Ornithorhynchus_anatinus Locus Mono:SNORA7
snOPY snoRNA Orthological Gene Database
Ornithorhynchus_anatinus Mono:SNORA7
Ornithorhynchus_anatinus
Mono:SNORA7
Contig203042
SNORA7
488..627
735
TGGAGGTTCTTATTTAGAAACGGCCTGGTTTATCTGCATGTGCTCATTAGATGATTGAA
TCAAAGGATGATTGTTTTAACCCAGGCCTTTAAAAATGGCCCTGACCACAAAGCTATGTG
GAATAAACCTTGGGTTGCTTCTTTAGAGCCATGGGCAAAACCACAGCATTCCTTCATTCC
ACCTCATCACGTAACTTCCTCCCTGCACTTATTCTCCTGTTTCTTCCTGGCATCCTCACG
TAAAATATTAAGACAGAGGCCTCTCTCAGATAAATCCAAGTGAGAAACAGCTTGGCCCGA
TGGATCGAGCACGGGCTCGCAAGTCAGAGGTCCCGAGTTTCACCTGCCCGCTTGGACAGA
TCGCTTCGTTTCTTTTCGCCTCAATTTCCTCATCTGTAAAATGGGGATTCGATACCCGTT
CTCTCTCTCTCCCTTAGACTGTGAGTCCCATATGGGACGGGGATTATGTCGGACCCGATA
ATCGGGTCCGCCTCTCAGGGTCGCACCTGGAGAGTTTCCAGTCCTCCACCGGTCTCGGCT
ACGGGAGGGAGAGTCGAGCGGAGGCCCGCCCGTTCCATTCCCGGCTTGGGCGGCGGCTGG
CGAGTGGAAGGCAATATCTGCTACAAGTCAAACCCCCCCCCCCACCCCCCCGTGCTGGGG
AGCAGCGACTCTGGACAGAGTCGAGGGCGGAGACTTCAGTTTTACTGGGTGGAAAGGTCG
CAGCGGGTAAACACCT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved