Ornithorhynchus_anatinus Locus ENSOANG00000021427
snOPY snoRNA Orthological Gene Database
Ornithorhynchus_anatinus ENSOANG00000021427
Ornithorhynchus_anatinus
ENSOANG00000021427
Contig18615
snR56, SNORD27, SNORD28, SNORD22, SNORD29, SNORD30, SNORD31, SNORD22
998..1062, 2299..2369, 2563..2638, 2797..2922, 3096..3162, 3353..3421, 4263..4330, 4521..4647
6048
ATTCTCTTCCCTTCTTCAAAGCCCTACTGAGACCTCACCTCCTCCAGAAGGCCTTTCCA
CACTGAGCTTCCCCTTTTCCCTCTGCTCCCTTTGCTGCCTCTGCCCCCTCCTCACTTCCC
CTCAGCTAACCCCCCTTCCCCCCTTTTCCCTCTGCTCCTCTCCCCTCCCCCCAGCGCTGT
GCTCATTTGTATATATTTTACTACCCTATTTTGTTAATGAGATGTACATCCCCTTGATTC
TATTTATTGCTATTGTTTGTCTGTCTCCCCCGATTAGACTGTAAGCCCGTCAATGGGCAG
GGATTGTCTTTCTGTTGCCGAATTGTATATTCCAAGTGCTTAGTACAGTGCTCTGCACGT
GGTAAGCGCTCAATAGATACTGTTGAATGAATGAATGTCCTGCCTCGGGGAGAAAAAGAA
CTGCAGTAGCTTTTCTCGATGATGATTTTCACAGACCTATACTGATTTCTGTGAGGAAGA
AATACTTTCTGAAGAGACTGAGCCTTGCACCTTTTGAAGTGCCACTCTTCTGACCCAAGG
GGCAAGGGGGATAAGGAGGGGGAACCGAACTGCTTTTTGGTGCAGAATCCCATGAAGAAC
AAAAGCAATCACGTGATCTGACCGATATTTTTTCCCCTGTAGGAGCCAGTATGGCTACGG
TGTCCTGCAGGATCCTAGGCGTCAACCAATTCACCTGCCATTCTCCCAACAAAATGTAAG
TGCAATTCCCCAGGAAGTGTAAGTGCTTACTATGTGCCAGGCACTCTACTAAGCGCTGGG
GTAGATTAGGATGGAAACAGTCCATGTCCCAAATGGAGCTCAATCCCTGTTTTATAAATG
GAGGAAACTGAGTCGCAGAGAAGTTAACTGATGTGCTGGGATTAGAACCCCAGCTCCTTT
GAACTCCCAGGCCCATGCTACACTAGCCTCCTCTACACCGCATAATGGAAATCCTTTGTT
GCCATGCCTTGGGAGAAAAAAAAATTGCAGGAGCCTTTCTCGGTGATGAAAAATTTTCAC
AGACCTGTACTGACATCTGTGAGGAAAAAATACTTTTCTGAAGAGACTGAGCTTTGCACC
AATTCTCACTGAAATCATGGGGCCACCCAATGGGGCCCTCTGTCATTGAGAATCCTGATA
TAAAGATTATTTATTGAATACCAAAGTGATCTGAATAACTGATTTTTTTCTCTTCATAGG
GGCCAATATGGCCAGTGTCCTTACGTGATCATGGGCATCAGCAATTCTTTAACCCAAACT
AATGTAAGTGCAGAATATACAGACCTTGGTATTTTTGTTTACTTGCTATGTTTTAATTAG
TAATGTATTAAATGCTGTGACAAGCCCTGGGGTAGATACAAGGTAATCACGTTTTCCACG
TGGGGCTGGGTCTTAGTCCCCATTTTACAGTTTAGGTGACAGGCACAGAGCTGTTAAGGA
GTTGCCCAAGGTTACAGAGCAGACAAGTGGCAGAGCTGGGTTTAGAACTCATGTCCTCTG
ATTTGCTTTTTCCACTAACCTGTGGAAAAAGACTAAACTAGGCTAAGCCATGGGGCAGAT
TGAAGCTAAGCAGATCGAGCCCAATCTGTCCCACATGGGGCTCCATTTCAATGGAAAGTG
CATTTACCAAGCTCATACAGCAAGTACTAGGATTAGAACCCAATCCCTCTGACTCTTAGG
CCTGGGCTCTTTCCATTAGGCCACACAACTTAACATGGAACTTGGATGTGCTGCAGGGAT
GATGTAAAAATGAACTCTCTCTTTCTGATGGTTCAGTGGGAGAAATTTTACTAATTTNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTACTAATTTCTGAGTGGCATTATTC
TTGTTCCAGTTAGGTCTGCTTTCAGTTACAGGAGATGTCACTGGGAAGCTCTGTGGAGTG
TATTGTACTGTACACTTAAATGCTTGACATAAGCTGGGTTTTCCATAAGTGCTTGAAGTA
ATGAGGTCTAAAATTTTTTTTGCCACAGAAAATGCAATTTATGTCCTGAGTCCATGGACT
GAAGACAGTTTTCCAACCAGCACCGACCATCTAGTCGCAGTGATGGCCTCTAAAATGACA
GACCCCAGGTAAATGAGGTCTGTGTGGAAATTGTCCTAGATTCCATCTGGGGGAGGGGAA
ACTACATAACGGCCTCCACTTTCCCTGATGAAGGTAAAAAAGACAAGCATATGGCTGATG
GCATAGTGATGTCACTTTACTTCTGAGAAATAGGCCAGGGGGACAGTAGATCTGTATATG
TACAATGGGCATTTGGTTGACTACATCTCTTGTCAGTAGATGACCCAGCAAGGATGGAAA
ATGGAACCCAACTGGACTACAGGTAATTTTGGGGTGAGTGCGTGGAGCTGCTCCTTGGAG
AAATACTCTCGAGTGAACACATCCTTAGGCCCAGCTAGTCATTGCCAGATGATTTCAATC
CTTATTTTCTGATGCTCCGTGAGGTACAGATATCATAGCATGTTAGAGTTCTGATGGCAA
TTCCCTCTACATAAAATGTCTGACACCACACTAGACCCCTCTGACCTGTCTTTTGCTGCT
TTTCCCAGGTCTATCCGTGGTGCTTCTGCGAGCTTCAGGTAAGATCCTTCTTTATGTTTC
AGGAAAGTCTCATGACTCCCACTTGCTAACACAAGGGTACTAATGAGGAAATCCACACCT
GTCTTAGCTCCTGTCCAGTTCCAGAGCCTGCAAAGGCGAACCCACTGGAATTGGCAGGGG
AGAGAGGAAGATAAAATGTTCCTGAGTGAACAGTCTGATGTGCCCTATTGAAATCCAAGA
AAGCCTTTTTCATAATGTGACATAGCCCACTCTCACCTGTCTAATTTCTCACTTTTAACA
GTTGCTGCAGCTGCTGAAGGGAAGGTGGAGAAGTAATAAATATCTTGTTATGAGAGGTGA
GTTAATAAACTTCACATGGGGACCCCCTTCATGCAGTTTCTATGATGATTCTAACTAGCT
CACTTTGATAACTAAAATGAAAACCCTTGAACATCTGAGAAACTGCTCTTTCCCCAATCC
TGAGGACCCTTTAAAGCTGTTTTTTGCCACTCCTTGCTACTTTCTAAGTTCTCATACCTT
TTTTTCCGCTTTATATAGGTCCTTAGAGAACAACTGCCAGTGGTGAGTTAAGGAAATTGA
CTGGGGTTTTTTGGTGGTGGTACCCAAGTGTGAGGGCAAAATTTGTGAGGGGAGGATGTG
ATGAATTTCTTGGAATCTCGTTCGGCTGAACTCTGCTGTTGAGACTTGGAAATCTGATTG
TCAGCAGTAGCTGACGTTGGGAGAAGGATGGAAGCCTTGCTGAAGGAAATGTTCTGAATC
TCCTTTCTGCTTGTTACAGCTTACCCGTTTTGATAGGGTCAAGACAAGACTGAATAAAGG
TAAACTCTTTGCCTAACTCCTGAAGTGTGCCTGACTCAAACAGCCCTCCTAATTGTCTGA
AAATGCAAACTGCCCAAGTGGATTTTGAATTAGGCACCCTGAGCAGTCTTTAACTGGCCA
AGGAACATTGCTCATTGATGGATGTGAAAGCATGGCTTCTATTCCTGGGTCCCCCACGTA
TCTGCTGGGTGACCTTGGGCATCCTTCACTTGTCTGACTGCCTTTGTTACCTCATCAGTA
AAATAGGGATTGAGACTGTGAGCCCCATGTGGGGCAGGAACTGTGTCTAACCCAATTTGC
TTGTCTCTGTCCCGGCGCTTAGTATGGTGCTTGACAAGTAGTAAGCAGTTTGCAGATACC
TCTTATCCATCTCAACAGTTAATGAAATGCAGAACAATCCCATCCCCTGGTAAATACCCA
ACCTCATAGGTGGGAAGAGGGTGGGTATGCTCTCCAAGGATGATTTAGTACCACCTTAGT
CTGGTTGCTGGTAATCCCCATCTGAGCTTAGGAGCAGGGCATTAAATTAGAGGGATTGTC
AGACACCCCCCCCCCCAATCTAATGTTTGCCTCCTCTGAACATGGCAACATCAAGTGAAT
TGCTAAATTCATGATCCCTGTTTTTCAGCTTCTTATGCCTGGAAACATTCTCAGTGTTTG
GCAAGAGAAATGGCAGTTTGGGTAAGTATTAATAAAGGGAAGATGAGGGAATTGCAGGAT
AGCAATATTCTGTGATGAATCTATACCGCCCCAGTCTGATCATTGTGACTGAAAGGTAAT
TCTGAGCTGTCAATCCTGGGTCTCCACCCCCCATTTTCATGGTCAAGTAAATCTACTCTT
GATTTAGCATCACTTTTTTTTTCCTTTTCAGGAGATTGTTGACTGTATCAACTCTGACTG
CCTGGAACCCTTCAAAAGAGCTGGAACAGGTAAGGGGGAGACTTCAGGGAGAAGGAAGTT
GAAATGTTATTGTCCCCTGGGTCCTAATGAAGAAAACCAGCACCTGTCTTACTCCTTGTC
CTGGCCCCAGAGCCTGCAAAGGCGAACCCACTGGGGTCGGCTGGGGGAGAAGATGATAAT
CTGTTCCAGCGGGAACAGTCTGAGGGACCCATGTTTAAAAACAAATGAATTTTTTGTGGT
TGAGCTTTAATGCCTCAGCTGCATTCCCTTCTTGCAACAAACGTGGCTCAGTCATTACGT
CTTATCATGACTTTGGAGAGCCTTTTCACTGCTATGTAACCCCTCAAGTGATTAGCTAAA
GCATATCCAACTGGCCATACCTATATCATCTCCTTTTACCGTGTACAATTTTCTGCTTAA
GTCCACTATACATATATGCTGTGCACATCAGTTGAGAACATGCACCTTGCCTTTTAGAGG
ATTTTAAGTAACACACCCTTTTACATAACTTTCTTTTTCTGCAGATGCTGTTGAGCATTT
AAGCTCAGAACAACAAAACATGGTGAAAACAACCCTTCTCATTCTTTAAATAAACTTTAA
AAGACTACAGATTTGTGTCTTGTGATTTTTTGGTGGTGGGTTAAAAACTGTGGGAAGGGT
ACATGCCTTTCTTCCTAACCTCACTAGTGGTTAAGGTAGTTTAACCCAAATATTCTGTAC
TTCATTTACTATTTAACCATCCCAACAAAGAAGTGCCCCAACTTTTAAACCCCAACTCCT
GCATCTGCCAAAGTCTACAAAGCTGCCAGCCAGAGTTGTGGCAGGAAAGGGGGAGCTAAT
GATGACCAAGAAATTAGGGCTCCATTGGGGTTGCGGTGGGAATGGATAGCATGAGTGGTC
TTAAACACAGGGGGCTAGTTTTTCATCCTTGGGCGATACCCCCATCAAAAGTAGCTGGAA
TCCTGCTCCCATTAACTGTTGTCCAAGAAATCAGCAGGGTGGGGTGGAGAGAGCACTAGC
CTGGGCTTGAGAAGGGCTGGGTTTTAATTCAAAAACATGTCTGCTGTGTGATCTAGCATG
AGATTTACTTTCTGCCTTAGTTGCCTCATCTGGAAAATGGGATGCCCACCTGTGAGCTCC
AGGACAGTGAGCATCAATTTTCTTTTATCAACTCCCATTTTATCCAATGCCTGCCACAAA
GCAAGCATTTAAATGCCCTCCCTGCAAAATCCTGGGATCTAAATATTCCTTACATACCAT
GCCCCATGGCTGCTTCCAGTGTGGGTACTAGGGGCCTTGGACCACCAGGATGCCACCTGC
CCCAACCTCTGCACTGTTAGACAAGCAGTGCCAAGATGGGGATCGCAGGAGTGGGCAAAA
GAGTGGTAACTGTTGAAGCTGCCCACGAACTCAACTGTGGAGGGAGGTGGAAGAGCTTGC
TACTGGCTAAGGGGCACCATGACACTACCGAGTGTTTGGAAGGTTAGCATATAATAACAT
TCCCTGCCCACAATGAGCTTAAAATTTAGAGGGACATGAGTTTACAGTCAGATCCGGGAC
TGCTTATGTTTATTAGAGCCACTGTACTAAGCAGGTAGGTACCCAGATG
  Untranslated Region
  Coding Sequence
  snoRNA
3001..3055, 3258..3281, 3499..3538, 4168..4220, 4411..4468, 4964..5048
4209..4220, 4411..4468, 4964..5028
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved