Ornithorhynchus_anatinus Locus Mono:SCARNA4
snOPY snoRNA Orthological Gene Database
Ornithorhynchus_anatinus Mono:SCARNA4
Ornithorhynchus_anatinus
Mono:SCARNA4
Contig18997
SCARNA4
1001..1133
2133
TTGTTAAGCGCTTACTGTGCGCCAGGCGCTGTTCTGAGCGCTGGGGGAGATACAAGGTC
ATCAGGTTGGACCCAGTCCCTGTCCCCCGTGGGCTTCACCATCTTCACCCCCATTTTCCA
GATGAGGTGACTGAGGCTCAGAGAAGCCAAGTGACTTGCCCAGGGTCACACAGCAGACAA
GTGGAGGAGTCGGGATAGTAATAATAATAATGTTGGTATTGGTAAAGCGCTTCCTATGTG
CGGAGCACTGTTCTAAGCGCTGGGGGAGATACAGGGGAATGAGGTCGTCCCACGTGAGGC
TCACATTCTTCATCCCTATTTTACAGATGAGATAACTGAGGCACAGAGAAGTGAAGTGAC
TTGCCCACAGTCCCACAGCTGACAAATGGCAGAGCCGCGATTCGAACCCATGACCTCTGA
CTCCCAAGCCCGGGCTCTTTCCACCGAGCCACGATTCGAACCCAGGCCCTCCTGGCTCCC
CGGCCCGTACTCTGTCCACGCCCCCTGTACTGTGTGCAGAACAATCGATCGTATTTATTG
AGCGCTCATTATATGCAGGGCACTGTACTGAGCGTTTGGGAGGGGACAGTCCAACAGTGT
TAGGGACACATTCCTGCCCTCAACGAATTTATATTCTAAAGAGGAGGATGGTGGGGATGT
CAACTGTGCTAGGAAAGTTAGGTTTGGAGGAGGTTTTTGGGTGGGAGGATGAGGTAGACA
TATTCATTGGTATTTACTGAACGCTTACTGTGCGCAGAGTACTGTACTAAGCGCTTGGGA
AAGCACTACATAACAATAAGCAGTGACATTCCCTGCCCACGTTGAACCCAAGGTGTCCAT
CGAGAACAGCCGCATCTGCGTACGCTGCTCGGTGTCTCCCACTCATTTCCTCCCCGTTTT
CCAGATGAGGTAACTGAGGCACGGAGAGGTTGAGTGACTTTCTCACGCAGAGCAGACAAG
TGGCAGAGCCAGAATTAGAACCCAGGTCTTTGTGATGTCTCCTTGGAGGATTAAGAAAGT
CGAGTCATTGCAGTCCAGCAGGTTCGACTGATACGCTCCTCCTACATGAAAAAGGTAGAG
GAACAGGCCCTGGGTGCCAGGTCGACTCTGGGCCTACTTACTCTACCTACAGTGATCAAT
CCGTGGTTTAAAGAAATGTATGGAAGTGCTGGGCCATTTGTTAAGTGCTTTTTGCCAAGC
ACTGGACGGAGCGCCGGGGTAGATACAAGCTAGTCAGAATGGACACAGTCCGTTCCTGTC
CCGCATGGGGCTCACAGTCTAAGTAGGAGGGAGTAAGATCTAATCCCCATTTTACACATG
AGGTAACTGAGGCCCAGAGCAGACAAGTGGCGGAACCAGGATTAGAACCCAGGTCCTCTG
ACTCTCAGGCCCGTGCTCTGTCCATGAGGCCACGCTGCCTCCCTTCATTGGATTGAGAGT
TTATTTGGTGAAAAATAAGGTGATGTGTGAGCCACTTGGGGTAGAGTCCTTAAGCTCATG
GGCAGAGAATGTGTCTATTTATTGTTATAGTGTATTCTCACACAGTAAGCACTCAATACA
TTCGAATGAAGTGAAAGACATTCCCCATTCTAGACGATCTTAAAATTTGCCCCAGTAGTG
AAAAAGTGAACCCGGTGTATAAATGCTGCTTCTGGTGGTGGTCTGTCTTTTTCCCACCGG
AGGTAGCTGTCCAAATAGGCAATTCAGCCCAGTCCGCCCTAACGGGGATATGGGGTTCTC
GAAAAACCCCGGGTCACAAAAACTCATGCCGTGTGTATGCCTAAAACCGTTTCTCCCAAC
ACCACGCCACCGCGTCCCCGTGCGTTGCAGGGAGAGAGGTCCCCGATGAAAGTTTAATAG
ACCCGAGGAGGGTCTCTCTGCGACCTTGGATGAATAATAGATCGTGGGTATGTGGATCCA
AGTTGTCTTTTGGCTGAATAGGAGGAGGAGGAAGATAACATTTGAACGTGAAATATTGAC
ATTTGTCCACTTATAACTGAATTCATAATCATTCTGTTACAAATTTACATTGCTATTTCA
TACCAGAAGTTTTAAGCTGTTTATATTTGTCTTTTTTTTTTTTAGATCAGACGTTTAATA
CAATGCCCCAAAAGTGCTATTGATTAACTCACTC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved