Ornithorhynchus_anatinus Locus Mono:SCARNA16
snOPY snoRNA Orthological Gene Database
Ornithorhynchus_anatinus Mono:SCARNA16
Ornithorhynchus_anatinus
Mono:SCARNA16
Contig19812
SCARNA16
1001..1188
2188
GGGTGGGTTCACCAGGGACCCTCAGATCAATTGAATGGAGTGGTATTTAATATGTGCAG
ATCACTGTACTATGTGCTGGAGAGAGGACAGCACATTAAAAGTTGGTAGACGGGATCCCT
GCCCCACAGGGAGCTGACAGTCTAGAGGACAGTTGTTAACTGATCCTGCCCTCTGGAATG
GGCTTCAGGCGGATTGTTGCTTTGGTGACATTTCTGACGGGGTGCAGGTGGGCTTCCTTT
TGGGGGAGATAACGAGGTGGTTGGATACCCAGATATAGGAATTACATGAGCATCAAGGAA
TTACTGAGTCAGTTGAGTCCTTCCCCTTGAACAAGTGTGTAACGCCACCTGGGTAATGAT
GGAACAGGAAGGATTTCCTCTCTTTCCTCAGGAGGCTGTGAGGGGTGGACCTGTCCGATG
GGACGGCACAGAAGAAGCTTTTGGAAATAAGCAGTCAGCTGTGGGGTTTTTGTCAATCGG
GGTGAGTTTCCTCCTTCGCCTACCTCGTCCCTGAGTAGCTCCCACTCCCTGTCCGCTCTG
GGCTCTCGGTAGAAGCGGGATGGCCTAATGGGTGGAGACCAGGCGTGGAAATCAGAAGGA
CCTGGGTTCTAATCCCAGCTCTGCCAATTGTCTGCTGGGTGGCCCTGAGCAAGTAATCTC
TGGGCCTCAGTGACTTCATCTGTGGAAAGGTGTGAGAGCCCTTTCTGGGACATGGACTGT
GTCCAACCTGATAATCTTGTATCTACCCCAGCGCTTAGTACAGTGCTCGGCACATAGTAG
GCACTTAGATGCCATTAAAAAAATATATCACTCTGGCGTTTGTTCCTGAAGAAGATGGAT
GGCGACGTGGCCGGTCACCAAAGCTGCAGCCACGTCCAGCCCGCGGGTGTGGGAAGGTAG
GCCCTCTGAGAGAGCGGGAGCCGGCCACAGCTCACCTCCCTCGGCTCGGGTGCCCGGAAG
GAAGCGCGTCGTCCCCCTCCGTCGCTCACCCGCCGGGACCTGTGGTCAGGAGAAAGGCTG
CTGAGTGGTTGAGCCCGGTCAGCCGGGCACGGCCTTGTAGCAGTTGGCCTTGATCCCCGA
CCTAGAGTAAACCCCCAGGAAAGCTCCTTTCTGGGATTTGAACTTTGCAGTAGCAGGTGT
GAGCATTCTAGCAGCAGTTTGATGATCATGTATGATACTGCAAACAAGACGCCCCCAGCC
TCTGTCCTCCCCCCAAAAGCCACCCAGCACCGGTTGTGGGCGGAGGGGCGGACCAGGGCC
ACTGGGCTGCACCCTCAGGCCCCCAGACCTGGCGATAAGGTTTCGGTCCCATCCATCGTG
TCTTCCCATCTCCTCTCCACCCCGAACCACACCCCCCCCCCGTTCCCCCTTTCCTATTTA
ACTTGGCACCTGCTCTCAGGGAAGCGGAGCCTTTTCAGGACTCGGGTTATTTTCTCGCCG
GTCTTGTTTTTCCAGCTTCCCTGGGTAACCCACATTCCTATCCAGGCTCCCTCCGCTCGT
CACCTTTCGGTCTGAAAGCCGGACTCTTCAGCGGGGGTGAGGGGTTGGGGAGATAGGACC
AGGAAGGCATCCACACCCCCGACTTAATGCCCCATCACTGTTTTCAGGCCGGCGTTCCGG
AAGAGCGCCTCGTCGCGGTGGTACCAGGGAGGACCGCCGCCCGTCAGCCGTGGATTGAGG
TTTGGGTTTTCCGGGGGTGTGTTTTTCCCACTGCCACACTCGAGTCTTCAGAATAAAAAC
CAGACTGTCCCAATGTAATTTTGGTTGCTTCGAAGAAGCCGGAGTCTCGATGTAGAGAGT
CTAGAGGTTGACCGAAACCCTGGTGATCGGAATCATCTCCCCGATGATCCAGGGGTGTCA
GTCAGTCGATGGTATTGGTGGCAAGCCTTCCATGGGCAGAGCACTGTCCTGAACACTTGG
GAAGGATAATGGAATTAGTAGTTGTGATCGATCCCTCCCCTTAAAGGAGCCTATAGTTGG
CCATGTGAGCTTCACTGTACTGGGGGCTTGAACAAGTACACTAGAATGAGTAGAAGTGGG
AAGCAGTGTGGCCTAGTGGAAAGAGCCTGGGACCTGCGTTCTAATCCCAGCTCCGTCACT
TATCAGCTGTGTGACCTTGGACAAGTCACTTCACTTCTGTACCTCCGTTACCTCATCTGA
AATGGGGATTAAGACTGAGAGCCCAACAT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved