Ornithorhynchus_anatinus Locus ENSOANG00000021687
snOPY snoRNA Orthological Gene Database
Ornithorhynchus_anatinus ENSOANG00000021687
Ornithorhynchus_anatinus
ENSOANG00000021687
Contig2091
SNORA7
4010..4160
17854
ATATCCCTCTACACAAACCATACAGATAACTCTTATTCCAGCCTTGCTTTTAGCTCAGT
AAACCACACCCTTCTCATTCTTAGACTTGATGCCATAATTAATATCCATGCTGGGCCGAA
AGAGAATAGGCAGTCCAGGCTTCTGAAGAAACTTCATCTCTGTTTATTATCTCTGAAGGA
GCAATGTAATTTCCCCATCCTTGGCATCTATTAACTTTTGTGATCCCGAGAACACATGAA
AACAATTTCAGCAGACAATACGAATTTCCTCCTGGCTTCATACAGCCTGAAATTTCTCTT
TCTGCGTCAGATTGTGGTGTCGGAGCCTGCTTGGGTAGTATTTGAACATTCACACCCAGC
CCAGATTGACCACATCTGCAGTTTCATCGTGAGAACGCCTAGCCTCCAAGGGGACAGGAT
CATATCACACAGCCCTTTTCTTCTCTTTAGTTTCCTTCTGCCTCAGCTAAATCTCTTTTG
AAAAAAATGGCATTTATTAAGCACTTAGAATGTGATAAACACTGGTATAGATGCAAAGTT
ATCAGTTTGGACACAGTCCCTATGCAACTCAGGACTCACAGTCTATTTTATCCCCATCTT
GTCCCCATACGAGGAAGCAGGCCCAGAGAGGTTAAATCCCTGGCACAGAGTAAGCACGTA
ACAAATACCACAATTATCATTATTATTATTATTATTAATAAAACCCTCTCTACCCATTCC
ACGTGTGGATGTGGTTAGTCAGTCTTCTCTTCATTGGCCTAGTGGAGAGAGCATCCGCCT
GAGAGTCAGAAGGTCATGGGTTCTAATCCAAGCTCTGCCACTTCTCTGCTGTGTGACCTT
GGGCAAATCACTTCACTTCTCTTTGCCTCAGTTACCTCATCTGTAAAATGGGGATTAAGA
CTATGAGCCTGATATGGGACAGAGCCTATGTCCAACCCAATTTGCTTGTATTCCTCCCTC
AGTGCTTACTACAGTACCTGAAACAGAGTGAGTACTTAACAAATACCACAGTTATCATCA
TCATTATTATTATTGTTATTATTATTAAAGCCCTCTCTACCAGTTCCAGGTGTGATGTGG
TTGGGTCAACCTTCTGTTTGCTGTTCTGTTTTGCAGATTCCTCCAACACACCTCAATTCA
TCAAGTGCCGTTCCCCGGAACTGGAGACCTTTTCATGCCATTGGACGGGTGGCGGAGCCC
AGCCCGGTTTTAGGGAACCAGGAGCCGTTCAGCTTTTATACAGGAAAAGGTATGGCAGTG
TTGTGCTGAAGAGGGAGATCAATCATTGGTATTTATCGAGCGCTTACCATGTGCACAGCA
CTGAACTAAGCGCTTGGGAGAGGACAGTATAACACACTCGGTAGAAATGTTCCCTACCCA
CAACAAACTTACAGTCCAGAGAAATGGCCAGCAATATACTGATGAGAGTATTCCATCCAA
TCATATTTATTGAGCACTTACTGGGTGCAGAGCACCGTACTGAGTGCTTGGGAGAGGGCA
GACTTGGTAGACACATTCCCTGTCCACAACAAACTTACAGTCCAGAGAAAATGGCCAGCA
ATATAGTGAAGGGAGTATTCCATCCAATCATATTTATTGAGCGCTTACTGGGTGCAGAGC
ACTGTACTGAGCACTTGGGAGAGGACAATATTATAGAGTCATTGACACTTTCCTTGCACA
AAGCAAACTTATAGTCCAGGAAAAAATGGCCAGCAATGCAGTCATAGAAATATTTCATTC
AATCATATTTATTGAGTGCTTTCTGTAAGCAGAGCACTGTACTAAATGCTTGGGAGAATA
AAATAAAACAATAAACAGTTGAAACGTATGCCTCCTCAGCCAATGGAAGGGGCGGCATAA
AGAGAGGGGCCTCTCCTAGGTAAAGGTGGGAAGATGGATGAGGGGGGTGGCAGGAGGAAT
CAACCAATCAATTGTATTTTTAAGCTCTTACCCTGTGCAGAGCACTGTACTAAGAGCTTG
GGAGAGTACAATATAACAGAGTCAGTAGACATGTTCCTTGCCCACAGTGTGCTTTCAGTC
AAGAGGGAGATGATTTGCTTTGAGAACCTTGAGTGAATTTGGTGTAGTTATCGGCCCCCA
GGAGGTTCAACTCAATCAATTAATCAGTGGTATTTATTAAGCGCTTACTATGTGCAGAGA
ACTGTACTGAGCGCTCGGGTGAGTACAGTACAGTAGAGTTGGTTGAACTGATCCTTGCCC
ATAATAAGCTTACAGTCTACAGGAGGAGACAGACATAAAGTAAATTAAATTACGTTTAGG
GGAAATGTTAGAGTCTAAGGATATGTATATATCCATATATCCAGAGAAGTAGCATGGCCT
AGTGGATAGAGCACGGGCCTGGGAGTCAGAGGCTCATGGGTTCTAATCCCGGCTCTGCCA
CTTGTCTGCTGTGCAACTCTGGGCAAGTCACTTCAGTTCTCGTGCCTCAGTTACCTCATC
TGGAAAATGAGGTTTGAGACTCTGAGCCCCACATGGGACAGGGACTGAGTCCAACTTCAT
TTGCTTCTATCCACCACAGCACTTAATACAGTGCCTGTTACATAGTAAGTGCTTTAGAAA
TAACATCATCATTATCACTGTTGTTATAATTCCTTCTTCTGCCTCCCCTACAGGATTCCC
ACGAGTGATATTTCCACAAATAACAATAATCGTATTTGCTAAGCACTTATTATGTGCCTG
CCCAGACTAAGCCCCTTTTTCCTCAGCTCCCCCTCCTTTCCGTGTCACCTCAACTTGCTC
CCTTTGCTCTTCCCCCATCCATAGCACTTATGTGTATATATATACCTATAATTCTATTTA
TTTATATTGATGACTGTTTACTTGCTTTGATGTCTGTCTCCCCCCTTCTAGACTATAAGC
CCATGTGGACAGGGATTGTCTCTCACTGTTGCATTTCACTTTCCAAGAACTTAGTACTGT
GCTCTGCACACAGTAAGCACTTAGTAAATATGATTGAATGAATGGATGAATGTGCCAAGC
ACCATTCTAAATGCTGGACACTGTACTAAGTGCTGTTAAAGTCCCAACTCTGCCCGTACT
CCTTCCCATCATCATCCTAACACTCCAAAGCCCATGGACAAGACAGTGCCTTTTGAAAAA
TGAAGAGATTTCCTGGCCTTGAGAGTGTGGTGCTTGGGAATCAACAGACTGGGGCAAAGG
GAAGATTGAAATGGGATTGATAGAAACGTCAGTGTCCTAGAAAAAGACATCCAAACTTGT
ATTATATTGATTATATTTGCTGCGTGTTTGTTTTGGAATAAGCACTCTGTAAATATCATT
TATTGATTGGTCGATTGATCTACCCTAGGACTAGGCATAGTACTCGGCTTGACACATAAT
ACGCACTTAATAAATACTGTCATTATTATTACTAGGAAAAGAAAGGCAAGCAGAAATTGT
ATGTACCATGGGGGAAAAATATTCCTGATAATAAATAGCTAGAGTATTGAAAATTAACCA
AGTGGAGTAAGTCAGTCAATAGCCTTAAGTACCAAAAATGCACAGTTCACTTTGGCATCA
CTATTAGTGTCAAGTCAATCAATCAGTAGTATTCATTGAGTACTTGTTGTGCTCCAGGAC
AATCCCTTGGGAGAGTACAATACAATAGAGTTCCTACGCATGTAAATCTGACTCATCTCT
GAACGTTACTATTAGCACTGTATTTTTCTCCTTCCTCTTTCAGGAACGACGAATGGAAAG
AATGTCCCGATTATGTCTCCGCTGGAGAAAACAGCTGTTATTTCAATAAAACATACACAT
CCGTCTGGATACCCTACTGCATTCAGCTGACCGTGGACACTGGCTTAGTGGACGAAAGGT
GTTTCACCGTTGATGATATCGGTAAATCTCAGAATTGTATTCCATTGAGGAGGAGGTTGG
CCTAATGGATAGAACACCAGTCTGGAAGTCAGAAGGACCTGGGTTCTAATCCCGGCTCCT
CCACTTGTTGGCTGTGCGATCCTGGGCAAGTCACTCCTCTGGGCCTCAATTACCTCATCT
GTAAAATGGGGATTGCTCCTCTCAGGGCCGCACCTGGAGTAATCTACCATCTCGACTAAG
GGAGAGAGAGTCAAGAAGAAGCATATATTCCATTCTTAGCTTGGGCAGTGGCTAGCGAGT
GGCAGGCAATCTGCTACAAGTCAGAACTCACCCATGCTGGCAGGGGAGAGAGTCGAGGGC
GGAGATACAGTTTACTGCACGGAAGGAGGCATGGTAAAACACTTCAGGATTTTGACCAAG
AAAACTCTAAGGAGACAGGATTGCAGATGGATGTGGGGTGTTCTGGAAGAAATGTCGCTA
TGGGTCAGAGACGACTCGATGACATCAGGCAAGACAAGAAAATGGGGATTAACAGTTTGA
GCCCCAGGATGGGACAGGGACTGTTTCCAACCTGATGAACTCGTTTCTAGTCCAGCTCTT
AGAATGGTGCTTGACACATAGTAAGCGCTTAACAAGTACCCTATTTATTCATTATCATTA
CTATTACCCGGCGTCACCCCTGTCTTCGCTCTGTCTAAAACAGTGCAGCCCGACCCCCCC
GTGGGACTGAACTGGACGCTGCTGAATGACAGCTTGACGGGGGTCCATGCGGACATCCAG
GTGCGCTGGGAGCCTCCACCCAACGCCGACGTCCAGAAGGGATGGATCATCCTAGAGTAT
GAGCTGCAGTTCAAGGAAACCAACGATTCGCACTGGAAACGGGTATGGGGGTGACTCTCC
CGCCTCCCCATCTCAAAATGCAGCTATTCCCTCATTTAGCTTATTCTGGAAAGGGAACAT
GTCGGCTGATTCTTTTGTCCTGTACCTTCCCAAGCACTTAGTTCAGGGCTCTGCATGTAG
TAAGCGCTCAATAATGAGAAATAGCGTAGCGTAGTGAAAAGGGCATGGATCTGGGAGTCA
GAAGGATATGAGTTCTAATCCGGCTCTGCCACTCATCTGCTGGATGAGCTTGGGTAAATC
ACTTCAGTTCTCTGGGCCTCCGTTACCTCATCTTTCAAATGGGAATTAAGATTGTGAGGT
CCAAGTGGGACAGAGACCGTGTCCAACCTGATTAGCTTGTATCTACCCCAGGGCTTAGAA
CAGTGCTTGACCTATAGTAAGCGCTTAACAATATCATCGTTATTATTATTTGTTTTTAAT
AAATGCCACTGATTGATTGGTGGACGAATGGTTCTCTAGAAAACAGTTTTTTTCTCACCT
GGAACTGCTGGATAATACCCTTCTGTATGCTCAGTTTATTTATTTTGAACACTGTAGTTG
GAAATATTTTCATGTTTGTCTCCCCAATCAGAGCATAAACAGGTAACATACCACTTCATT
ACTCTGCACTTCTGAAGCACTTAGTACAGTGCTCTGCACCAGGGGGTGCTCCAAAAGGTG
GAAGCAGGGTGCCCTAGCGGAAAGAGAATGGACCCGACAATCAAGAGACCTGGATTCTAA
TCCCGCTCTGCCCCTTGCCTGCTTGGCTAATGCGAGCTTACTGTTATTCAGTGTCAACTG
ATCGGTCATGGTGTGGCCAAGTGGCAGAGCCAGAGGACCAGGGTTCGAGTCCGAGCTGTG
CCTCTAACCGGCCATGTGACTGTGGGCAAGTGCTTTCACTTCACTGTACCTCAGTATCCC
CTTCAGTAAAATGGGAATAATGATACCTGCCTCTCCTCCCTACCTCATGGGGCTGTTGTG
AGGTCTGAAATGATCTAGTTAATGTGAGAGTATTTTGGGAATAAAAGTTCTCTAGAAAAC
TAAGGTATTATCATTATTTTGTGGCAAGACCAAGGGAGAGGGCCTGCTAGGTTCTCCCTT
TGTTTTGTTTTGTTTTTATGGGATCTGTTAAGTGCTTACTATGCAGCCAGCTCATACTGT
ATGCCAAGTAGATCCAAAGTACCTAGGTTGGACATAGTCCCTGATCCACATGGGGCTCCC
AGTTTTAATCCCCATTTTATGTATGAAGTGACTGAGGCACAGAGAAGTGAAGTGACTTCC
CCAAGGTCACCCAGTAGACAAGTGGTGGAGGCAGGATTAGAACCCAGGTCCTTCTGACTC
CCGGGCCCATTCTCTATCCACCAGGCCACGCTGCTCCCTTCCTCTTACCCTAAGCATAAC
ATTTGTCAACCTTTCCAAATCCAGTGGAACTCAGCACTGAGATAAGTTCTGCATGGCCCA
AAGCTAGAGAAAAATCAGAGTGATTGTACTTATTTCAGGGTATGAGTTATCAATCAATAA
ATAAAAGATATTTATTGAACACTTACTCTGCAGAGCACTATACTAAGCGCTTGGCACATT
CCCTGCCTATAACGAGCTTACAGTCTAGACAGGGAGATGGACATTAATTTTATTTTTATT
TTTATGGTATTTGTTAAGCGCTTACTGTTTGTCAAACACCATTCTCAGTGCTGGAGTAGA
TACAAGTTAATTGGATTTAACACAGTCCCTGTCCCCTCATGAGGCTCACAGTCTAAATAG
GAGGGAGAACGGAGAGCTGAGGCACAGAAAAGTGAAGTGACTTGCTCAAGGTCACTCAGC
AAGCAATTGGTAGAGCTGTGATTAGAACCCAGGTCCTCTGACTCCCAGATCCGTGCTCTT
TCCACTAGGCCATGCTCTTTCTCCAGCATGTACAAATCTTTAGCCACCGATGCTAAGTCA
ACCTAAATGGTCAAGCGGCCTCAACAATGTCACATCACGCCCAATTTCCTGACCCACTTC
CCCACATCATTTATATGCCCTAGTGCCCTCCAGCAATCAATCAATCAGTGGTATTTACTG
AGCGCGTACTGTGTAGAGAGCACTGTACTCTGCACGTGAGAGAGTACAGTACGACAGAGT
TGGCAGACACAATTCCCTGCCCACAAGGAGCTTACAGTCTAGAGGGGGAGACAGACATTA
AAATAAAATAAATTATGGATACGTACATGTGTGTTGGCAGTGGGTCAGATCCTTTCTAGC
AGATATTTTGGCTATCACCACCACAAGCAAATGAGCTTTGACTATGTTGTTTTAGTAACA
ATTGAACTTGCAGCTGAATGCAGCATGGCCTAGTGAATAGAGCTGTCTGGCCCTGGCTTG
TAATCCCAGCTCTGCCACTGGTCTGCTGCATGACCTTGGGCAAGTCACTTTACTTCTCTG
CACCTCAGTTCCCTCGTCTGTAAAATGGGGATTAAGACTGTGAGCCCTATGTCGGACAGG
GACTGCGTCCAACTCGATTACCTTGTACCTACCCCAGTTCATAGAACAGTACCTGGCATA
TAGTAAGCGCTTACCAAATACCACAATTATTATCATCATCACTGCCGGAGTCAGAACCCG
GACTTCGACACAAAAGTAGAAAGGGTTGGTAGGATTATGGCGAACGTCCGTGGTCCCAGT
TTCCGATTCGGATAAGGAAGTGTGAGAGTTCTCAAACCAGAAGTGGTTCGTTCTGCTAAC
ACTTACCCTGCTAGTGCATCCAGCGCTTAGAAAAGGGCCCAGTGCTTAAAACGGTGTCCA
GCGCTTAGAACAGTGCCCAGCGCTTAGAACAGTGCCCAGTGCTTAGAACAGTGCCCAGCG
CTTAGAACAGTGCTCTGCACATAGTAAGAGCTTAACCAACACCAACATTACTACGTACTT
GCTTCGGGAATATTTGACTTAGAAAATAGCCTTTGCTTCATCGTATTCACTAAATTGATA
GTGGGTTGAAAAGATCATCTGTACGGAGCAACTGCATCCATTCTCGTCTCTGAACGTATG
AGTAAGGGTATGCTCATTGTGGGCAGGGACTGTGTCTACCAACTATGTTAGATTGGACTC
TCCCCAGTGCTAAGTACAGTGCTCTGCACAAAGTAAACACTCAATAAAGATCATTGATTG
ATGACTGATTGATTGAGGATTCTGCACAGGAGAGCTGTGGTACTCAGGAAAGCATAAGTA
TGGAAGACTGGCAAAACTCTCCCTCTTCAGATAATAAACAGTCAGTGACCTCAGGTAATA
AACAGTTAGTTAGTCAATCATATTTATTGAGCACTTACTGTGTGCAGAGCATTGTACTAA
ACGCTGGGGAGAGTATAATACAGCAATAAACAGATACATCCCCTGACCACAAGGATAATA
ATAATAATAATAATGATGGTATTTTACTATGTGCCAGGCACTGTACTAAGCGCTGGGGTA
GATATAAGCAAATCAGGTTGGATATAGCCCCTGTCCCCCATAGGGCTCACAGCCTCAATC
CCCATTTTACAGATGAGGTAGCTGAGGCACAGAAGTAAAGTGACTTGCCCAAGATCACAC
AGCCGACAAGTTGGGGAGCCGGGATTAGAACCCATCACCTTCTGACTCCCCGGCCTGTGC
TCTATCCACTACGCTATGCTACTTAGACATTAGTATAGATAAATAAATTACAGATATGGA
TGTTAACAGAAAGGGGTAAGTTAGCTGCAGTCCTGCCCAGAGACAAGGGGGCAAATGGGG
GACTGGATGACGTCAATAGCAGGGTGGCCTAAAGGAAAGAGCCCAGGCCTGGGAGTCAGG
AGACTTGGGTTTCACTCCCAGTTCAACCCTTTGCCTGCTCGGTGACCTTGGGCAAGTCAC
TTAACCTCTATGTGCCCCAGTTTCCTCATCTGTAAAATGGGGATTGAGACTGTGAGCCTC
ACATGGGACAGGGACTGCGTCTAACGCGATTCCCTCCACCAAGACTGTGAGCCCCATGTG
GGACAGGGATTGTGTCTGAACTGATTATGTTTTTTTCTATCCATGTGCTTGGAACAGTTC
TTGCTACATCAATCAACTAATGATATTTATTAGACACTTACTGTGTGCAGAGCACTTCCT
AAGTGCTTGGGAGAGTACAGTACAACAGAGCTGGTAGATACATTCCCTGTGCGCAGTGAG
CTTACAGTGTAGAGGCAAGCTTACAGTCTAGAACATATAATAAATGCCATAATTCGTATC
ATCGTTATTATTATTGTTTTTAATCACAAGACATCCCTCAAGACTTAGGTCCCTTTAAAT
GTATATAAAGTGCTTTGGGTTCTTTGTCCAAAAGCCCCCCACCCTTCAAAAAGAAATACT
ATTTGTCATTACTGTTTTCCATCGTATCTTTTGTGTGGGAACTTCAGTGCATCTACAGAT
AGAGAGTAAGTACCTTTTCTAATCAGCAATTCATTCAGTGCTTTGCACGCAGTAAGTACT
CAGTAAATACGATTGAAAGAATCAATGAACGAATGAACATTTTTATTTTTTGTAGCTGGA
GCCCGTCCGCACGACGTACATCCCCTTGTATTCTCTGAAGGTGGACAGAGAGTATGAAAT
TCGAGTCAGATGTAGACAACGGACCTCTGAGAAATATGGGGAGTTCAGTGAGACCCTTTA
TGTGACTCTTCCCCAGATGAGCCCACTTCTTTGTGAGGAAGGTAAGAAGAAAGATTCTAC
TACTAATAATAACAGTAATAATAATAATAGTATTTAAGTGCCTAGTATGTGTAAAGAACT
GTTTTAAATGCTGAGGTGGGTACAAGTTAATTGGGTCATATCCAGTCACTGTCCCACATG
AGGAAAGAGGACTTAATCCTCATTTTAGAGATGAGGTAACAGAGGCACAGAGAAGGTGAC
TGGCTCAAAGTCACACAGAAGACAAGTGGCAGAGCCGGGATTAAAAAGAGGGAAAGAAGG
AGAGAGGAGAGAGAGCAAGAGAAAGAAAGGAAGTTAGGACGGAAGAAAGGAAGGAAAGAA
GGGAGGAAGGAAGGAAAGAAGAAGAGGCAGGGAGGGAGAGAGGGAGAAAGAGGAAGAGAG
GAAGAAAGAGAGGAAGTGAAAGGAAAGGAGGGAGGGAAGGCTGGAGGGAGAAGGAAGGAA
AGGAGGGATAGAGTAACTGAAGCAGTCAGCTGGAGAGGAAGGAACGTTGGGCTCAGGGAT
TCCTTTCTCTGTCCAGTATCAGTAAGAACCATGATTGGTATAAGCAGAACGGGCACAGGG
GCTGAGATTGTCCCTGGCTCAGTGCTTCCCACTCCTTCCACTGCCACTAGCCAGCAGCAG
TGATGTGGAGGCGAGCCAGGCATGCCATGTCATGAAGGGAACTGGGCACCCTCTTCGGCA
CTGCCGACATGGGTGAGAGAGCAGTTCCAATCACCTGTCACCAGAGAGAATGATATACCT
ACGCCGGGTGGGGTCATGACATATCCTGACTAATTGGGTTAATCACCGTAATGGTATATT
TAAGCCTATTTAAGCTTTGTGTATGTGTGTGTCTGTGGGATGTCTTGAATGGGAATAATG
AAAAACAAATGTATTCAGTCCTGCTGAGTGCCAAATTAGCAACTGTTCTGTTCATTTCTT
GGATAACAAATTGCTGCATCTTTTTTCTATTGAGAGTGAAAACTGACTCACAAGTACCCA
CCAGTGTGATTTTTATTGTGTGTTTCAGATTTCCAGTTCCCCTGGTTTTTGGTTATCATC
TTGGGAATATTCGGGCTGACGGTGGTGTTTTTCATACTCGTGTTTACTAAGCAGCAAAGG
TATGTTTGGAAGGGCCTTCTCTAAAGCATAATTATGCCCTGAGATGTTTCAGTCAATCAA
TCAATGGTATTTATTGAGCATTTAATATTCATTCATTCAATAATATTATTGAGTACTTAC
TGTATGCAAAGCACTGTTCTGAGCACTTGGGAAAGTTCAGTATAACAATAAACAGACACA
TTTGCTGCTACTCTGTACAGACCACTGTACTAAGCCCTTGGGTGGGTACGATAGAGTTGG
TAGAAATGATCCCTGCTTTTAAGGAGGTTGCTTCTTTTCTGTACAAATCTAGGAAAGCAG
TGATGAAGTCTTTGATGGGTTTGTGAGTTATAAATCAAATTTCAGGGCCAAATTACGTAT
TCACACCAAGGTATTGCCACAACCCCTTGTTGGAAAGCCAGAATCTAGCGGACCATCCGA
GCCAGAGTCAGGGCAAGAGGGACCTCGAGCAAATGGACTCTAATAAGCCATTTGTGACCT
TGGGTAGGACACGTAATTTCTCTGTGCCTCAGTTTCCTCAATCATGAAATGAAAATTAAG
TACCTGTTCTCCACTCTACTTATACTCTTAGCCCCTTGTGGGTCAGGGACTTATATCCAA
CCTAATTATCTTTAATTTTGGGGGAATTTGTTAAGTGCTTACTTTGTGCCAGCACTTTAC
TAAGCGCTGGGGTAGATGCAAGTTAACCAGGTTGGACACAGTCCTGTCCCACATGGGGCT
CGCAGTCGTAATCCCCATTTTACAGATGAGGTGACAAGTCCCCATGGCTCTGACTAGGTT
AGCAGTTTTGCCAAGCTAGACCCGCTGGTCTTTGATCAGTCAATCCATCAGTGGAATTTA
TTGAACGCTTGCTGTGTGCAGAGGACTGTAGTAAGCACTTGGGAGAGTACAATATAACAG
AAATGGTCGACACATTTCCTGCCCACAGTGAGCTTGCAGTCTTGAAGGTGGAAATAAGAT
GCAGAACAGGACACCGTTATTTACAGATGATGAAACGGAGACGTTTCGGAGAAGTTATGT
GTCCTGCCCCAGGTCCCATATGGCTATTGAGATCACACAAAATTTTTGATGACATGTAGG
CAAGCTACCAAAGCTGCCTTCAGCCTTTTTCTACTGGAGTTTTTTTTCAATCTTGAGTCA
CTCTACAAATTAGGAAGCAAATAATAATTATAGTTGTGGTATTTGTTAAGTGCTTACTGT
GTGCCAGTCACCATACTGAACATTGGTGTGGATACAAGCAAATCGGGTTGGACACAGTCC
CTGTCCCAAGTAAGGCTCACAGTCTTAATCCCCAATTTACAGGTGAGGTGACTGAGGCCC
AGAGAAGTGAAGTGACTTGTCCAAGGCCACACAGCAGACAAATGGCAGAGCTGGGATTAG
AACCCATGACCTTCTGACTCCCAGGCCCAGACTCTATCCACTGCAATACTTGCCTCCCCT
ATGATGATCGGTGCTAAAGTTGTTTTTCCCCTCGTAGATAAAATATAATAGAAACATATT
GCGCTTGTTTTTTCTTGGCATTAACACAGAAATCGGCCTCATGCAGGCTTGAAGCTCTGG
CCCGGACTCTGAAAAGTGGTTTATAAATCTCCTAGAATTTAATAAAATCGACTGTTGAAA
ACCTGCTGCTGATGTAGTGTGGCTCAGTGGAAAGAGCACGGGCTTGGGAATCAGAGGTCA
TGGGTTCTAATCCCAGCTCTGCCACTTGTCAGCTGTGTGACTCTGGACAAGTCACTATTA
GCTTCTCTGTGCCTCAGTTACCTCATCTGTAAAATGGGGATCAAGACTNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNGAAGTAGTGTGGCTCAGTGGAAAGAGCACGGGCTTGGGAATC
AGAGGTCATGGGTTGTAATCCCAGCTCTGCCACTCGTCAGCTGTGTGACTCTGGACAAGT
CACTTAACTTCTCTGTGCCTCAGTTACCTCATCTGTAAAATGGGGATCAAGACTGTGAGC
CCCATATGGGACAACCTGATCACCTTGTATCCCCTCCCAGTGCTTAGAACAGTGCTATGC
ACGTAGTAAGTGCTTAACAAATGCCATCATTATTATGTAAGCTGAATGCAGCAAGGCTGT
GTCCAAATATTCAATAGTATTTATTGAGTGGTCAGAAAATCAATCAATTAATCAATCAAT
GGTGGTTATTGAGCACTAACTGTGGGCAAAGCACTGCAGTAATCGGTTGGGAGATTACAA
TGCAACAGAGTTGGTAGAAGCATTCCCTGCCCACAAGCTAACGGAACCTAGTCTTGGGGA
AATGTACTAGGAGAGTTGTTCAGATATGGCCTCTCAGCCCATGGGCCACTTTGAGAGAAG
GGAGGAGGAAAAGACTGGAGTCAGACATAGAGCAGCATGGCTTCATAGATAAAGCACTGG
CCTGGGAGTCAGAAGGATCTGGGTTCTAATCCCGGCTCCGCCATGTGCCTGCTGTGTGGC
CTTGGGCAAGCTACTTCACTTCTCTGATCCTCATGTGGAAAATGGGGATTAAGACTGTGA
CCCCCATGTGGGACAGGCACTGGTCTAACTTGATTACTTTGTATCTACCCCAGTGCTTGG
AAAAGTGCTTAGCACATAGTAAGTGCTTAACAAGTACCAGAGTTATTATTATCATTACAT
ACCTGGGGAGGTTAAAATGATGAATAGAACAAAAGCAAAGCAATCAATCAATCAGAGGTA
TTAATTGAACACTTACTGTGTGCTGAGCTCTGTACGAAGTGCTTGGGAGAGTACAACACA
TTAGAGTTGGTAAACACAATCACTGCCTTCAAGAGGAGGAGACAGACATGGAAATAAATA
GATGAGGGAGGTGGCAGGATTTAAGGATATATGAGGATATTTTAAGGAGATGTATCCTTT
ACTTACTTCACCACTAACCTCTCATCCACATGCTGCCTCTGGTTTGGAACACCCTCTCTT
TTCATATCTGACAGGAAATTACTCTTCCCACCTTCAAAGCCTTATTAAAGGTACGTCTCC
TCCAAGAGGACTTCCCTGACTAAGCCCTCATTTCCTCTTCTCCCATTCATTCATTCAATA
GTATTTATTGAGCGCTTACTATGTGCAGAGCACTGTACGAAGTGCTTGGAATGTACAATT
CAGCAACAGATAGAGACAATCCCTTCTGTGTCACCCTTACATTTGGAATTTGCTCCCCTT
ACTCATCCCTACTTCAGCCCCACAGTACTTATATCATTATCTGTCTTCCCCTCTAGGCTG
TAAACTCTTTGTGGGCGGGGAACATGTCTATCAACTCTATTATTTTGTTACACTGTACTC
GCCCAAGCATGAGGTACAGTGCTCTGCACACAGTAAGCGCTGGGTAAATATGATTGACTG
ATAGATGTACAAAAGTATTGTGGGGCTGAACGTAAGGTGAAAATCAAATCCTTCAGGGGT
ACAGATCTGAGTCGCCTCTCAGGGTCACACCTGGAGAGTTTCCAGTATTCTACCAGTCTC
CGCTAAGGGAGGGAGAGTCAAACAGCGGCATACCCATTCCATTCCTAGCTTGGGCAGTGG
CTAGCGAGTGGCAGGGAGAGAATCAAGGGTGGAGACTCAAGTTGACTGCACAGAAGGAGG
CAATGGTAAACCACTTCTGTATTTTTACCAAGAAAACTCTATGGATACACTACCAGAACG
ATTGCAGATGGAGTTAGGACATTCTGGGAGAGATGTGCCCATGATGTCGCTACGGGTCAG
AGATGACTCAACAGCATAAGGCCAGAGAAGACACAGATCTGAGTTCATAGGCTTTGCAGA
GGAGAGGGCTGGTAGGAAAACTCTGGGCTTAATCGATGTTACAATAAAAGAATGATCTTT
CACTGCTCCAGAGGCCAGCCCAGGGTCCCCCTCTAGACTTTAAGTTCGTCATGGACAGGG
AATGTGTCTATCAACTGTTCTATTGCACTCTCCCAAGCGTTCAGTACAGTGCTGTGCACA
CAGTAAGACTCAACATAGACAACTGATTGATTGATTGTCAGTCAATCATATTTATTGAGC
ACTTACTGTGTGCAGAGCACTGTACTAAGTGCTTGGGAGAGTACAATAGAACAATATAAC
AGACACATCCCTTGCCCACAACGAGCTTACAGTCTAGAGGAGGGAATCAGACATTAATAT
AGATAGAGAGAATATAGATAGATAGATTAGATATAGATAGACAGATAGATAGATAGATAG
ATAGATAGATAGATAGATAGATAGATAGATAGATAGAGATAGATATAGATATGTACATAA
GTGCCATGGGGCTGCGAGAGGAGATGAATAAATGGAGCAATCAGAATGACACAAAAGGGA
GAGGGAGAAATCTGACCGTCATGACCTTCCCCACGTTCAAGTTGTTTGGAACACTGAACA
CCCACCTCTGCTCTAGACTCTGAGCTTTTTGTGGGCAGGGAATGTGCCTGATGTTATATT
GTTCTCTCTCAAGCACTTAGTACAGTGCTTTGCACATAGTAAGTGCTCAATAAATACGAT
TGAATGAGTGAAAGAATGCTGCTGCGTCTCGTGCCTATATTGTACTCTCCCAAGTACTTA
ATGCATTGCTTTGTACTCAGTAAGCGCTCAATAAATATGACTGAACTGAACTATCCCATT
CCAGCATGGCCGGACCTGAACCCCAGAGCAGCAAATTTCCTCTGAGACCCCAAATCTCCT
ATGACAGGATGGGCTAGCAGGGTCACATGAACACGGCTGCTGCCCCTCTTACCCTTTCCT
ATTTCCCACTTCTTCTCTTTCCTTTATATCCCCTCCCACTCCACTCCTCCTTGCCCAACT
CCCCAATCTCTTAACTCCTCATCCTTCCCCTCTTCCACTCCCACCTCGTCAGAACATTGC
GAATCTGGAAGAACAAGAAGTCAAGTACTGCCAATATTTTGTTGTCACTATTGTTTTTAT
TATTGCTCACATTTATTAAGCCCTGGGGAAGAAACAGGATAATGAGATCAGACACAGTCT
TCGTCCCATAATCCAAGCGGCGAAAGATGTCAGGGAAACACAATCAAAACAAGTTAATAG
CAAATTAATAAATCTATTGGGAGTGTTAAATAATAATAACTATGGTATTTGTTAAGCACT
TACTATGTGCCAAGCACTGTTCTAAGCTCTGGTGTAGATATAAGGTAAGCTGCTTGTCCC
ACGTGGGGCTCACAGTCTTAATTCCCTTTTTACACATGAGGGAACTGAGACACAGAGAAG
TGAAATGCCTTTCCCAAGGTCACACAGCAGACAAGTGGTGGAGCCGGGATTGGAACCCAT
GTCCTCTGACTCCCAAGCCCAAGCTCTTGCCACTAACCCATGCTNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGCATAGAGAGGTTAAGTGGCATCGTGGA
TAGAGCACAGGCCCGGGAGTCAGAAGATCATGGGTTCTAATCCCAGCTCTGCAACTTGTC
CCCTGGGTGACCTTGGGCAAGTCACTTCACTTTTCTGTGCTTCAGTTCCCTCACCTGTTA
AATGGGGATTGAGACTGTGAGTTCCACATGGGACAGGGACTGGGTCCAACCCTACTTGCT
TGTATCCATCCCAGCACTTAGTACAGTGCCCGGTGCCTAATAAGTGTTTAACAAACACCA
TAATGTTTTTTACTGTTATGCTGTTTTGCTGTTACAGTCATCACTACCCTTGGTGGAGGG
CAGGAGGGAGGAGACTGAGCTGTACCTCCATCTGTGACCTTTGGACACTTGATGTTCTCC
ATATCCCCAACCCCGTAGCACCTATGTAAATGCCCATCAAAGGGCAGGGACTGTCTCTAT
CTGTTACCGATTTGTACATTACAAGCGCTTAGTACAGAGCTCTGCACATAGTAAACGCTC
AATAAGTACTATTGGATGAATGAATGAATGTCTTTAAATTATATAGTACAAATTTTTTAT
TCACATGAATGTCTGTCTCCCCCTCTAGACTGTAAGCTCATATGGGCAGAGAACGTGTCT
GCTAATTCTGTTGTATTGTACTCTCCCAAGCGCTTAGTACGGTTCTCTCCACATAGTAAA
CGCTCAATAAATACAAATGATTGATTGATTGATGGCTGAGCTCCCCACAGCCCCGATGGT
GCCTGGCTCTGCTCCTCTGCCCAGTGTCTTCTCCTGTGTGTGGGAGGGGGTGGGGGACTT
CATTCCCCTGGAGACAAAGGAGTGGAAAAAAAGCCGGGGCCAAAACGTCTCCTTTCTTAA
CAAAGCCATGTTTGAACCGTACTTCAGACTCTAAATAGATTTGTTTTTTTCAGGATCAAG
ATGTTGATTCTCCCTCCGGTTCCGGTTCCCAAGATTAAAGGGATTGACCCAGATTTCCTA
AAGGTAATAAACAACCTTCACTTACACTTCCAAACCTAGCTTGGCTTCCTATCTTAGATA
GCGCTCACAATCCAATAGTATTTATTGAGTGCTTACTGTGTACAGAGTACTATAGCAAGC
ACTTGGTCCCTCCTCTAGACTGTAACCTCCTTGTGAGCAGGGAATATGTCTGTTTATTAT
TGTACTGTACTCTCCCAAGCACTTAGTACAGTGCTCTGCACACAGTAAGAATTCAATAAA
TACTATTGAATGAATGCGGACCACCCCCTTCTCCTGAAAACATTATCCGACCTTGGCTTC
ACTGACACTGGCCTCTCCTGATTGTTTTTTTATGGTATTTGTTAAGTGTTTAGTATGGGT
CAGGCACTATACTAAGCCCTGTGTTAGATATAAGCTAATTTGGTTGGACACAGTCCCTGG
CCCACGTGGGGCTCACGGTCTTAATCCCCATTTTA
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1068, 1108..1248, 3703..3860, 4543..4721, 9235..9396, 10416..10498, 17333..17448
1001..1068, 1108..1248, 3703..3860, 4543..4721, 9235..9396, 10416..10498, 17333..17438
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved