Ornithorhynchus_anatinus Locus Mono:SNORA62
snOPY snoRNA Orthological Gene Database
Ornithorhynchus_anatinus Mono:SNORA62
Ornithorhynchus_anatinus
Mono:SNORA62
Contig195309
SNORA62
39..199
648
GTTAACCGCACTAACTCCCGGGGGCCCGGTGGGACGGTCCCGCACGCGGCTAGAGCTTG
GAGCTGAGGCCGGTCTCCGGCCGATGAACTACCGAGTGTAGGTCGTGTGCCACAGCGAAG
GACGGCGGGTTTTTTCGCTAACGCCACGAGGCCCTCGGTGGGCCGACGAGTGGAGTTTGA
TAGTGACATCTGCCACAGGTTGGAAACTGGCGGGGCCTTGTGAAAGCTGAAAACGGGGGG
GGGTGGGGACAAGCGGCAGGTCTCCAGAGGTCCGCGTGCGTGAGGGGCAGCGGACGTCCG
GAGCCTCTCCGGACAAGAAGCTAAGCGACTTGCCCAGGGTCACGCAGCAGACGGGGGAGC
GGAGCCGGGATGGGAACCCAAGCCTTCCTGACTCCCGGGCCCGTGCCCTCTCCGCTGGGC
CGCTCCTGCACGGGGGCGTCGTCCGCGTCGTTGGGCCCGGGGCAGTGTCAGGCGCAGACT
TTTCTTCCTCCCGTCCCTTCGACTTCTTCGTGGGTTCTTGAATTGTCTCGCCTTCGGGCC
CCGTCCACTGAGAGGACGCACGTCTGGTCTTTTCCCCTCTGCTCCGCCTTCCCCCCCCCG
CACCCGTCGTAACCTTGTTCGATCCCCTCCTCAGCGCGCCGTGCTGAAG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved