Ornithorhynchus_anatinus Locus Mono:SNORA7
snOPY snoRNA Orthological Gene Database
Ornithorhynchus_anatinus Mono:SNORA7
Ornithorhynchus_anatinus
Mono:SNORA7
Contig189236
SNORA7
39..176
961
TTAATCGATAGGATTTAATGAGAACCTAAGCAGTGCTACACCTCTCAGGGTCACACCCG
GAGAGTTTCCAGTACTCTTCCAGTCATGACTATGGGAGGGAGAGTCAAGCAGAGGCATAC
CCATTCCATTCCTAGCTTGGACAGTGACTAATGAATAGAAAGCAATCTCCTACAAGTCAA
AACTCACCTGTGCCAGGCTGCAGTGGCATAGGAGAGACTTGAGGGTGGGGTCTCAGGTTT
ACTGCGCAGGAGGCAGTGGTAAACCACTTTGTATTTTTACCAAGAAAACTCTGTGAATAC
ACTACCAGAACAATTGCAGATGGAGGTGGGGCATTCTGGGAGAGATGTGGTCAATGGCTT
CGCTATGGGTTGGATACGACTTGACAGCATAAGACAACAACAGGAATAAGTGCTAAGCAC
TGTACAAAACCAGTTGAATGAGTAATGACAGAAGCAAGATGGATGATGATTCTTGCCCTC
AAGGAATTTACAATCTAAAGGAAAGACAGAGAAGACAGACAAAAGTAATACAAAGCAAGA
GCCAGAGGAAGAATGAGGATTTAGAAGGATTTAGTAAAAATATATCTGGATGAAATGAAT
GAATTGATTATTAAATGTACATATATGTGTGTCTATATCTATATACATATAACATATACA
CATATATATTTACATAGAGAGAGAGGGATAAAGTGTAAAGTATAAGAATAAAATACATAT
GGGTTAGGGACTGTGTCCAACCTGATAATCTTGTATCTATCCCAGTGCTTAGTACAGTGT
TGGTACATAGTAAGTGCTTAACGAATGCCATTATTATTATTATTAGCTAATGGTAGTTGT
TGAGTTTGCATAACTGGGGTGTAGGGAATTCATCCTCTCCACTACTTACCAAATTGTCCA
GAGAGTGGTTTTAACTTTCATTCCTTGCTTTGCCCTTTACCGGTCGAGCCTGTAAAATGC
TT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved