTGCACAGAGTAAGCGCTCAGTAAAATCACTT
ATGGGTTGATCTTTCCATTCCAGCGTTTGGCACGTAGGAAACGCGTAGTGGATATCGAAT
TATCCTTTTCCCTACGGTGGCAATTGGCGCCTGGGGGAAATGGGGTGAGCCGAGCCGGAT
CGTGACTTCTGGGGGTCGCGGACCCGACCCTCCAGCTCCCGGACTGAAAAAGTAAGCAAT
GTCGGGGGGTTGCTTGGGTCTGGAAATGGGGGGAGGTTGCCTGCATCCCATCGGCCAGCA
ATCTGTCCTTAAGCCGCCCTGAAATCCTGCCACAAAAATGTGGACCATGAGGCTTTGGCA
ATGGGGATTGAATATTAACGGGAGAAGTACCTTTTCTCCGGACGGTGGCCACCTCCAGCA
TCCAGCACAGTACTTGGCATGTAATAAGTGCCTAACGAATGCCCGGATTTCTCCCATTTT
CCCTGCTGAAAAGTAGTTTAAAGGGAGCAGGCCCATGTGCTACTGCATTCTGCAGTCACC
TGGCGACACAGGGCTAGCCATGGCACGTGCTATGGTGTTAGAGGTGATGTATGGAATCCA
GCTCCGGCTGAACTGCCCTTGGGTGGAGTTAAATCGGAAGAGCGAGCTAGTGATGAGTAA
AAGTTATCCCTGTCTGAACAAAATCCTTTGTGGAATTTTGATTTCCTGAGGCTCAGCTCT
GCAGCGTTCCCAGCATAAAGTCTCTTTATTGCCTGTCATTTTGGGGGCAGTTCTCATGAG
TGGTAGTCTCTGAAATTCCCAGGGTGGACCATCTCCTCCTGGACCAGGACAAGAGACAGC
AGACAAGAATGTCATCCTTACATTCCTGAGAGCGTTGAGGTGCTGGCTACAGTATCTGGA
AGTGCCCTCCTCTAGTTGGTAAGGAACTTTTTTGTGGGTCGGGCATGTGGGTGAGTGAGT
CTGTTTTTGCCATGTGATGGACAGTAAAATTGGGGGACTCCTGATAAGGCCTAGTGGAGA
AGCCCAGGCCTGGGAGTCAGAGAACCTGGGTTTTCACCCCACTCTGCCACTGGCCTGTTG
TGTGACCTCGAGCAAGTCACCTAACTTTTCTGGGCCTTAGTTGCCTAATGGAGATTAAAT
CCTATTCTCTATTTTTTGAGAGCTGCAAATGGGACAGGGACTGTGTCCACCCTGATTTTT
TTTTATGTGCCCCAGTGCTTAATATGGGGCTTGGCACATAATAAGCACCTATTAGGTACT
ATCTCCAGGAAAAGCCAAAGATGGTCTGGGTCCACAGTGGGGAGCATTCAACGCAACCCT
TTTAGGGCTGGTTAAGAGCTGGTGTCGGTCACTGAGTTGGAGGTGTTAGAGCCCTACCGT
GTGCAGAGTGCTGTTCTAAGAGGCCACGTCGAGGGAGAGCTGAGTTGATGATGCTACTGA
GTTATCCCTGACTGAAGAGGAATATTCCTCCCCTTGTGGAGATCAGACTTGCTGAACTTG
AAGCTCTCCCAGCAGCTGGAAGCAAATCCAGGAGGGGCAGAGGCCTAGGGGCAGCTGGGC
TTTATCTGTCCCTCTGTGGCATCTTCCCCAGGGTGCTGCGTGCATGAAGCTGAGGGCTAA
TGGATCCAGTTCCGAGATTCCTCCGACAACTCCGGGCGACCGGCATTTAGACGCCAGGGA
AGAGGGTAAGAGCGGCTGCCTTCCTGAGACCTGGGA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved