Ornithorhynchus_anatinus Locus CHD4b
snOPY snoRNA Orthological Gene Database
Ornithorhynchus_anatinus CHD4b
Ornithorhynchus_anatinus
CHD4b
Contig21276
SCARNA11
11156..11298
15247
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNCCCCCCATTTGGGGGTTGTGGGGGGGATGGGG
TAGACACCCAACCACTGGGGACGGGGTGAAGACGTGGGCCCCGGGCTGACGTCCAGCCGG
CGTGCCGACACCTGCTCGGAGGGCCCGGGCTGGGAGGGGCCCGGGCGGTCCGTTCCCAGG
GCTCACCCGCCCCTTCGGGCTCACCCCCAGGGAACGATGAGGATCCCGAGGAGGACCTGT
CCGAAGCCGAGACTCCCAAACTCAAGAAGAAAAAGAAGCCCAAGAAGCCCCGTGACCCCA
AAATCCCCAAGAGCAAGAGGCAGAAAAAAGAGGTCAGTGGCCGTCGGGCTCTGGGGCTCG
GCGGGGGCGGCGGGGGACTGGCGGCCAGGCAAGGTGGGCTGTGGCGGGCAGGGGTGGGGG
GCGGCGGCGTGTTTGCGTCTCCCTCCCCCCGTCTCCATCCCGTGCTCTTGCGCCGGCAGC
TGGGGGACAGCTCGGGGGAGGGGCCCGAGTTCGTAGAGGAGGAGGACGAGGCGGCGCTGC
TGCGCTCGGACAGCGAGGGCAGCGACTACACCCCCGGCAAGAAGAAGAAGAAGAAGATCG
GCCCCAAGAAAGAGAAGAAGAGCAAGTCGAAGCGGAAAGAGGAGGAGGATGACGACGATG
ACGACGACGACTCCAAGGTGGCCTTTTCCACCTCTCCCCCTCCCCTTTTCCCCTCCATCT
TTTCCAGCCCATCAATTAATCAATCACTTGTTCGCTGGTAGTTAGCGCTTGGCCGTGGGT
AGGGCGCGGTGCTCAGACGAGGACAGCGATCCGTCGGTCAGTGGCGTTTATCGGGTGCCC
GTTATGTGCAGAGCACTGGACTAAGCGCTTGGGAAAGTACAGCAGAAGTAAGGGATGTGT
TCCCTGCGCATAACAAACTTAAGGTCTAGAGGTGTATCGTCTCGTAGAGGCGAGAAGACG
CCGTCCCCTCCCCGCCCTCAAGGAGCTTCCAGTCCCCGTCCCGCGCTTCAATTTGCCCCT
TCCGGCTCAGTCTCGGGCCCTTTCTCCGCCCCCGCCGGCCCGGGTCCCGGCAGGGCTGTG
ACCCTTCCTCCCCTACCCAGGAGCCCAAATCCTCGGGGCAGTTGCTGGAGGACTGGGGCA
TGGAGGACATCGACCACGTGTTCTCCGAAGAGGACTACCACGCCCTCACCAACTACAAGG
CCTTCAGCCAGTTTGTCCGGTGCGTGGCGGGGCCGGACCGGGCGGGCGGGGAGTCCTCCC
TCCCTCCCTCCCTCCGTCGAGGCCCCTTGACCGGCTCCTCCTCCCACCCGCAGGCCCCTG
ATCGCCGCCAAGAACCCCAAGATCGCCGTCTCGAAGATGATGATGGTGCTGGGGGCCAAG
TGGCGGGAGTTCAGCACCAACAACCCGTTCAAGGGCAGCTCGGGGGCGTCGGTGGCGGCC
GCGGCCGCGGCGGCCGTGGCCGTGGTGGAGAGCATGGTCACGGTCAGCGAGGTCGCCCCG
CCTCCCCCGCCCGTGGAAGTGCCCATCCGCAAGGCCAAGACCAAGGAAGGCAAAGGTGGG
CGGCGGCCGGGCTTGTGTCGCGCCGGACTGGGGGCGGCGGCGGGGTCGTGGGGGAGCTCG
TCTTGGTCGGGACGCCGTCTGCCAGTCTTTCTGAGTACCCGTTCTCCCCCTCTGTCCTCA
GGCCCTATGCCAGCAGAAGCCAAGGGCAGCCCCNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNGTGGATTCGGGAGGTTGTATGTGCATAGAGAGGCTGGGTACTGT
GTATATCCTTTTACATGAGAGGCTGGGTACTAGGGTCACGTCCACTACCTGTCCTCTATA
GTAGGGCGTGACCTACCCTACGACCAGGCCTCCTGGGAGAGCGAGGACGTGGAAGTGCAG
GACTATGACCTGTTTAAGCAGGGCTACTGGAACCACAGGTGAGTTCTGGGGGCGGCCGGG
GGGGTGTCCCGGGGGGCTGGGGGAGGCCCCGACGGGACCACCTCCTGACGGGCCCGGCCC
CCGCAGGGAGCTGATGCGGGGCGAGGAAGGCCGGCCGGGCAAGAAGCTCAAGAAGGTGAA
GCTGAGGAAGCTGGAGCGGCCACCCGAGACCCCCACGGTGGATGTGAGTGGGGGGCCGCC
TGTGGGCGCTGAGGGCGCGGGGCGGGCGGTGAATGATGGCAAGAAGGAATGAGGTCTAAT
GGCAACAGCAGGGGCTTGGGAGTCAGAGGACGTGGGTTTAATTCCGGCTCTGCTGCTTGC
CCCAAGTCACACAGCAGACAAGTCGCTTTGGGCCTCAGTTACCTCACCTGTAAAATGGGG
ATAAAGTCGGTGAGCCCTACACGGGACAGGGTCTGTGTCCAACCTGATGACCTTGTATCT
CTCCCAGTGCTTAGCCACGTAGTAAGTGCTTAACCCCCCCCCCCCACCACCTCCCTGANN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCTG
CCTCTCACCTGGAACGCCCTCCCTCCTCAAATCCGACGATGACTCTCTCTCTCTCTCCAG
ACTTACTGAAGGCCCATCTCCTCCAAGAGGCCTTCCCTGATTCAGCCCTCCTTTCCTCTT
CTCCCGCTCCCTTTTGCCGCACCCTTTATTCATCACCCTATCCCAGCCCCACAGCCCTCG
TGGTACACGTCTGTCATTTACTTGTGTGAATATCTGTCTCCCCCTCTACTTGCTGTGGGC
AGGGAATGTGTCTTTCTATTGTTGGACCGTACTCTCGTACAGTGCTTTGCACACAGTAAG
TGCTCGATAGATACGACTGACTGACTCTCCTTCCCTCCTCCCACTTCCGCCCCGGCAGAA
GGAGGCCTCGGTGAAGTTCCACGTGCTGCTGACCTCCTACGAGCTGATCACCATCGACAT
GGCCATCCTGGGCTCCATCGACTGGGCCTGCCTCATCGTGGACGAGGCCCACCGGCTCAA
GAACAATCAGTCCAAGGTGGGCACGGGGGAGGAGTCAGCCGCCGCCGGGCCCTTCCGGGG
TCGCGGCCGGGCCCGTGACTGAATCTCCTCACCTTCCCCCCGCCCCCTCCCCTCCAGTTT
TTCAGGGTCCTGAACGGCTACTCGCTCCAGCACAAGCTGCTGCTGACCGGGACCCCGCTG
CAGAACAACCTGGAAGAGCTCTTCCACCTCCTCAACTTCCTCACCCCCGAGCGGTTCCAG
TGAGTGTCCGCCCGCCCACCCTCCCTTCCGTCCGTCCGCCCGCCTCCTCCGGCGTGGTCT
CCAAGCCCTGCCATCCCATGCCGCTCCTCCCCTTCTCCAGCAACCTGGAGGGCTTCCTGG
AGGAGTTTGCGGACATTGCCAAGGAGGACCAGATCAAGAAGCTGCACGACATGCTGGGCC
CCCACATGCTGCGGCGACTCAAGGCGGACGTGTTCAAGAACATGCCCTCCAAGACCGAGC
TGATCGTACGCGTCGAGCTCAGTCCCATGCAGAAGTGAGTGATGATGATGATGGCATTTG
TTAAGCGCTTACTGGGCATCTACCTCTGTTGTAGGTGCTGGGGTTCACTTCTCTGTGCTT
CCGTTCTCCTGTTCCTTCCCCTACTTTGTCTTTGAGTCCCACGTGGGACAGGGAGTGCGT
CCAACCTAATGAACCTGTATCCACCTCCATGCGTAAAGCGGTTTGACACGTACTGAACTC
TTAACAAATACCCTTAAAAAAATGAAGTCGAACACAGTCCCTGTCCCACAAGGGGCTCAG
GGTCTGATTAGGAGGAAGAACGGGCCTTGAATCTCCATTTTATAGTTGAGGACACTGAAG
CCCAGAGAAGGGAAGTGGCTTCCCCGAGGTCACCCAGCAAGGAAGGGGCGGAGCTGGGAT
TAGAACCCGGGTCCTCCGACGGCCAGGCCCGTGCTCTGTCCCGTTGGCCACACTGCTGCT
CCGTGGGGGCCGGGGGTGGCCCTGGGCTCCGGGTAGGGGGTGCGGGTGGTTTGTGCGCGG
GGGGGATGGAATACTGTTTCTACGTCTACTACTGCTGATATTTTAATAAGCATTTACTCT
GTACCAGGCACGGTGGAAAGAACTGAGTTAGATACAAGAGAACCCGAGCGGATATCCCCT
GTCCCCTCATGAGGCTCCCCTAAGAGGGAGGGCCACAGCAGAAATTCTGGATTTCATTTT
NNNNNNNNNNTGCCATTCCCCCCGGCCTCCAGGAGGCGCCCAAGATGCCCAACGGCATGT
ACGACGGCAGCGCCCTGATCCGGGCAGCTGGGAAGCTGCTGCTGCTGCAGAAGATGCTCA
AGAACCTGAAGGAAGGAGGCCACCGCGTGCTCATCTTCTCCCAGGTACCGGGCCCACCCC
AGCGGGCGGGGGGGCGGTGAGCCGGGGTGGGGGAAGGCCAAGGCTGACCCCCTCCACTCC
TCCCGCAGATGACCAAGATGCTGGACCTGCTGGAGGACTTCCTGGAGCACGAGGGCTACA
AGTACGAGCGCATCGACGGCGGCATCACGGGGAACATGCGGCAGGAGGCCATCGACCGCT
TCAACGGTGAGGAGCCGGGCCGGGGGACGCGACCGGAGAGCGGCCGGTCCCCCGCCCCCA
TCCTGACGGGCTCTTCTGTCCGCCCTCAGCGCCCGGCGCTCAACAGTTCTGCTTCCTGCT
GTCCACCCGGGCCGGGGGCCTGGGCATCAACCTGGCCACGGCCGACACGGTCATCATCTA
CGACTCGGACTGGAACCCCCACAACGACATCCAGGTGAGCCCGGCGGCGGCTGCCGGGAT
CGGGCCCGCGGTGGGGGAGGTCGGGGAGGCCGGCCGGGCCGGGCCCACCGGTGGGGTCTC
AGCGGGCCCCCGCCCCTCCTCTCCCACCCCGCCCCGCAGGCCTTCAGCCGCGCCCACCGC
ATCGGGCAGAACAAGAAGGTGATGATCTACCGGTTCGTCACGCGGGCGTCTGTGGAGGAG
CGCATCACCCAGGTGGCCAAGAAGAAGATGATGTTGACCCACCTGGTGGTACGGCCCGGC
CTGGGCTCCAAGACCGGCTCCATGTCCAAGCAGGAGCTGGACGACATCCTCAAGTTCGGC
ACCGAGGAGCTGTTCAAGGATGAGGCCACGGACGGGGGTGAGGAGGGGACCGGGCGGGGG
CTCGGACCGGGAGGAGGGGGGCTCCGTGGCCCGACTGGGCGGCGCCGACTGACCGGGGCC
GGGCCCCACGTGGCATCCCTGCAGGAGGGGACAGCAAGGAAGGGGAGGACAGCAGCGTCA
TCCACTACGACGACAAGGCCATCGAGAGGCTGCTGGACCGGAACCAGGACGAGACGGAGG
ACACGGAGCTGCAGGGCATGAACGAGTATCTGAGCTCCTTCAAGGTGGCCCAGTATGTGG
TGCGGGAAGAGGAGATGGGGGTGAGTATGACGCCGGGGTGAGGGAGGTGCCGGGGGACGC
CGGGAGGTCGAGAGCAGCGGTCTGGTTTTCTGCAGTGCTGCGCTCTCCGAGCACCGGCCG
GATAGCCCCTTCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNCCCAGAGAGTGACCGTAGACCTCAGAGAGACGC
TTGAAGAGGTCTATTTATAAAAAGACACAGCGTGACTGCGCGGGGGGGGGGTTATTTTTA
TTTGCCCACCCCTGAACCCACCGCGGATAAGTATTAGTGGTCTAGAATTCCAACAAGATG
TCGTGGCCCCCAGACGAGCCAAACGGTGCTCTCTGTTGCCGCCCCGTCTGTCCGTCCCGT
CCCTCCCGTGACCCCTGTCTGCTGGGGTCCTCTGAAGGAGAGGAGGGTTGGTGGTGGTGG
GGAAGGGTGATTCATCCCCCCTCGCCCAGCCCCGCAGCGCTTCTTTACACACTTATAATT
TACTTATTCATATTAACGTCTGTCCCCCCCTCGAGACTGTAAGTGCGTTATGGGCAGGGA
ATATATCTGTTTACCGTTGTATTGGACTCTCCCAAGTACACAGTACAGTACTTTGTATCC
AGTAAGCACTCGATAGATGAGATTGAATTGAATGAAAAGAGAGGATGTGGGGGGAAACCA
GAGCTCCGGTCCGGGCAGCATCCTGGGGAGGACCCCACCTGCTCCTCTGCCCCCAATGGA
TTTAAACGTGGGCAGCAGCCCCTCCCTGCCCTCTGGCCCAGGCATCTGTGGTGGGCACTA
GAACCCCCTGGAGGAACCGTGCCCTGGCCGGTCGTCTGGTAGAAGCGGGTCACCCCGTGC
CCGCCGAGGTCCCCTCCACCCCCGCCAGGCGCTGCCTCTTCCCACAGTGGCCCAGCGTGG
GCCTCCCTCACGCCCTTAGAGACCCAGGGTCCAGCACCGCTCCCAAACCCTCCCGGGGAC
CCTCTGGTCAATCCGGGGTGGGGGGAGGGGCGGGCCGCATCTCCCTGAGCCCCGCTGAGT
GCCGGCCCCTCCCTCGCGCCAGGAGGAGGAGGAGGTGGAGCGGGAGATCATCAAGCAGGA
GGAGAGCGTAGACCCCGACTACTGGGAGAAGCTGCTGCGCCACCATTACGAGCAGCAGCA
GGAAGACCTGGCCCGCAACCTGGGCAAGGGCAAGCGCATCCGCAAGCAGGTCAACTACAA
CGACGGCTCGCAGGAGGACCGAGGTGGGTGCGCCCTCCGGGCCCCGCGCCGTCGTCCCCA
ACATCTCACCCCGGCCTCTCACCCCCGGCTCTCCCCCTCAGATTGGCAGGACGACCAGTC
CGACAACCAGTCCGACTACTCCGTGGCCTCGGAGGAAGGCGACGAGGACTTTGACGAGCG
CTCGGAAGGTGAGGGTGGTGCGCGCCCCTCCTCTCCCCCCCCCCACCCCCAGGCCGTGGT
CCCACTCACCCATCTCTCTCTTTTTCTCTCTCTTCCCCTCCTCCTGCTGGCACAGCACCC
CGCCGGCCCAGCCGGAAGGGTCTGCGGAATGACAAGGACAAACCTCTGCCTCCCCTGCTG
GCCCGTGTGGGCGGCAACATCGAGGTGAGGCCCCGCGGTGCCCCCGGCCCAGCGGGCGGG
AGGCGGAGGGGCCCGGGGGATCCTCCTCCTCCTCCTCCTCTCCACCCCGCTCACCGAACA
CCGCCCCACAGGTCCTCGGCTTCAACGCCCGCCAGCGCAAGGCCTTCCTCAATGCCATCA
TGCGCTACGGGATGCCGCCCCAGGACGCCTTCACTACTCAGTGGCTGGTGCGGGATCTGC
GGGGCAAGTCGGAGAAAGAGTTCAAGTGAGGGCCCGGGGGGCACCGGGCGGTGACGGGGT
TCGGGCCGGGCACGAAGCGGGGGAAGGGAATATGTCTAGGGGGCGGGTCCTCCGGCTTCT
CGTTCTGGACCAGAGCTGTCGCTGAGCCCCGGGTCGGAGGAGGAGGCCGTTTTCGGCCGC
CGCCGCCTCGTCTGCTCACCCGTCTCCCTTCCTCAGGGCCTACGTCTCGCTGTTCATGCG
GCACCTGTGTGAGCCGGGAGCGGACGGGGCCGAGACCTTCGCCGACGGCGTTCCCCGCGA
GGGCCTGTCCCGCCAGCACGTGCTCACCCGCATCGGCGTCATGTCGCTCATCCGCAAGAA
GGTGAGGGGGCTCCTCCTTGTCTCTCCCTCCCCCGACCTCCGGTTGCCGGCTCCAGCCGC
TGGAGAGGGGCTGGACGGGGACCTCACTGACGGCCTCCCCGACCCCCAGGTCCAGGAGTT
CGAACATGTGAACGGGCGCTGGAGCATGCCGGAGCTCGCCGAGGCGGAAGAGAACAAGAA
GATGTCACAGCCCGGCTCACCCTCCCCCAAGACCCCCACGCCCTCCACCCCTGGAGACAC
GCAGCCCAACACGCCCGCCCCCGTCCTGCCGGCAGGTGAGGCCCCGTTTTCCCCCATTCC
CGCCACCCCCAGTGCCCATGACGGCCCCAGTGAGCGCTTCTGGGACCTTGTGTCTGGACT
CACCCTGGGTTTGCATTGAGGTGGGGCAGAGCGGCCCACTGAGAAGGGCGATGGGGATGG
AGGGGTCAGTCTGGGAGTCCCGATGGCTCCTTCCCCGTGGAAAATGGTCAGTGCCGAGAC
GTGCCGGGCCCGGCGGGCGTCTTGGAGAGATCGGCGGCTACCCGCTGGGAGCTCGGCCCG
CTTCGGGCAGCTTTCGCTGTGGACCGGTGGGCCCGAGCCGCTGGGCTCTGCCGTCCCCGT
CCCGGCCCTTGCAGCTGCCCCCCTGTGCCGAGCTGTGGCGGGGGGGTGTCCGGGCGGGAC
ACACAGTAACCCTAACCCTCTCCATTTAGGAGGGCCCCCCCGAGGCTGGGGGTGGTCCTT
AAAGGCAAGAGAGGACAAAGGGGTTCGGGGGAGGGGGTCCCTCAGCCCAGCCCGCGCTCC
CCGCCCGGGTCCGACTCTTCCCTGTGTGTTGGCAGAGGATGGGGTGAAGGTGGAAGAGGG
GCCCGGCAGAGAGGAGGACGGGGCCGAAGGAGAGAAAGAGACGAAGCCTACGCCTCCCGA
GGGGACTTCAGAGGTGAGAGTCCAGGGAGGGAAAGGAGGATCCTCTCGCCTGTCTGTTTG
CCTACCCTCCCGGGCGTTGCCCACTTCACCGGCTGCCCTCTCTGCCCCCAGGGCCCGCAG
CCCCCTCCCCCTGCCCCCGAGGAGGAGAAGACCCCCGTGGAGCTCCCAGAGGGAGAGGAA
AAGAAGGAGGAGCCCAGTGTCAAGGAGAGGCCGGAGGAGCCCATGGAAACAGAGACCAAA
GGTCTGTTGTCTCCGATCACCCAGGGAGGTCGGGCTGGGGGACTCCACGGGAAGGGGATG
TCACTGAGGCAGGTGGGGAGGGTCAGGAGGCGGACGGGTGAGAGCGCTCCAGCGGGCTCA
GCCCCCACTTGCTTCCGCAGCTTCTACAGAGGTGGAGAAGGTGGAGGAGAAGCCAGTTGT
GGACCTGACCCCCATCGTGGTGGAGGACAAGGGTGAGTGTGGGCGATGTGGAGGCCCATC
GGGAGCGGGTGGGCCCGGGGAGCACATGAGCCCAGTGTCGGCGTGCCTGAGCCTGGCCCT
CAGGAAGAGCAGGGAGAGTTGTGAGGAATACCAGATTTTGAGTGGCAGTCTGCCCCACCG
GGTCAGTCCCGTGGCCCTTCGTGGTTAGGGATGGACTCCATCCCTGACTCCCCCTCAGTA
ACGCAGCTCGGATGCTCTTCCGTGGATCTCTCTGGACCCTTGTGGGCCTGGTGGCTTTTC
CGGCTCACCGGCTCCCTGTGGGAACGGATTTCCCGTGCTCCCCCTAGGCTCGGGGAAGAT
GTTTCCTGTGTCCCTACAGCTCCCATGGGGGCCCCTCGCCCCAGGGTCCGGGATTTGGGG
AACAGCAGTTCCGTGTCTGCCCCGTCCCCCCTTCCCTGGTCCTGTAACTCCAGACCGCAG
AGCCCTGACCCTTCCCGCCCAGAAGCAGCCCCGTCCCCACAAGCGTCTTGGGGCCGGTGC
CCGGAGCCAGGGCCGAGGGGGAGCTGACCCCGTCCCCTCTCCTGCCCACCCACAGAGGAG
GAGAAGAAAGAGGAGGAGGAGGAGAAGAAGGATGTCTTGATGCAGAACGGGGAGACGCCC
AGGGAACCGGGTGACGAGAAACAGAAGAAAGCGGTCAAGCAGCGCTTCATGTTCAACATC
GCCGACGGAGGCTTCACCGGTACGTGGGGCCCGGTGGAGGTACCCCCGCCCCCCCCCCGC
CAAGGGGAGTGGAGGCGAGGGCACCTCCCGGCACTGAAAGTGAAGCTGTGGAGCCCACGA
GTGCCACGTAGAGGGGTGGCCTGCCCACTGGGCCCGGGACCCCCGAACTCACCCACCCTG
TTGCCGCCCCGCAGAGCTCCACTCGCTGTGGCAGAACGAGGAGCGGGCAGCCACCGTCAC
CAAGAAGACCTACGAGATCTGGCATCGGCGGCACGACTATTGGCTGCTGGCCGGCATCAT
CAAGTATCCTTGGCCACCGTCCAGCGGGGGTCTGGGCGGGACCGGTGGGGAGGGGGCCGG
GGGATGGTGAGAGGGCGGCGTCCCAGCTTCCCGCATGTCTTCCTGAGCCCGCCCGCAGCC
ACGGCTACGCCCGGTGGCAGGACATCCAGAACGACCCACGCTACGCCATCCTCAACGAGC
CCTTCAAGGGAGAGATGAACCGGGGCAACTTCCTGGAAATCAAGAACAAATTCCTGGCCC
GCCGGTTTAAGGTGACGGGTCCGACGCGGGCGGCCCCGGGGGGGCGGTTCCCTCCTGTCC
CTTTGGGTGCTGGGGCACGGGGGGAGCGGGGCCACGGGCTCCACACAGGAGCCCTGGGTT
GGAGAGCCGGCTCCGTCACCCGGCCTCCTGAGGGGCGAGGCATTTCACCGCCCGCTTGGG
CCTTCTTCCCGTCATCTGTGAAACGGGAGATGAGATCCCCGCTCTCCCTTCACGATCTCT
TCAGCTGGGAGTCCGACCCGATTAGCCTGTTCCCGCCCCAGAGCTTGGGGGAAACTGTAA
CCGAGAGGAGGCCCCCAGGGGTGTGACCTCCCTTCTCCCCCTGGAAACTGGGGCATAGCC
CTGCGGGGATCCCGGTGGGAAGGGAAAAGGGCAGGGGGTTCACCGTCTTCCCTCCCGCCC
CCCAGCTCCTGGAGCAGGCCCTGGTGATCGAGGAGCAGCTGCGGCGGGCGGCCTACCTCA
ACATGTCCGAGGACCCCTCGCATCCTTCCATGGCCCTCAACACCCGCTTCGCGGAGGTGG
AGTGCCTGGCCGAGAGCCACCAGCACCTGTCCAAGGAGTCCATGGCCGGCAACAAACCCG
CCAATGCTGTCCTGCACAAAGGTAGCCAGTGGCTGGCGGGTGTGCCTGGGCTACCTTGGC
GGGGGGGCTGCGAAAGAAGGGGCTCCAGGGCCGGGGGCCGGTGGCCGAGAGTCCCGCAGG
GGCCGGGGAGAGGGTGCCGTTTCAAGCAGGGTGAGGAACGGAGGCTTCCTCTGAGGGGGG
CGGAGGATAGGAACCGGGGTAGACCCTGCCCCTGCCGCCCCTCGCTCGTGGGGGGCGGGA
GGGGCGCTGGGCATCGAGGGCACTGCCCAGACCCCAGCCCCGGGGCTCTGGCCGCTCACC
ACGTCCCTCCTGCCCGCCCCGTGCAGTTCTCAAACAGCTGGAGGAGCTGCTGAGCGACAT
GAAGGCCGACGTGACCCGGCTGCCGGCCACCATCGCCCGCATCCCCCCCGTGGCCGTGCG
CCTGCAGATGTCCGAGCGCAACATCCTCAGCCGCCTGGCCAGCNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1231, 1358..1475, 1911..2118, 2213..2318, 2367..2611, 3918..3981, 3993..4117, 4206..4357, 4594..4616, 5656..5835, 5937..6058, 6160..6335, 6406..6442, 6781..6870, 7033..7183, 7268..7385, 7469..7593, 7719..7956, 8064..8239, 9442..9622, 9701..9787, 9889..9986, 10091..10224, 10416..10560, 10669..10834, 11375..11472, 11532..11700, 11840..11911, 11986..12017, 12513..12618, 12794..12902, 13018..13150, 13565..13760, 14066..14202
1106..1231, 1358..1475, 1911..2118, 2213..2318, 2367..2611, 3918..3981, 3993..4117, 4206..4357, 4594..4616, 5656..5835, 5937..6058, 6160..6335, 6406..6442, 6781..6870, 7033..7183, 7268..7385, 7469..7593, 7719..7956, 8064..8239, 9442..9622, 9701..9787, 9889..9986, 10091..10224, 10416..10560, 10669..10834, 11375..11472, 11532..11700, 11840..11911, 11986..12017, 12513..12618, 12794..12902, 13018..13150, 13565..13760, 14066..14202
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved