Ornithorhynchus_anatinus Locus Mono:SNORD2
snOPY snoRNA Orthological Gene Database
Ornithorhynchus_anatinus Mono:SNORD2
Ornithorhynchus_anatinus
Mono:SNORD2
Contig213555
SNORD2
131..211
723
TTTGAGAAAACCTTCAGCCCATCCAGCAGAAGAGCCATCATCCCCTGCATTCAAAGGAA
AGGCCGTCCCGAGGGGGGGCGGCGGTCGCCATCCCCCGCCCTCCCCTCCCCGGCCCCCGG
CGGCGTCCCTCGAGTGACGTGATGGCATACCATCTTTCGGGACTGACCTGAGATGGAGAT
GGAAAAAAAAAAGTAAAGTCTGCTGATCACTTATTTCATCGGGCGAAAGTCACCTACCAG
AAGGCATACGTGGTGTAAACTGACGAAATGACGAGTGTGGGAACAGTAAATATGTTTCCT
ACTTTTTTTAGGGTATGATGTGATTGCTCAAGCTCAGTCAGGTACTGGCAAGACAGCCAC
ATTTGCTATTTCCATCCTGCAACAGTTGGAGATTGAGCTCAAGGAGACCCAAGCACTAGT
ATTGGCCCCCACCAGAGAACTGGCTCAACAGGTATTGATAGTGTAGATTTAAAAAAAAAA
AAAAGAAAAAAAAACTGCTTGCGTGTTGCATAGGTTTCACGTTTCACAACTGAAGGATGC
CCCTCGCCGAACCGGTCCATTGAGAACCGTCCTTTTAATGGGAAAGCAAGACCTATTTCC
AGTCCCGTCCCGTCCCCCCCTTTTTTTCTCCTGGTCCACGTAGGGAGCTTATCTGTGCTT
TATTTGAAGGTAGGCTGGGACTGGGTACCAGGTGGAAGTTGCTACGCTGTGCAAGGCCGC
GTCC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved