Ornithorhynchus_anatinus Locus ATG16L1
snOPY snoRNA Orthological Gene Database
Ornithorhynchus_anatinus ATG16L1
Ornithorhynchus_anatinus
ATG16L1
Contig1847
SCARNA6
40702..40875
51545
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAGGGTGATCAGGTTGT
CCCACGTGAGGCTCGCAGTTAATCCCCATTTTCCAGATGAGGTCACTGAGGTACAGAGAA
GTGAAGTGATTTGCCCACAGTCACCCAGCTGACAAGTGGCAGAGAGGGGATTCGAACCCA
TGACCTCTGACTCCCAAGCCCCGCTCTTTCCACTGAGCGACGCTGCTTCCCCAACGTGGG
ATTTGTAATAATAATAATAATAATAATAATGTTGGTATTTGTTAAGCGCTTACTAGGTGC
AGAGCACTGTTTTAAGCGCTGGGGTAGACACAGGGGAATCAGGTTGTCCCACCTGAGGCT
CACAGTTAATCCCCATTTTCCAGATGAGGTCACTGAGGCCCAGAGAAGTGAAGTGACTTG
CCCACAGTCACCCAGCTGACAAGTGGCAGAGCGGGGATTCGAACCCATGACCTCTGACTC
CCAAGCCCAGGCTCTTTCCACTGAGCCACGCTGCTTCCCCTGCGTGGGATTTGTAATAAT
AATAATAATAATGTTGGTATTTGTGAAGCGCTTACTAGGTGCAGAGCACTGTTTTAAGCA
CTGGGGTAGACACAGGGGAATCAGGTTGTCCCACGTGGGGCTCACAATCTTAATCCATTC
CAAGCGCTTTGTACATTCTCTTTTCGAGTACACCCTGCACATAGTAAGCGCTCAATAAAT
ACTATTGAATGAATGAATAAATACTATTGAATGAACGCAAGGGGAGCAGTGAGGCGAGCT
CTCCTGGCCACTGCCAAAATGGCCGCCTGCTCTTGTCAAGGGCGCTAACAGAGCCACCCC
GAAAATGGCCGCCGGCGGGCCGGGAGGGTCACGTGTCTCCGTTCGGCCAATGGCAAGCGT
CCCCGCCCCGCTAGTTCGGCCCCCTCCGCCTTGACCAACCCCGCCATGGCGGCCTGGCTC
CTCGGGGCCTGGCTGGGGTGAAGGGGAGGCCTTCTCTCCCGGGGCGGAGCGAGAGGCGGC
GGGGAGGAGTCTGTGGCCCCCGCGGGGGGCTCCATTGCTGCGCGCCGGCGCCGGGGCCTT
GGAGGCCGGGCCATGGGGCCTAAGATGGCGGCGGGGAGGCGAGGCCGAGGTAGGCCGCAG
CGGGCCCGGCGGGAACCCCCAAGCCTCTGAGCGCTCCCCGTGGGGCCGGGGCTTCGGCGC
CATGGCGGCCGGCCTCAGGGCGCCCGGCCTCCCCGGCTGGAGGCGCCACATCTCCGAAGA
GCTGCGGCGGAGGGACCGGCTGCAGAGGCAGGCCTTCGAGGAGATCATCCTGCAGTGTAA
GCAGGCCCCGACCCCGCCGACCCTTTGACTCCCAACCCTCATGACAACAGCGGTGCTTGC
CCAGTGGTCCATGCCAAGCGCTTGGCACAGTGCTGTGCACATAGTAATGATAACGTTGGT
ATTTGGTAAGCGCTCACGAGGGGCCAAGCACTGATAATAGTAAGAATGTTGGTATTGGTT
CAGCGCTTACTAGGGGGCCAAGCACTGTTAATAATAATAATGCTGGTATTAAGCGCTTAC
GAAGGGGCCAAGCACTGATAATAGTAATAATATTGGTATTGGTTCAGCGCTTACTAGGGG
GCCAAGCACTGTTAATAATAATAATGCTGGTATTAAGCGCTTACGAAGGGGCCAAGCACT
GATAATAGTAATAATATTGGTATTGGTTCAGCGCTTACCAGGGCCCAAGCACTGTTAATA
ATATAATGCTGGTATTTTTAAGCTCTTACGAAGGGGCCAAGCACTGATAATAGTAATAAT
GTTGGTATTGGTTCAGCGCTTACTAGGGGCCAAGCACTGTTAATAATGTTGGTATTTGTT
AAGCACTTACGAAGGGCCAAGCACTAATAATAATAATAATGTTGGTATTGGTTCAGCGCT
TACTAGGAGCCACGCACTGCTAATAATGTTGGTATTAAGTGCTTACGAAGGGCCAAACAC
TGATGATGATAATGTTGGTATATGGTTCAGCGCTTACCAGGGCCCATGCACTGTTAATAA
TGCTGATATATGTTAAGCGCTTACTTACGAGGTGCCAAGCAGTGTTAATAATAATAATGT
TGGTATTTGTTCAGCGCTTACTAGGGGCCAGGCATTCATTCATTCAATAAAATAAAATGT
TGGTATTTGTTAAGCGCTTACTATGTGCCGAGCACTGTTCTAAGCGCTGAGGTAGATACA
GGGTCATCAGGTAGTCCCACGTGAGGCTCACAGTTAATCCCCCTTTTCAGATGAGGGAAC
TGAGGCACCGAGAAGTGAAGTGACTTGCCCAAAGTCACAAAGCTGACAGGTGACAAAGCT
GGTATTCAAACCCGTGACCTCTGACTCCCAAACATTGGGTGATTCCGCTAAATCAAGCTG
ATTCAGAAAGCCCCTTATAGTGCAACCACTTGACTCTCCATTCTGCGCTTCCAATTGCGT
GCTCTCAGATCGCGGGAAAGCCACTTATCTTCTCTGGGACTCGATAGTCGTGTTCTCCCA
CCTACTTATACTTTGAGCCACATGAGGTACCGGGACTAGGTCCAACCTAATATACTTCTA
TCTACCCCCACACTTATAATGGAGATTGATAACTGCTGAGAGTCTTAAAATAAAAACTAA
CCTGGGCTCTAGGCCTGTAAGGCTTGTAGTGGGCACAGAATGTATCTGCTAATTATGATG
CTTCGCACACTCCCAAGCACTTAAAACTAGATATGCAAGATGAACAAATGAAGGGCTAAA
AGGTAGTTTAATCCCATTTAAAATCCCAAAATGGTTTTCTCGTAAGTAAATTCACTGGTG
AGTTTTCAAGGNNNNNNNNNNGGGGCCAAGCACTGATAATAGTAAGAAATGTTGGTAGTG
GTTCAGCGCTTACTAGGGGGCCAAGCACTGTTAATAATAATAATGCTGGTATTAAGCGCT
TACGAAGGGGCCAAGCACTGATAATAGTAATAATATTGGTATTGGTTCAGCGCTTACTAG
GGGGCCAAGCACTGTTAATAATAATAATGCTGGTATTAAGCGCTTAAGAAGGGGCCAAGC
ACTGATAATAGTAATAATATTGGTATTGGTTCAGCGCTTACCAGGGCCCAAGCACTGTTA
ATAATAATAATGCTGCTATTTAAGCCCTTACAAAGGGGCCAAGCACAGATAATAATAATA
ATGTTGGTATTGGTTCAGCGCTTACTAGGGGCCAAACACTGTTAATAACGTTGGTATTGG
TTAAGCGCTTACAAAGGGCCAAGCACTGATAATAATAATAATGTTGGTATTGGTTCAGCG
CTTACTAGGAGCCAAGCACTGCTAATAACGTTGGTATTTGTTAAGCGCTTACGAAGGGCC
AAGCACTGATAATAATAATAACGTTGGTATTGGTTCAGCGCTTACCAGGGCCCAAGCACT
GTTAATAATAATAATGCTGGTATTTTTAAGCTCTTACGAAGGGGCCAGGCACTGATAATA
GTAATAATGTTGATATTGGTTCAGCGCTTACTAGGGGCCAAGCACTGTTAATAATGTTGG
TATTTGTTAAGCACTTACGAAGGGCCAAGCACTAATAATAATAATAATGTTGGTATTGGT
TCAGCGCTTACTAGGAGCCACGCACTGCTAATAATGTTGGTATTAAGCGCTTACGAAGGG
CCAAACACTGATGATAATAATAATGTTGGTATATGGTTCAGCGCTTACTAGGGCCCATGC
ACTGTTAATAATGCTGATGTATGTTAAGCGCTACTTACGAGGTGCCAAGCAGTGTTAATA
ATAATAATGTTGGTATTTGTTCAGCGCTTACTAGGGGCCAGGCATTCATTCATTCAATAG
AATAAAATGTTGGTATTTGTTAAGCGCTTACTATGTGCCGAGCACTGTTCTAAGCGCTGA
GGTAGATACAGGGTCATCAGGTAGTCCCACGTGAGGCTCACAGTTAATCCCCCTTTTCAG
ATGAGGGAACTGAGGCACCGAGAAGTGAAGTGACTTGCCCAAAGTCACAAAGCTGACAGG
TGACAGAGCTGGTATTCGAACCCGTGACCTCTGACTCCCAAGCCCGGGCTCTTTCCACTG
AGCCACGCTGCTTCTGTGAGCCCCATATGGGGCAACCTCATTACTCTCCATTCATTGTCA
TATTTATTGAGCGCTTACTTTGTGCAGAGCACTGGACTGAGTGCTTGGAATGGACAATTC
GGCAACAGATAGAGACAATCCCTGCCCAGCGATGGGCTCACAGTCTAAACGGGGGCCCTG
TATCTACCCCGGTGCTAAAAACAGTGCTCGGCACATAGTAAGCGCTTAACAAATACCAAC
ATTATTATGTGCCAAGCACCGTCTCTGTGCCTCAGTGCCCTCATCTGGAAAATGGGCATG
AAGACTGAGCCCCATGTGGGACAACCTAATTACCCTGTATCTACCCCAGCGCTTACAACA
GTGCTCGGCACATAGTAAGCACTTAACAAATACCAACATTATTATTACGTGCCAACTACT
GTCTCTCTGCCTCAGTGACCTCATCTGGAAAATGGGGATTAAGACTGTGAGCCCCATGAG
GGACAACCTGATGACCTTGTATTCATTCATTCACATTTACTGAGCGCTTACTGTGTGCAG
GGCACTGGACTAAGCGCTTGGAATGGACAATTCGGCAACAGATAGAGACAATCCCTGCCC
AACTACGGGCTTACAGTCTAAACGGGGGCCCTGTGTCTACCCCGGCGCTTAGAACAGTTC
TCGGTACATAGTAAGCGCTTAACAAATACCAACGTGTGCCAAGCACTGTCTCTGTGCCTC
AGTGACCTCATCTGTAAAATGGGCATTAAGACTGTAAGCCCCACGTGGGACAACCCGATC
ACCTTGTATCCTCCCCAGCGCTTAGAACAGGGCTTGGCACGTAGTAAGCGCATAACAAAT
GCCATCATTATTATTATACAAGGTAATCAGGGTGTCCCACGTGGGGCTTACAGTCTTAAT
GCCCATTTTACAGATGAGGTCACTGAGGCACAGAGACAGTGATTGGCACACGTTGGTATT
TGTTAAGCGCTTACTATGTACCGAGAACTGGTCTGAGCGCCGGGGAGGACACAGCACCCC
CGTTTAGACTGTAAGCCCCGTAGTTGGGCAGGGATTGTCTCTATCTGTTGCCGAATTGTT
CCATTTCCAAGCGCTTAGTCCAGTGCCCTGCACACAGTAATGTGCTCAGTAAATGTGAAT
GAATGAATACAAGGTTCATCAGGTTTGTTCCCTTCATGGGGNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAAGTCACTTCGCCTCTCT
GGGCCTCAGTGACCTCATCTGGAAAATGGGAATTAAGACTGTGAGCCCCACGTGGGGCAA
CTTCCTGACCTTGTGACTTCAGGTAAGTCACTTCGCTTCTCTGTACTTCAGCTACCTCAT
TTGTAAAATGAGGATTAAGACTGTGAGCCCCACGTGGGACAACCTGATTACCCTGTATCT
ACCCCAGTGCTTAGAACAGTGCTTGGCACATAGTAAGCACTTAACAAATAGCAACATTAT
TATTATTACAAACTAATCAAGTATGTCTGTCTCCCCCCTTCTAGACTGTGAGCCAGTTGT
GGGCGGGGATTGTCTCTATTTGTTGCAGAGTTGTACTTTCCAAGCACTTAATACAGTGTT
CTGCACTCAGTAAGCGCTCAATAAATATGATTAAATGAAGTTGGACGCAGGCCATATTCT
GCGTGGGCCGCCGAGTCTCTTAGAACAGCGTTTGGCACATAGTAAGAGCTTAACTAATAC
CGTCGTCATTATTATTCTCGTTAATCCCCATTTTGCATATAATTGTAGTATTTTGTTAAG
CTCTAACTAATAATAATAATTGTGGTATTTAAGAGCTCACAGTGTCAAGGCTACAGGCTA
ATCAAGTTGGATGCAGTCTTGCTCGTAGGGCTGTCGATCCCCATTTTACATATAATGGTC
ATATTTTGTTATTAATAGTAATAATTGTGATATTTGGTAAGCGCTTACTGTGTGCCGGGC
CCTGTACTAAGCGCTGGGGGTGGATGCAAGCAAATCAGGTGAACCTACGTGAGGTTCACA
GTTTCAGTCCCCGTTTTACAGAGGTCACTGAGGCCCAGAGAAGGGAAGTGACTTGCCCAA
AGTCACCCAGCAGACAAATGGAGATGCAGGGATTAGAACCCATGACCCTCTGACTCCCGG
GCCCGGGCTCTATCCACTATTCCATGCTGCGGCTATGTGCCAGGCGCTTTACTGAGCTCA
TTGTAGGCAGAGAATGTGTCTGTTATATTGTTATAATGTACTCTGCCAAGCGCTTAGTGC
GTAAATATAATTGACTGACTGACAACTCCTTTGGATAATCAGTTAGGCATCGTTTTTATG
GTATTTGTTAGGTGCTTACTATGTGTCGTGGGTAAATGCAAGGTAATAATGTACCAAATA
CCAACATTATTAATAATGTTTGTGGGTTTTGATAAGCATTTACTATGTGCCAGGCATTGT
AGTGAGCACTGAGGCAGATACTGAGCAAATCAAGTTGGGCACAGTCTCTGTCCCACATGG
GACTCACGATTTTATATATTGCTATATGTATTGTACATTATTGCATATTAATGTTCATAT
TTGTTAAGCGCCTACTATGTGCACAGCACTGTTCTTAAGCACCTGGGGAGATACAGGGTA
ATCAGGTTGTCCCACGTGAGGCTCACAGTCTTCATCCCCATTTTCCAGACGAGGTCACTG
AGGCAAAGAGAAGTGAAGTGACTGGACCCCAGTCACACAGCTGACAAGTGGCAGAGCCGG
GATTCGAATCCATAATGTAGCCATGCTACATTATTGCATATCACATTGTACAATAATGTA
GTGTCATGTACATGTACGTATTATTGCTCTGTTGTACTTTCCAAGCGCTCAGTGCAGCGC
TCTGCACACAGTAAGCGCTCGCTATAAATCAGTGAACGTATGAGGTAGTTGAGGCACAGA
GCAGCGAAGCGACTTGCGCAAGGTCCCACAGCAGATGAGTGGCGGAGCCGGAATTAGAAC
CCAGCTCCTTTGGACTCCCAGGTCCGTGCTCCTTCTCTGTTCCCTTTTGTTCAGGTTTTA
CCGATGGGGCTCCCTCACGGCAGTGATAATGATGATGTGGGGTGCGTTAAGCACTTACTA
GGTGCCAAGCACTGTATTAACTGCTGGGGTAGACACAAGGCAGTCCCTGTCCCGCTAGAA
AAGGCAACAGCAAAATTTCCTTTTTGCGCTGATGGCGTAATTAGAGCTCTTTCGTTCCAA
AGAGTTGGGGAAAGACCCTTTACCTCCTTATCCTCTCGACACCCGATTTGATCGACCGTA
AGCTCGTTTTGGGCGGGGAGTGTGTCTCTTACATTGTTACTGTTTCTTTCTCTCCCAAGC
GCTTAATACAGTGCTCCGCACAGAGCACGTGCTCAGTAAATACGATTGATCCACCACACC
CGCCGCCGAGGGAATGTGGGAGGCAAAAGGCAGGCCCCCTTGTAATTGGACCCCCACAAG
TCACACTGAAAATTGAAAATAAAGCTGGGGAATAAGGGTGGTCTTTCTTACATGAGCACA
AATGTGAGAGATAACACAAATTCAGCAGTCGACAATGGTGTTTTCCTGGCCCTCATTCTC
TTCCCCCCCCATTTATCTTACCGTGGCTGCTTTTTGCCGCTCAGAACGTACATCTGCGCA
TTTCCAAATGTTGAGTTACCGCTGTCCTTAAACCTAGCCATCTTGCATTCATTTGTGTTA
TGTGCTTGGTTTCACCCTCATTCCAGGAGTCCTGTCTAGAGAAAGTAAGTTATGTGCTTG
GTTTCACCCTCATTCCAGGAGTCCTGTCTAGAGAAAGTCATTCAGAAGCTTTCAAGGCCT
TGTGAAAGGAGTTTACTTAATTCCTTAAAAGGAATGAACTGTTTACTTTTAATTTTTTCA
ATGGTGGCACTAATGTTTAGCCAGTCACAATTTTGGCAGAGACACTGCAGTAATTGAAAA
ATGGACTTAAACTGGAAAGATCGTTGGATCATAGTTAAGGCCCAAAAGTGCCTCAGGACT
TCACTCACCAGCACCAAAACCTTAGGTGCCAGCGGCTCCTCTCGCACTGATTCTCATTAT
TATTATTATCATTAATAATAGTATTTGTTAAGCGCTTACTTTGTGCCAGACGCTGCACTA
AGCACTGGGATAGATATAAGGTAATTGGGTTGGACACAGTGAGCTCACAGTCTTTGTCCC
CATTTTACAAATGAGGTAACTGAGATGCAGAGAATTGAAGTGACTTGTCCATGGTCACAC
AGCATACGAGTCCTGGAGCCAGGATTAGAACCCAGATCCTTCTTACTCCCGGACCTGTGC
TCTGACCACTAGACCACACTGTTTTTTCCACTTTTTGAAGAGATCTCCGAAGCCATCCCT
TGTGGCTTGCAGCTTCCAGGGTTAGCAGCTAGTGAAGGAGCTAGAGCCTTACCCATTTAA
GATTTTGCAAAATAGTAATAATCATAATAATTGTGGTATTTGTTAAGCCTTGTTACGGGC
AGGAAGTATGTCTGCTAATGTTGTTATTGTGCAACAATACACAGTCTCGAGGATGGAGAC
TGTGAGCCCCATGTGGTACAGTGACTATATCCATCCCTATTTGCTTGTATCCACCCCAGG
GTTTAGTACAGTGCAGGCACAATACAGTGAAGCAGTTTAGTACAGTGACTTGGGCCTGCC
AGGCAGGCACTAAATATCATGCTAACTTCTTAACCTCTTCGCTTTGTCACATTCTGAGTC
AGAGTCCTCTAGAAAGTAGTTTGCCCTGCATATTGTCTTCAGATCATAGGTTTTATGGAA
AATGGAAACTCAAGGATGGTAACAAACCGAGTATCCGCTCAATGCTTGTTGGCCCGTCGA
CTGAAACTTAATTGTTCCTTGCCTTTTTAATTTTGTTCCTTGTTCTCTTAGACAACAAGC
TGTTGGAGAAGTCAGATCTTCAGTCAGTGTTGGCCGGCAAGCTACAAGCTGAAAAGTATG
ACATGCAAAGCAAGCATGAGATCAGGTATTTGAAGCTCTTGGTTGCTTATTTTCCCTCAG
AAATCTGCTTTATTTTATCCCAGTTAAGAGGTTCTGCCCTTAATTCAGTTAAGGGGTGAC
CTAACGTACTATTGTAAATGTCATCATCAACAAATGTTTATTTCAAGTGTTTAACATTAC
TCTTTTTGGAATGTTAAGGTAATCCCATAATGCCTATAGTACTTAGAATAGTCTGATCTG
CCCCGATGGTGTGTTTTACATTTTGTTCACCTACTTGTAAATCTCCAGGCTTTCTTATAT
TTCTGAGCAGACATCCTTCCGTTACTGTCTCAGTCACAATTTGTGTCCATTTAGCTCACT
TACCTTACCAGCCTACTTGTTTTAATGCCAGTTTTATGCAGCATGGCAATGAAACTTCCA
TATAACTATAGATAATTTAATCAATTAATGGTATTGGGAAATTACCCTATGGTGTATTGT
ATTAAGCATTTGGGAGCATGTAATAGAGTATATAGACACCCTCCCTGCCCTCAAGGAGCT
TATGGTCTACATGGAGGGGCAGACATTAAAATAAATTACAGGCGGGAAGAATCGATGGAG
TTTAAAAATATGTACCTGAGTGTTAGGGGGCAGGGGAAGTGGTGAGTACCCAAGGGTTTA
GGTGACATGGAAGTACTGGAGTGTCGATGCAAGAAGTAGAGTGGGAGTTGAGGTTAATCA
GAGAAGATTTTGGATTTTATTTATTTGCAGGCTTTGAAGATTGTGGCAGGGAAGCGGCGA
TCTGTCAGATAGGAAGGTGGAGGGAGGATGTGAGCAAGAAGCCTATGATGAGAGAGAGAA
GATCAAGGCAGGTTTTTGAAGCAGTGCTTGCTGTGTAGGAAATGACTGGACCAATTCTCT
GCCCCTAATCTGACCCGGTCCTCCCCACCCCATACCCTACATTTAAAGGAGGTTCAGCCT
CTCTGTTGGTACGTGGTAATGGAGTGGCCAAAGGAAAGCACTTAGGTACATGTCCCTTAA
CTTTACAGGAAGATAAAACCAAAGTAAAAAGTCACATAATATGCAGTTCCATCGGTCTCC
TCTCCCCTTCAGTGTGTGCCCCCTGGAGTTAAACATTTAACAGGGTGCAAACTGGGCAGA
ACCCCCCTGGGTGCTGGTCCTTTGTGAACCTGTGGGCCTGCCAGGGCCAATGCAGAGCCC
TAGACTGCATAGTGCCTTTGAAGTGATACAGACAATAATAATAGGCAATATATTTAACTA
TAATAATGTTGGTATATTTTTAAGGGCTTACTATCTGCAGCGCACTGTTCTAAGTGCTGG
CGTAGATACAGGGTCATCAGATTGTCCCACATGAGGCTCACAGTCTTAATTCCCATTTTA
CAGATGAGGTAACTGAGGCACAGAGAAGTTAAGTGACTTGCCCACAGTCACACAGCTGAC
AAGTGGCAGAGGTGGGATTCGAACCCATGACCTCTGACTCCCCAGCCCGGGCTCTTTCCA
CTAAGCCACGCTGCTTCTCTGCTATCTGATGACTCGTCTTCCTTTGCTTTGGCGGTATGA
GGCAGAAGTGTGCACACAACAAGCGCTCAGATACGGTGGAGCGGTTCAGGCGTACGTCAG
AGAATGCCTGACTCGATGAAATATTGTAATTCAATACCTCAAATGTTATTTGTAATTCCC
TATTTTTAGACTAGAGTAATCGTTCCTTGAGCTGAGAGAGTGCAATATAAGTACATTTTG
TTCAGTAGCTTTGATTAAGCGTCTACTATCCTGAACACTATCCTGGGGTCTTGGAAGAAT
ATAAGTTCAGGAAGGCATAGTCTCTGCCCTCGGACATATGGAAATCTAGTTTTCAGAGTG
AGAGAGGTTTGACCGACACAGGAAGGCCTACAGTGCACTTAATGCGTAGGTGTCCTCTCT
CAATTTTTCCATAAAATAAAAGTTTAAACTTGAAAGAAAACCATGTTAATAGAGAGCAAA
GGGTATATATTGACAGGGTAGTAATGGGATATTTTGGGTGATCACATATGGCAGAGACCT
GAATCTTTATTTTATGTAGGCGCTTTCACAGAAGGAATACTCAGCAAAAATTCTGGAAAA
CGTTCCTTACCCTGGAATTTTGAGAAGAGATTAAGGTACCCCTTCCAGAATCTTTGCTGA
GTATTCCTTCCGTGAAAGTGCATATGTAAAATAAAGATTCGGGTCTCATTACCGTACTTA
CTCTGGGATTTTGAGGAAAAGAGATGAAGGAGTTTGTGGGCAGGTGACAAGGAAACATGA
AGAATACCTGTAAAATTACTTTCTCATTACCTGTGGCCTTACAAAGGGTAGTAAAATTAA
TAGTAAAAAACATATGTTCTTGTAACTCATCGGTTCTCTTATAACGCTGGGCTCGTGTTA
CCGTAGAGCCTCATCTTAAGAAAAACCTGCATCGTAGCACTCTTTTTGATTAACGCCACC
TCCACATGCAAAACTGTTCCTTCAGACATGACCTTATATATGGATGACTCGTGTTGTGGG
AGAAACGCTGTATCCGAAATGTGTAATGAAAGCAAATGTTATTGGAGAACAGTCTGTTAG
AGACTTTCAAGTCTTAAGAAAAATGAGAGGGGGTCACTTAAGCATTGGTATTTGCCTATT
GTAGGCAGAGCACCGTACTAAGCTTGGGAAGAGTACCATACAGTAGAGTTGGTAGACACA
TTCCCTGTCCACACAAGCGTAAAATAACTGTTACTTAAGCGCTTACTATGTGCCAAAGAC
TTTTCTAAGTAAAGCACTGGGATGGGTACATCTGATTATTTTTATTGTTTTATTATTGTG
GAGTTCAACTGTGTGTTCGATTATATAAGTAAAAGTACAGTTATCTCCTGTACTACTGAT
TAGAATTCATTTCATTTCAAATTTCGGGTTTCAGTTTACAACTACAGCCATTAAATCAGA
CCTGATTGTTTTTGTCTTGCCATCTCAGGATTCTTTATATATTTATCTGTTATTCACTTG
TGTTCAACATTTAAATCTATTCTCTTGCTTTTTGTGTATTGTCAGTTTAGTCTACCTGTC
TTTCCCCCACCATTAGATTGTAAAATCCTTGGATTACTATGTTAATCCAAGCATTTTTTC
TGTCCCGCCTTGATTGCCGTATCACTCTCGTTGCTGACCTCCTTGACTCCTGTCTCTCCC
TACTCCAGGACATATTTCACTCTGCTGCCCGGTTCAGTTTTTCTACAGAAATGTTCAGTC
CATGTTTCCCCACCTCTTAAAAACCTCCAGTGATTGCCCGTCCACCTCCGCATCAAATAG
AAATTCTTTACCAGCGGCTTTAAAGCACTCAGTCACCTTGCCCACTCCTACTTTCACCTA
GCTACTGTCCTCCTTCAATCCAGCCCACACACTTCACTTTTGTAATGCCAACTTACAGTA
CCTCGATCTCGTCCATCTTGCCGCCCACCTCTCTCCCACGTATTGCCTGTGGCCTGGAAT
GCCCTCCCTCTTCATATCTGATAGACAGTTACTCTCCCCCCAACCTTCAAAGCCTTATTG
AAGGCCCATCTCCTCCAAGAAACCTTCTCTGACTAAGCCCTCTTTTTCTTTTCTTCCACT
CCCCTCTGTGTCACCCTGACTTGCTCCTTTTATTCATTTCCCCCTCCCAGCCTCATAGCA
CTTGTGTGTGTATCTGTAATTTTATATATTTATATTAGTGCCTGTCTCCCCCTCTAGACT
AAGTTCACTGTGGGCAGGGAATGTGTGTTATATTGTACTTTCCCAAGTGCGTAATATGGT
GCTCTGCACACTAAATACGATTGACTGACTTGAGTGCCAGGAACATATTTTATATTTCCT
TATGCTCCCCAAATGCCCTTTGCGATGTTCTCTGCACAGTAGCCTTTTGATAAACAATAA
TTTAAAGACCAGAAATCTATTAATTTCATATGGGGGCTTCCTTTGAAGGCTTGAATTGCT
TAAACTATCGTTATCACTCTATAGCTAGGCTTTCAGTGAAAGAGTCAAGTGGCCTGATTT
TCTCTTCACCTCGCTACATCTCGTTCCATGCGTGAGGCATTACTGAGCGGAATAGCAGTT
TGCATCTACGAATGTTTACAATTAGTAATTTAACTGTACCTCGGTGACTACACAGAAGTG
TAGGAACTTGAAAAATCCTTATATAAATGAAGAGCTGTTTGAGACTTGAGGCAAATTTGT
TTTCTTTTTCTTCCCGTCTCCTCTTTATTTACCTTTTTTGTTTGCCTTTTAATTCCAGCC
AGGGGCATGATGGAATGTGGAACAATAGCCAACTGCAAGAAATGGCCCAGATGAGGATAA
AACATCAAGAAGAACTAACTGAACTGCATAAGAAACGTGGGGAGGTTAGCACATCCCCCT
CTTTTGCTCTAGTATGAGAATCCAGTTTTTAGAGCCCAACTGGGCTCCGGTAAAGTACTC
GACAACTCTCCGAAACTTGTTTTTGTAGCGGGGTGCGTTTAAATCTTTGGCATAAACAAT
ATTTTCTTTCTCTTAGTTGGCCCAGTCGGTAATTGACCTGAACAACCAAATGCAACAGAA
GGACAAAGAGATGCAAGAAAACGAAGCCAAGTGAGTAAAATTAATGCCCCCTGCCAGGGA
TTGGATGGGTAGATGAGCATTCCGGTTGTCATTCTCGTTCACACTTCGCCCTTGCAGAAT
TGCAGAATATCTGCGGAAGATCGCCGAATTAGAGACAGAATGCCAGGAGCTTCGCAACAA
GCTGCAGGACCATGAAAGGGCAAACCAGACCCTGAAGGACGAGTACGACGCCCTGCAGAT
CACCTTCACGGCTTTGGAAGAGAAGCTGAGGAAAACTACTGAAGACAACCAAGAGCTGGT
CACCCGCTGGATGGCAGAGAAGGCCCAGGAAGCCAATCGCCTAAATGCAGAAAACGAAAA
GGACTCAAGGTGACTGCTCACCACCCGGGCCTCTTACTTTAACTCGTTCTTAAAAACGGT
TTCAGCTGAACCCGATTCTTTGGCGTACTTTAAGGAGGATGGGGAATTGAGCGTCCTCCT
TTAACTCGCTCGCCGTATCTCCTTACTGACGGAATCCGACCAATTTCTAAGCCAGCTGCC
TTTCGGGAGGCAGCCCGGCCCTCTAGACTGGAAGCGCGTCGTGGGCAGGGAACGGCTCCG
CCAAGTCTCTTACGTTGTTGTGGCGTATACTCGCCCGAGCGCTCAGTACAGTGTTCCGCA
CACAGCAAGGGCTCGATGAATACCATTGATCGATTGTGTGGCCTTGTGGAAAGAGCACAA
GGCTGAGAGTCAAGAGAACTGAGTTCTAACGTCAGCTCTGCCACTTGCCTTTTTGTGACC
TTGGACAGGTCAGTTAACTTCCGTGTACTTCAGTTTCCTCCTCTGTAAAATGAAGATAAA
ATGCCTGGTCTCCTTCCCTCTCGGACTGTGACCCCTCTGTGCGAGATAGGGACTGCGTCT
ATACTTCCTTATCATCTACCTCGATGTGGGGCGTGTAATAAATACATTTTAATAAATTTA
GCACCATCATTTTCATTCTACAGGGCTCCGTCTGGTGGCAAAGTGCCCTGGTACTTTTGC
TTCTGGTGATTCCCCCCGAACCATTTGTTGTTAGCTTCTTAAGAGACATCTTTGTGAAAA
ATTAAAATGAGCGATTACGGTATAATAATGATGGTATTTGGTAAGCGCTTCTTATGTGCC
GAGCACTGTTCTGAGCCGTATCTAGGTAGGGTGTCCTTATCCCCGGGACTTAGAAGTCAG
CTCAGATATGAAGGAAACGAGGAAGCGGGCTGAAAGAGACTCGATCAGTCTGTTATCTTG
TGTTTTAAGTAGTAGTAATGCTATTTACTGGACTGCACGAAGGTCTTGGGGAAAGTAACC
CCGAAGCACAGATGAACCGAGGACTAAAAATCGTTTCTGTTGGTTATCACAGGAGACGGC
AAGCCAAACTTCAGAAAGAGCTAGCAGAAGCTGCAAAGGAACCGCTTCCTGTCGAACAGT
AAGTAGTCTCTGACACTTGACCAGAACGGACCTACGGAAAGCGTTCCGCTTAACACACCA
ATTAGGATGTGGATCAGAAGATCACATTCTCCCCTTGGTTGAATAAGCTTGTGATGTGGG
AAGGAGCCCAGAGCTGGCCAGTTGAAATATTAGTTTACGTCTAGGAATCCACAGGTGAGT
GGATTAGCTTATTTCGGTCGTGTCCTCGTAGAGACTTTGGACGGTGGCTTTTGGTCCTTA
GCCTACGTGTGGAAGAAAACAGATGTCGTAGGCCATCTACTTTTATAACATCCCACATGC
CTAGGGTGTATTCTTGAGCCTCTCTTGACTCCAGGCTCCAGCTGCCTTTTGAGCGAGGTG
TTTGACAGGGGTTCTGAAAAACCGGTGACTCCACCTGCCTTTTCAGTCCTGTCGGTGCCT
CCAGACTTCGGTAGCGCTCCACCCTCTAGATTTGCCTTATTGTGGATTTGTTTCTTCCCC
CAAAGCTCCCCTCGTTCTGCAGAGACGCTCTGGCTACCACTCCTCACACTTTCCTTGCCG
ACTTGTCCTGGCTCTGTTTTTGCTTCCTCGTGTCCTTGTAATCTGTTAACTGACTTAAGG
GGCAAAGGACTTTATGTGGTGGTGTTTGTTTTTTTTTTCCAGCATGCTTTGTGGAAAGCA
ATTGGCCCCTTTAAATCACTGTTATGGGACACGAGACAAAACTCTGTAGCGACCTTTGCA
AAGTATTTGTATTTCTCAAGTTTCTTTGATGCTCTAGAATCAATAAAACGGTCCAGGAAA
TCATTATTTCTTTCTGTGGGAAGGGGAGTACGTTTAGTTGAGCCGGAACAAAGGGTGGTG
TTTTTAGGCAACCCTGGATTTCGTAACTTGGGCTGCCAATCATTGGATGATATTTCAAAA
GAGGATTCGATTTAAAACTTTTTTTTAATGTTTCCCCTACTTCGTTCAGTTGACGTAACC
CGTGAACAAGAGGCAAAATGGGGTTCAACTGCTGGGTTTGCCGCGGGTTCACTAGGTTAC
CTGACACAAGCTGCTTCTCTCTTCCCGACTTTAAATACAACTCAGTTCATTCTAACTACT
ACGTACCTTAGAAGACTATTGTGGAAAGTACTGGGCAAAGTTTAAAAGCTTTGAACTGTT
GGAGGAAAAGCATTGCAAAATTCAGAATACTTTAAATGGCGGTCATTGGTATTTATTGAG
TGCTACTGTGTGCAGAACACTGTACTAAACATTTGGATGAGTACAACACGACAGAATTGG
TAGATGTGATCCCCGCTCATAAAGAGTTTACAGTCTAGAGGGGGAGACACATTAAAATGA
TTAGGCTTAGGGGAAATACTAGAATATAAGGATGTGTACATAAGTGCCGTGGGGCTGGGA
TGAATACGAGAGTGCTGAAGGATTACGCAGCCAACTTCTTATTCGGTGCAGAATAGAGGC
CAGATAAGGGAAATAGTTTAGTTTGGAAGGGCCTGTTGGAGGGGAGGTGGAGGGTTTGGA
AGGTGAGGAGAGTGGTGGACTGTCAAATGTGAAGCAGGAGGGAGTTCCAGGCCTGAGGGA
GAAAGTGGGCATCGCTTTGGTGGCGGGATAGGCGAGATCGAGATTCAGGCGGGAAGTTGG
TTTTAGAGGAGCGGAGTGTTCGGGTTGGGTTGTAGAAGGGTTCAGCGAGGTTAATGAGGC
GGGAGAGAGCCCATTGAGTGGCTTAAAGCCAGTGGAAGGAGTTTCTATATGATGCGGAGG
TGGCTGGGCAATCACTGGAGGTTTTTGCGGATTGAATGTTTTTGTCTCAGAAGTGATCCC
GGCAGCAGAATGAAATATGAATCGGAGACGGGAGAGAGAGTTTGCACAGGAGGTTAGAAG
GAGCCTGATGGAGTAGTCGAGAGGGAAGTGATGGATGCTTGGATTGACGTGGTAATCGTT
TGCATGGAGAGGAAAGGGATATTCTAGAGATGTCAGGAGGTAGGCCCGATAGGATTTTGT
GGCAGATTGAATGTGTGGATTGAGTGAGAGAGATGAATCAAGTTTAGTAGTGATAATTAG
TGGTATTTGTTAAAGCGCTTACTGTGTGCCAAGCACTTTTCTAAGCACCGAAGTAATCAT
AAGATAATATAACGGTGAGGTTACGAGCCTGTGAGACAGAACAGTGGTGCCGTCTATGGT
GATAGGAAGAGGGGCTTGGGGGGGAAGATGAGCTATTCTGTTTTGGACATGTTAAGTTTG
AGCAGTAGGATTCATTAATCTTACCTAGTAATTTAAAAGTTCACTTAACGTGATGAAAAT
TCTGAGGTGGCTAAGTTCTCTCATCCATATTACCTCTGTTACTGCTACGATTGTATTGAG
AGCACTTTAAATTTCTTAGCTAATTACCAGAACATCCCTGAGGAACCGTATTGTCTTGCC
TCTGTTGTATAGTGTTCTTGGGAGAGTAAATTGCTTCACACTTCGGGTTCAGTAGAAGCC
ACTGGTTGGTTGGTTTCTCACCCAAAAACTTAGAAGAAGCTAAGCAAGCCAGTAATGGAG
CTGGGAAGGGAACTAGATCCCATCCTCTCACACCTGGGATTGGGTGCAGCCAGTGTTCAG
TGCATCTATTTGGGCTAACCCATTTATCCTTTCATCCAGATCTCTCTTTAAAGCGGGTCG
TGCTGAGCCAGTGCGGATTGAAGTTTAAGCTAGAACACCACCGGGGACCTGCCTCTGAGA
GGTTCCTTTCATGGATAAAAGAGATATAAGACTGTGGATTGAAAGAAAGAAGGTTCGGCC
CATTCGGGAACGGATATGTCGAAATGGTGGGTGCAGATAGTCATTCAAATGGAGAGGATG
TCTGAGAGCCGATAACAGTGCCTTTTATCAGTTGTTCGGATCGATCGATAACAGTAGTTA
GACCCCACGACTTTGCCAGCTGGTAGAAATTTTCCGTTTCCTTTCCTCATCTTAACCAAG
GTAATCAGATGGTGATCTCCGGAGAGAGGAGGAAGAGTGGCTTGGGGAACTTGGAAGCAT
TGGCATTATTATAGTTTCTCTGGCACTTCCGGGGCATCCCCTTGATGCTGTAGGGTTAGA
GCAAACCTCAAGAATCCTTGCTTTTATCCTAAATTGCTCAGGGAGCATTGTGAGGATTCT
TGAGCTGGTCTTTTTCCTCTTTCCTCTCTGTCTATAGCTCAGGGGTGAAAGGTACTGCAG
AATTTGAGGCAGGGTCCCCACTCTCCACTTTTCCGAGGGTTCTCTTAGCTAGGTCCCGTC
CCTCCATCTGCTTACCAGTTCCTCTAATAAAATGACCCTGCTTCTGACCGTTCTCTTTGT
CTTCCAAAAAAATTAGCAATACTAATGACTTCTTGGAATCAAAGTAGGAATATGAGATTG
AAGAGGAAATATCCCCCTGCTGTTCCATGACAAAGCAATATTGTTTCACATCATTGATTA
ATAAGAAACTTGGGTTGATGGCACATTTTTTTGCTCCCTATTAGCATCTTTCAATAATAA
GATCTTTTCATGAAGGAAGCCATTTCCAGAGGAAGATAAAAGTGGCCAGATCTAATCCAG
ATTTCTTTTAATTTACTGCATTATGCCTTATGCCTGTAGAGCATGTTCATGTTTAGTACT
GAAGAGATCTAATTATAAAGTGACTTTGCAGCCTCTTGCCGTTCCCTCCCCCATCCCACG
CCCCTCAGGTTAAAAGTGATGTCCAAGTAGAAGAGCAAAGATCACTTTAATCTGTGGTGG
GGAGTAAACCTCTGAGAGGAGCGCTCGAACCCTGGATTGTTAACTGGTCGCTCTTTGGAA
GTTGACCACTGCTGCGGTGTGAGGCTGGGGTCGAAATCGCTTCAATTTGGGAGGTAGGTC
TGCCTAAGAACCCGAAGACTCAAACGTGTCACTCCCTGGGACCTAATTGGGTGAAAATCA
CATAGACTTCCAAGTCAACGTTTCTTGCCCTGTCCTCTCCCCATCTTGACAGTTTCTTCT
CCTGCCTTCCATCTCCAACCGAGTGACCTACCTGCACCCTAGACTCACTGTGATCGAAAT
ACATTTCTTTGCTTTTCCTGTAAACCTCTTTCCCATTTTCCTTCCTAGCCCCCAACCTCA
CAACCTTGATGTCCTCTTTGGTCCTCTCTTCTTTACCTTTGACATTTAGGCAGTCTGGAC
ACCCTACCAGGTTTTCCTCTGTAACATTTCATGGACTTATCTCTTTCTATCCACCTGTGG
TTCAAGCCCTAGTCATCTCCGCCCAGCTGGACAATATTAACTGCCTCCTTCGTGATCTCC
CTGCCTCGGCAGATCTCTCCCCTAAGGCTAACAGGCCGCCTGAAACACCACTCCTATGAT
TACCCAATTTTTTCTTGCATTAAACAGTCCTAACCATCAGTTAACCTGTCCCAACTTGAG
ATGAAGGTCAAGTATGATGGTTTCTAGTTATGGTAAATACCATTGATTGACTATATATTT
GGAAAATTACTTTTGTGGTGGAGCAGGTGGCAGATGGCAGGTTGGAGGTATATATATTCT
GGCATTTTGTTAGGGCCAGAATGTTGTCAGGGGGCCCAGTGTGCTAGTTGGAGAGTAATA
GCAAGATATCCACACTGAGCCTGCATTATCAGTCCAGGGTGGACATTCTGGTCATCTCTG
GAACTGCTCAAGGAGAAGGTTCTGGCATGCTAGCATCAAAACCAGGAAGGACGGATAGTC
TGGTCATCTCTGGATCTGCCCAAGGAGGAAGTTCACCCCTACTAGCATCAAAAAAAAGAA
ACTTCTCCAGGAAACCGTTGCCGTACACTCTCAACAAAGCAGGAGGGATCGGCACTGTTT
ATCTCATCGGAAGAGGAATTTCCTCCAAGCGGTTCCCCCGTACGACCACCAAAAGAAAGG
AGGAACTCGCTCATCCCGGAGGACTCTTTGATGGACTGAAAACTACGGGGAGGAGTCGGG
AAGTCTTCGGGCGTTTGGATTTCTTTGGCTCTTAAAGGTGCACGCCTTTGCTGCAGAGGT
GCGCATCTACCAAATAATGCTGGGAAGGTGCGCTCTGGCATGGGGGAGCCATGGGGTCGC
TTTAAAAAAGATCTGTCGTAAGCCGTGATCCCGGTGTGTGGTCCTTCCGCTAATGGTTGG
CCAGCGGGATAGTACTGTTACCCTACAGGTGGGAGGTAACAGCTAGCAGGGCAGTTTAGT
GGTTGGAGTGGTGTTTTCACTCGGAGTAGTGACCGTTGTGGTGTTGGTGCTCAGAGTAGT
GACCGGTGTGGTGTTGGCCCTCGAGATAGCAACGTGTGTGTGTCGGTTCTCGGGTTAGCG
ACCGGTGTGGTGTCGGTCCTCGGGATAGCGACCGGTGTGGTGTCGGTCCTCGGGATAGCG
ACCGGTGTGGTGTCGGTCCTCGGGGTAGCGACCGGTGTGATGTCGGTCCTCGGGGTAGCG
ACCGGTGTCACTCGGGGTAGTGATAGGGAGGAGGTGGTAACATCTTCAGGGATATGAGTG
CAATCTGGCTGTCTAGGCTGAGCAACCGAGAATAGCGATGCTGATGTCTGCGTAGGAAAC
TGGACATCTGGGTGGGTTTATCAGGTCTTGTAGAAAGCAAAAGGGGGCGCTTTACCAGGT
TCCTGAGGGCAGTTGGACAGGCCTTCACCACTGGCAGGATAATAATGATGAGAATGACTG
TATTTGTTAAGCGCTCACTAAGTGGCAAGCACTATTTGAAGCGCTGGAGCAGATACAAGT
TTATCAGGTTGTCCCACGTGGGGCTCACGGTCTTAATCCCCATTTTCCAGATGAGGTAAC
TGAGGCCCGGAGAAGTGAAGCGACTTGCCCAAAGTCACACAGCTGACAAATGGCAGAGCC
GGGATTAGAACCCACGACCTCTGCCTCCCAAGCCCAGGCTCCTTCCACTAGGCCACACTG
GGATCTGCAACTCCAAAGGGACGGTGAAGTCGAGTAAGAAGGAAGGAGTAGTGATCCAGG
CTCTGTGGATTGAGACTGCAGGAACATATTGCTGCCCTGGAAGAGATAGTGGAACAGCAG
AAAGTCTTGGTCTAATTCTCGGTTTTATCCACCTGAGTCTCGGGCTGGGGTGCAGTGGAC
AGAGAAGGAGATAAAGAGTAAACGGGGTCTTGAGAAACTGGGGAAGAATTGAGAAAGACA
GAAGTCCAAGGAAAGGGGGATCATCTTGTCATTTACAGGTGGAACCTTCAGCTCCCCCTC
CTTACCTGAAATACCCGGATGTTTCAGAGGACCCGGGGTCATCGAAACCCCCGCAGGTTG
CTCCGGTGACCCGAAGAACACGGCACGTATTACCGGGGGCTCGTCCACTTGAGTTGTGGG
GAGGGTGTAGGGTTCCCCGTGTGGCGTCTGGCCCCGTAGAGGATTCGGATGAAAAGGCCC
GAGCGTCGGATCGCTCCCCGAGGCAAGAGGTGACGGAGGAGATCGTCCTGACTTCCTTCT
CGTCCAGGGACAGAGGAATGCTTGTAAAAGAATTAAGGATGGCCTGGTCAGAATGGGACC
CTTTCTGAGTTTACTAAGTTGCTAAGAGTGGAGAAGGCTCCATCGGAGCTGTATGAGAGG
AAGGAGGTGGCTCTGTTGGGTCCTTTAGGGACCAGAATTGTCTTGAGGAAGGTTTGCTCT
GTTTTGTCGTGGTAGTGAAGGCGTGCTTTTGGGGTGTACCCCCAAGGGAGTGGGGTAGGG
AAAGGGGCTGGTCTTCCCCACGAGCGTATCCCCGTAGATGGGCTGACCGCCTCCGGACGT
GGATCTAGGTGCGGCTGCCGGGTGAACCGGGAGAGGTCCCTGACGAACGGAAAAGTCTGG
GGAAGATGGATCGATCCGACTGGAAGTGGGAGTCTGTTAGAATCGTGATCCCAGCCGATT
CCTTCCAAATTCCAGTGAGATCTGTAAACGCGACGGGTTCCCGGAAGATTAGCCTCTTAT
CCGGCCAAGGCGCAAACCCGGTGGTGGTGAAATAACTCAGTCGATCGGTGGTGTTTATTG
AGTGCTTAACATGTGCAGAGCACTGCTCGGGAGAATACAATACGGTGGAGTTAGCAGACG
TTCCCTGCCCACGGCCAGCTTACCACCTAAAGGGAGAGACAGATAACAATATGAGTAATT
TATAACGTGTAATTTAAAGATATATACATTAAGTGCGTTCCGGCTGGGGCCGCTAGCGCA
GACTCTCAGGTCCACCAGACTCCCGCTTCTGTGCAGCCGGACAAAACAGCAGCTTGAGGA
AATCCAGGATAGACGGCAAGCAATGAGGGCAGCCCCTTAAGGAAACAAACTGGCTTAAGA
GAGGTCCCGACCCAGAAATGTAGGCTCAGGGAGACGTCAAGGTCCGGTTAGGGGTTAGGA
CACCCTCAGTTAGCTCCGGGGAGCAGACTTGGCCCCCAAGATGACTTGTTTCAGGTGTAC
AACCCCCAACCCTGCTGCAGGACCCAGTCCCGCTACCTGCAGTTCAACCGCCGAGAGTCC
CTTTTATGCTAGTGGGGAGTGTCTGGACCTTAACTTCAAAATGTCAGAAACTACAGGTCA
CCCAGGGGATGTGGGGGAACCAGTTGGATTAGAACACTTGATGAATTCAGGTGTGCCAGG
GATCACTGTGGTTCTCTGAGGATTTCCTCGAGAGAAAATGAGAAGCGACGTGGCTTAGTG
GCCAGAGCATAGGCTGGGGAGGCAGAGGTGGTGGATTCAAATCCCGGCTCCCCACTTGTC
AGCTCTGTGACTTTAGGCCAGTCACTTCACTTCTCTGTGCCTCAATTACCTCATCTGTAA
AATGGGGATTGACTGAGCCCCCACGTGGGACTCCCTGAAAACCTCGTATCTATCCCAGGG
CTTAGAACAGTGCTCGGCACAAAGTAAGCGCTTAACGAATACCATCATTATTTTAAAAAT
GAGAATATAGTAGGTACAGAGGAATCTGAGCAGGAGCAGTGTAGGGGAAGTGACAAGCCT
ATAGATTGGGCACTTGAAAGGGGGTTACCGAGCCCTGGGAATCAAACAGCAAACTTCCCC
ATCCAGCCCTTAGCAGGGCAGGGCAGCACTGTGTATCTGCAGTCAGATTCACCTCCCTCT
TGCATCTCCACCCCGTGAGAGTGAAACTGGGGATAGCGGGGAAGTGGGAAAGGAAGAAAA
GACAATAGAGGGAAAGCAAAAGGAGCTACGATTCATAAAGTTTTGGGGGGCCAGTTCCTG
GCCCGATTAGGTTCCTACTGTAAACTGCCTGAGGAAACTCCTCGGGCTTCACAGGGCAGA
TTCTGGATGGACACAGATGCCTGGCATGCCCCCAGACCTCCTGAAATACTGGGCATTTTC
TTGGTGAAGGTGAGTGCTTAACACGCTCCCTAAATAATGGTAGGAAGGCCCAGGCAACGG
TCAGTCTGAAAATCCCTTAGAGGTTCACATCCGAAAAGAACATACAATAATTCTGGGTAG
ACCTGAAATGCCAGGGGTTGGGATTTGATTTCTCAGTGTTTAGGCTGTAATTTAGGACTG
GCTGAAAGTTCTTAAATATAAGGGAAGAAGGTGTCCTGCAAAGTCAGCAGTTGTGTATCT
GTCGATTTACCGGGGTAAATTTGACAGAGTTTGGGTTGGGTGAAGGAGGAATGTAGGCAA
GTTGAATGCAGTCAGTCACCTTTACGTCCAGCCAGAGTAACTCTGATAGTCTGGGTCAAA
CTAGACCTTCCTTGATGGATTTTTTTTTTTTTTCTAAAGTAAATTTTGTACGTCAGTTTA
TTTGGAGACCGTTACGGCATTTAAAGTGGTTGGTGTGTGACTGGAGATGCCCGTATGTTC
CTTATTTGTGCAAAATGTCCTGATTGTATAAAGGCTAAAATGTAAAGAGACTGATGGGTC
ACACTTAGAAGGGTCACTGTTAGTTAACGTGTTTAGGGACAAATTTACTTTTGCTAGGTG
TTCCACATTTTGGCAACTTCACTTCATCATGGTTTCCAGGTCTGTGAGCCTGGACTGTGA
CAAAGGAACTGATCCTTCAGATTCCTGCTTTTGGGTGGGATCAGGCTAGAAAATTCCCTG
GAGCAACACCATCTCTTAAACTGTATATTTGTCAACTTTGCATCTCTCCCATAGGGAAAC
GATTGGTCAAGCTCCCTTGCAAAAGTTCCTGGAGAAATTCAAGTATTAATTGGCAGTGGG
AAAGGAATACCCTCGTGGTCATGAGTTTAATGTTGGTGATACTTGTATTCTGTATTAAAA
CCAGGCAGAGTGCAGGCCAGAGAAGGAAGACAGAAAGTGCTATGTTAACTATTGGTCAGG
GTGAATCTTAGAGTACAAATTGAGTGTATGGTTTCATGTATAAAGCCTGGATATCTGGGT
GTTTTTGTCACGCGTTTTTCAAGAATTTGTAAGGGTCTGTATTTACCCGTGGGATTTTCA
CCTGTGTCATCTGAAGGGAGGCGGGAGGGGGGTGGTTTGGGGGCCTCTGACTCTAGGAGT
CTGAGAAGCAATCACAGAGGGATAAGAATGAAGGCTAGTTTTATACTAAATCTTACACCT
TTGAGGAATCTAGAATGTGTATTGTCGGGGTGTGCGTTTAGAAAAGAATTGTTTTATCCA
TTTTGGGAACCGTGTTCTGGTGTCAGGCGCGTAGATGAATACTTATTTCCTGACAGTTAA
CGTAGCGCCGACTGTCCTTAGTAGGCTTTAACAGGGCTGTCGGGTGAGGCAGCTAATTGG
TGCTCCAGGCAGGGCAGCCAGATCCCAGCACAGAAATAATCTGCTCTACTGTGTATGTGT
GTATGGGAATTGTTTGTGACATTGTGCTGTATTGGTGTGCTAACTGGCTCAGGGACTGAG
ACCCCGGAGAGGAGAGGGGTGTGATTCAGCCGTATTAAATAAGAAAGCATTCGGGCAGTG
CTCCGTTGCCGTCAGCCAGCCGGGTGCCTGCCTGTATTCCACCGAAAAGGTGAAGGTCAC
TGATGTAGGCTCACGCCCTCAGACCCAAGCAACTATTTTGGAATTGGGAGGATCTGTGTG
TTTAGGGGAGGAAAGGGGGTGGTGAGCGAGTCACCCTCGGTATATCCGGCCCCGATTACA
AATGGTGGAGACGTTGGAGATGAAAGGTGCATCAGAACTGAAGAAGAACCAAATACATGG
GGAAGGTCACATAGCTTAAAAAACAAAAACCCCAAAACACTCAAGGGCTCAGTCCCAAAG
CCAGCCACTAGCCAATACAGACTCCAGACAGATGAATCCAGGAAAGACAAAATTGGACCC
TTCATTTGTATTTGAATCTCAGGATTTCCAAAGAGGGGGGAAAAACAAGTGCGGGAGTGT
GACCGGTAGTCTAGGGGGCCACTGGGCACAGCACGGCGTGCCTGTTGCAGAATAAGAGCA
GCAAGATAACCACATTGAGCCTGCACCGGTCCGGGGCGGACAATCTGGTCATCTCTGGAT
CCCCTCGAGGAGAAGGTTCACGCGTACTAGCATCCCAACCCAGATCTCTCCAGAAAAGTG
TTCCCACACGCTATCAACAAGGCGGAGGGATCAGAACTGTTGATATCGTCAGAAGAAGAA
TCTCCTCGAAGAGGCTCCCGCATACGATCATCGAAAGGAAGGAGGAACTGGCTCACCCGG
AAGGACTCTTTAATGGACTGGGAACTACGGGGAGGAGTCTGGGGAGCATTTGGATTTCTT
TGGTTATAAAAGGCACAAGCCTTTGCTGCAAAGGTCTGCGTCTACCAGAGGATGCCGGGA
TGGGGCACCCTGCCATGTGAGGCCAGGAGGTCACTTTAATAAAGAGGATCTGTCGTAAGC
CACGATCCTGGTATGTGGTTCCTTCGGTGATGGTATCCTTGCGGGACAGTCCTGGTTCCC
GAGCGGATCGGTGTTGACACCAAAACAGTAAAAAAAGAAAAATCAGCCGGAGGTGTCGAA
GGTTGAAGCTTGTTAATCTCGTATTTCATATCCCCGTGAAATCAGAAATAATGCAGATTG
TTGCCGTGGGGCTGTGCTTTAACTCTGTCCCTTTTTCGAACTGGGGCGAATTTAGGTTTG
TTACCCTTTTGCGAGAAATGTCTGAGGAAGTGTTTCTTTTTTCGAAACCCAGTCGAGCTG
TCCCTTCTCCTGATCGCTAGTTGGATTTAGATGCTACTGAGTGTAAAGTACCATACGTAG
AATTGTAGTAGCGTTTATCAAGGGATCCACTTGGTAGGGTGCACTACTGGATGTGTGGAA
AGTACAGAATAACCTATCGACACATTTCCCATCCACAGGGAGCTTACACTCCAATGGAGA
GTCAAATAAATGTTTACGACTACAGAGGTCAAAATGAAGCGGACATTTATCTAAATGCTA
AGGAGGATGTAAATAAATTCCTAAGTGGTAGGGAGTGCAAGAGGAGGTACAGGACTATCT
CAGAAGTAGTACGACCATAAGACTGAAGCGAGCCCGGGCTTGGGAGTCAGAGGTCACGGG
TTCGAATCCCGGCTCTGCCACTTGTCAGCTGTGTGACTGTGGGCGAGTCACTTCACTTCT
CTGGGCCTCCGTTACCTCATCTGTGAAATGGGAATTAAGACTGTGAGCCTCACGTGGGAC
AACCCAATTACCCTGTATCTACCCCAGTGCCTAGAACAATGCTCTGCACGTAGTAAGCGC
TTAACAAATACCAACGTTATTATTATTATTATTATTTTGAGGTAAATAAAAATAGATGGA
TATGTTCATCAGCCCCGAGGTTAGCTGTAAAATTCGTAGTTCTAAGGACGGCTGTCCCTT
TATCAAGTAAACGTTAGATCAAGTTGAGATAACTATCCCTTACGGCATACTGGCTCTTTT
TTTTTTTTTTTAGTTTTTTTAAAAATTGGGTGCTTGGGATTATTTTATTGTGTGTGATCC
CATTATTTCCAGAGAAATGGGAGAATCGGGATTTTTTCAGGAGTATACTAGGTCATCCCA
TAATGTGGGGGTGACATTTTTGCAGAACACTTAGAGAAGCAGCGTGGCTCAGTGGAAAGA
GCCTGGGCTTTGGAGTCAGAGGTCATGGGTTTGAATCCCGGCTCGGCCACTTGTCAGCTG
TGTGACTTTGGGTGAGTCACTTAACTTCTCGGTGCCTCAGTTACCTCATCTGGAAAATGG
GGATTAAGACTGTGAGCCCCACGTGGGACAACCCGATTCCCCTGTGTCTAGCCCAGCGCT
TAGAACAGTGCACATAGTAAGCGCTTAACAAATACCAACATTATTATTATAAGGGAAACT
TGTAGTATTTAAGAAAGTCTGATGCCGCACGTGTGCATGTAACCATCTCTTCTAATGCCG
TGTCGTGCTGAATTCAGACATTCCCACTGTTGGAAGAAGATTCCCCCATTATACAGTTGC
AGTCTACCCAAAGCATGCAGAGGAACCCCCGTGTTCTTTCAGAAGTGAGTCTACGTCTCA
TCCCTCTGCATAAACGAATGAGGTAGACGGTCAGCGCAGCGGAACGGTTAACCGATCTCA
TAATTAGAAGTGTCCGAACAGATGACGGCTCCAACGTTAACGTGGCAGGCCAGACTGGAG
CATTTCAGCAAGGAAGAGCCAAACAAAATGAAACGTGTGAGCGGGTGGCCCACAGAGCCG
AAGGTGTACACGGCTCACTTCAGTGTGATTCTAGTGCTTTGAAATGCTTCACTCTCCCGC
CTCTCCCCTTGCTCGCATTTGGTTCCCAGAAGAGCCAGGTATATCTCCCAAACCTCAGTG
CTCCCTGGCGCAACTTTGCTCTACGCGTAGTGGCCCTGCAATATACGTCACGTGGGCTGC
GTCGCACAGAGAATTTGCATTGGAGTTTCCCCTTCTCATTTTTAACCCCTTTTTCCTTCC
CCTTGTTGCTAAGTTTAAGTGAATCTCACCAAACGATTCAGAGGTGTCCCCCGTGTTCGG
ATTTCAGTGAAAACCAAACGGAAAGGAAGTGGAGACCAGAGGCAGAATGTATGAAATTTT
CTTAGGCCTGCCTCAGTTTATTTTGGGCCCTAGGGATGGATGTCTGAATGCTACTTGAAG
CTTGAGTTAGAAGAGTGCACGTATGGTGTAACTGCCCTTCGCGCTTTCGTTAGAGAAGCA
GCGTGGCGTAGCGGATAGAGCACGGGCCTGGGAGTCGTGGGATCTAATCCTGGCCCCGCC
ACGTGTCTGCTGTGTGACCTTAAATAATAATGTTGGTATTTGTTAAGCGCTTACTATGTG
CAGCGCACTGTTGTAAGCGCTGGGGTAGATACTGGGTAATCAGGTTGTCCCACATGAGGC
TCACAGTTCATCCCCATTTTCCAGCTGAAGAGGTAACTGAGGCACAGAGAAGTTAAGTGA
CTTGCCCACGGTCACACAGCTGATAAGTGGCAGAGCCGGGATTCGAACCCATGACCTCTG
ACTCCCAAGCCCGGGCTCTGTCCACTGAGCCACGCTGCTTCTCATAACTTCACTTCTCTG
TGCCTCAGTTACCTCATCTGGAAAATGGGGATTGAGACTAAGCCCCATGTGGGACGGGGA
CTGTGTCCAACTTGATTTGCTTGTATCCACCCCAGTGCTTAGTACAGTGCTTGGCACCTA
GTAGGCTCTTACAGCTACCACGATTATAGTATTATTATCCGCTCATCCGATCATGCCAGT
ACGTAGATTATTTTCCTTTCCACGGTGCCTGTTGTTTGCTCGCATTTAAGTTTCAACGGC
AGGCAGTCAGCTAGCCCTTCTGCCTTCCCCTCCAACCCATCTTGAGACCATCTCTGTTTT
TAGACTGTGAGTAACTTCTCACTGGCCACGACATAAAATTCCTGAATGCAAACTGGGGAA
TGCTCCAGGAGAGCCAGTCAGCCTCAGGTGTCTAAAGCCCTGTGCCTAATTCCGTGTACC
AACGTGTATACTGGACTCAGAGATTTAAAAATAAGAAAATAGCTGCTTTCCAGATGGATG
TGTGTACAACCAAAAATGTCACCGATTTGCCTTCAGGAAAACAATGGAAATCAATAGCTG
ATTTGGATTCCAGTGTGAGAATTTAAAAAAAAAAAAAAATATTTGTGGCCCAGCCTATCG
ATAAGAAGGGAGTCTGTTTTTCTCTTAAAGAGAAGTGTTGACCCTTAGGATAGTTGCACC
CAGTAGGTAATTCAAAAAGGATCGTGTTTGTTTAGATAGCAGAATGGATTGTGTGTGTTT
GCAGAAAAACTTAATGCTTAGCTGATTCAAAAGGAGGCCTGCCCCCATCCTTCTCCAGGG
ATGATGATATTGAAGTGCTCGTGGATGAAGTTACGGACCCGGCTGAGGAGACCTCTCCGG
CACGAGCCTCCGGTCGAACGACCACGTAAGTATACGAGGAGTGGTGGGGCGAAAAGGAGG
TGGACTTCGTTGCGTTTCGGGTTTGACGTCGGTCACCGGGGGAGGAGATGGAGGGTTTGA
TATCAGAGAAGGTCCAAAGTGAGGTGGGTCGCTGAGAAATACTATTCACACCTGCTATTC
TTGGGCGGGAAGTAGGGTGTAAACGTCCCTACGCTTCTGCGGGGATGGAGACGCATCCGT
GCTCTGCACACGGTAAGTGCTCGGTAAATAAGATCAAGTGTTCGGTAGCAGTCCAATCGT
ACTCTCAGATTGCCTCTTATAGGAAATTAAATAATTGCTCATTTAGCAGGAACATAAGGG
GATGAGTTGAAACCCTGTAGGCTTTATCCCATTTCTGTCGTTTTGAAATATCTAAGGCAA
AAGAGTACCCTAGCTTCATGTAAGAAAATAGTTTGTCATTCAGTATGGAGACTTGGATGG
AACGAATAGTTTAATCAGTTCCATTGGGATTAAGACGTTTCTTTCTCAGAGTGGCATCGA
AGGGAAAGAGAGGTGGGATTTGGGAAGCCGCAGAATTTGTGAAAGTGCAGATCCGAGTGG
TCGAAGCTATGCGTTAGATTTGGCAGGCTTCTCTTAAGGATTCAGGAAAGATCTTGTTCT
TTTAAGTGTGAAAAGACAAGAACCATTTCCTCCACGCCCTTTCTTCCAGGCTGGATTTCC
CTCCTGTCCACTCATTGTATATGTTTTCTAATTCCATGCTATCTGGTATTTTCCTTCCTG
GGTTTGGGGTCTGAATGGGAGGGTGTTTTCCCAGGTTCTCGCTTCGTGGGCTGTGTTTTT
ATTGCTCATTTATTTAAGCTTGTCGGTTCATAAGGTTTAAACCTGTCCTCCCCTCCTCTT
TAGTAAGCGACTCTCCCAGCCTGCTGGAGGCCTTCTGGAATCTCTCACTAATATCTTTGG
GTAGGTTAGTCCCCATTTGCCTTTCTGTTTTCGTGTATGTAAATAATCTAAATGATTGGC
GTTAACGTACCCCCAAATATCCGTGATTCAAGGAATGCCACGTGTCTTAATGTCAGGTTT
CTTCTAGCTTCTGCTTTTTTCTTCTCTCCTCCCCCTCCCCGTCCCCCCCCCAACCTCCTG
CTTCTTCCGTCTTGCCGTGTGCTGACCTCTGGCCTTTCCCTCCAGTCTGTCCGAATCTCC
ACTTTTGGGACAACCCTCTTCTGATGCTGCCAGGTGAAACTATTATGCACTCTTAGCCCA
GCATGTGAGTGTGGGACATTGAAATTGTAACGTGATCGCTCCTTCGTTTCCCTCAATCAT
GAGTCGTTTTGAACACTAACCAGGAGGCCCTGCATGTTTCCAGGAAGGCCCTCGGCTCTT
CCCAGAGATTCACTGTGATGATTGGCTGCTTCTCACGGTTGACAGTGGTAAAAACTGGCC
AGGGATCTTTTTAATAATAATGTTGGTATTTGTTAAGCGCTTACTACGTGCTGAGCGCTG
GATGCCGCCGCAAGTCAGCGTTTGCGTTAGGCTTTGCCTTAACTTCTCTGTGCCTCAGCG
ACCTCATCTGTAAAATGGGGATTAACTGGGAGCCTCACGTGGGACAACCCGATTCCCCTG
TATCTTCCCCAGCGTATAGAACAGTGCTCTGCACATAGTAAGCGCTTAACAGATACCAAC
ATTATCATTTCTTGAAGCATGAGCTAAGCTCTTCCCGCAGCGGAAAGGTTGCTTGTAGCC
AGACCAAGTGCTAATCGTGGATAACACTCCGAACCCCTGAAACATAGGGGTCTTTTGGCC
GGAGGATCTCGCGGTGATCGACCCCGCGTACGTGCGCAAAAACCATTTCTTCCAACACTG
CGTCGTGTTGCCTTCAGACGGACCCGTGCTGAGGGGGAGAGGTCCCCTAGTTCCCCGGTA
GCGTTACTTAAACATTTTAACCCCCTTGTGGGACTGGGACTGTGTCCAAACTGGTTAACT
TATCTCCCCCAGCGCTTAGTACAGTGCTTGGCACGTAGAGGGAGCTTAATAAGTACCGTC
AGAAACACAACGTGGAAACCTGCATTCTAAAGAGCTCACCGGATCTTTGCGGAGAGAAGC
TGGCGGTTATTCCTTCGCAGTAACTGGAAAAATGGTCCGACACTGCGTTCACTGATTGGG
CAACCGTTATCGCCAAGAAAGATCGTGCCTCGAGTTGGGTATTGAGAGGCTGTGAGCCTC
TTCCTCATGGGCTCGTGGACCATCTGAGGTGCAGTAGTTACGGGCAGATACTTTATTTGG
CCCGGTGCTTCTCGCGATCCGATGGGCCAAAGCGAGAAGAGAAGGCAATCGCCGAGGATC
GCCCGGTTAGGTAGGATCGTCTCTGCTCCCCTTACCTGCCGTCCTGATTCCCTGCCCCTA
AACGAATTTCATCTTCTGTTTAATATCTTCCTTTGCCTTCTTAGGAGGCGTTCTGTGTCT
TCCTCTCCCGTCCCCCAAGATACCATGGGAGCCCGTTCTGGTTCCAGGAAAGAAGTGAGG
GTGCCCACGAAAGCAGCTTACTATTTTGTAAGTATGGTTCGTTCAGAGACCGTAAGAAAT
GTTCACCAAGGCGGTGGAAGGAATTCCCCCCCGGCAGTTCAAAAATCTGTCCGGTGGTGT
TTTTCCACTTTGTTCTGTTAAAAGTCCCTGGTGTCTTGAACCCAAGTCTTGCTGAATGCC
AGCAGCCTTGTGAAAATCTCAAGTACAGGATAGTGGCAAGAGCGGGGGCTTGGGAGTCAG
AGGTCGTGGGTTCTAATCCCGGCTCCGCCCCTTATCTAATAATAATAATGTTGGTATTTG
TTAAGCGCTTACTATGTGCAGAGCACTGTTCTAAGCGCTGGGGTAGACACAGGGGAATCG
GGTTGTCCCACGTGGGGCTCACCAGATAAGAGGGATCCCCATTTTGCAGATGAGGNNNNN
NNNNNAATAAAAGGGTGTGAAAACTGCTGGCCTGATATTCAGTCACGTTTATCGGGTGTT
CACTCTGTTCCACTTGGGAGAGTACAGTCCAGCAGTAAGCAGACACATTCCCTGCCCCAC
AGGGAGTTTACAGCCTAGACGGGAATAGACGTTAATATGAAATAAAGAAATCACAGATAG
GTACAGAAGTGCCGTGGACCTGGGCAGGGGGATGAACACCGAGCGTTTATCTGTCCCAAG
AGCATTTATTTGTCCAGTTAGGTATTTCCAGACCCTAATCAGTGTTAAATTTTGTTTACC
TATTGTTGAAAGATGAGGTTTTTTTGTATTGGTCGTGATTCCTATCACAGCAAAAGCTTT
ATTATTCAGCATTTTACCAATGCCATTTCTGGTCCCCTCTGCCGTCAAAGCAGTCTTGGT
CAGTAGCGAAGCGGGACGGCATAGTCGATGGAGCCAGGGGCCTGGGAGTCGGAAGGTCAT
GAGTTCTGATCCCGGCTCTGACGCTTGTCTGCTGTATGACCTTCGGCAGTTCACTTAGCT
GTGCCTCAGTTACCTAATCTGTAAAAGGGGCATTGAGACTGTGAGCCCCATGTGGGACAG
GGGCTGTGTCCAACCCAATTTGCTCGAATCTACCCCAGCGCTTAATACAGTTCCTGACAC
ACAGTAAGCACTTAAATACCATTATTATTAGTAGTTCCCAGAGAGCAACAATTTATAGTC
ATCAGAATATGTCTGAGTCTTCTCCCATGTTAACGGGGAGCCTGGTAAGTGGCGTGAATT
CCTCAGGGCCACTACGTATGCTTTCCTTGGAAGTCCTTGTGGGTCTGGGGAGATATCGGT
GTTTTTGCATAGTAAGGAGTCAGTGCTGGACTGGCAAATGGCAAATTTAAGAACTTGAAT
TTAAACGTGGAGTTTGCAGACTACCAGTGGTGGGTATTTAATGAGTACATACTCTGGGAA
GAGCAGTACGCTGAGCACTCGAGAGAGTCCGGTACAGTTAGCGGGTATGGTCCGTGCCCT
CAAGGAACGTGCAGTTTAGCCCGGGAGGCAGACAATAAAGATACGGGTGCTGTGGGATGA
GTTTCTAGGGGACAAGAACGCAAGGGCGGAGCGATTCAGTGAGCGGAGAGGGAGATCAGG
AGCAGAGCTGAGAAACTAATCCCGAAAGACCAACTGGAGATAGATGAGATGGCAGGAGAG
CTTCGGTCCGCTGGATGTGAAGGGTGAGGGAGGTCTAGGCACTGGGAGGGTGTGAGCGAG
AAGACGTCGACGGCGAGAGAGCCGCTCAGTGAGTTTCCACTGATAACTGTGTCTTGCGGC
CCAATCTGCAAAGCCCCGGGCATCCCTAGCTCTGAGTCGAAGAACCTCCCAGCGTGCTGA
ATAGCGAAAGCTCCTGCTGTAGGGGGATTTTCATTAGCTCTCGACGCTAAAGCTATCTGG
GGCTGGGGGNNNNNNNNNNACGTCAAACCTCAATAGCCACGAAGTCCACTTCGTATACGC
CCCGTCACTCCTCGTATAATTGCTTGGTCGTTCGACCCGTGGGTCAGGCCGGAGAGATAT
CATCAGCCGGGTCCGTAATTTCATCCGCGAGAACTTCAATATCATCGTCCCAGGAGAAGG
ATGGGGGCTTAATCCCCATTGAATAGATGAGGGAACTGAGGCACAGAGAAGTTAAGTGAT
TTGCCCAGAGTCACCCAGCTGACAAGTGGCAGAGCCGGGATTCGAACCCATGACCTCTGA
CTCCAAAGCCCATGCTCTTTCCACTGAGCCATGCTGCTTCTCAAGCTGCTTATCTGCTGC
GTGACCTAATTTATCTGTGCCTCAGTTCCCTCATCTGTAAAATGGGGATTAAGGCTGTGA
GCCCCACGTGGGACAACCTGATTGCCTTCTCTCTACCCCAGTGCTTAGTGTTTGCCACAT
AGTAAGCGCTTAAACAAATGCCATAATCCTCCTCCTCCTAGGATAGATTCCAGCGCTTAG
AACAGTGCTGTGCACATAGTAAGAGCTTAACAAATGCCATTATTATTATTGTTATATTTT
GAAGAGGTCAGTGATGATTAGTAAAAGGTCTGACTGCACGGAGAAATCACAGTCCCTTTA
TTGCTCGCATCTCCCAGCAGCTCCTCTCTTGCCCCATCATGCTCAAGTTATGTCGTGATC
GGGTTCTGGGGCTGCTGACAGTTTGTGATGCACTCACTTTGGGTTATCCCAAGAGGAATG
GAGAGACAACCCTCCCCGAGCATCCAACAAAACTAATTACGAAGGAGGTTTTAATGGGGC
AATGTGGACTGTGATCGTGCCTGATTTTAAGTTTTCAAGCTGAGACCTCTTGGGGACTAA
AGAACAGTAATCAGGGCATGAGAAAGAAGTCGAAAATATTCCACGCTTGTAAACCTGGTT
CCCTAAGGAAACAGTTTTGTCATATAACGGCTGTGTAACGGGTTTTGCTTTTGGCCTCAC
GGTGTAGTTTCAGAGCTCCGCTGGCCAGTCCGTGGACTGGTGGTTCTCACTGTCTCGTCG
GGGGCCGTCCCTGAGAGTCAGAATCTTGTAAAATAATGTTGGTATTTGTTAAGCGCTTAC
TATGTGCAGAGCACTGTTCTAAGCGCCGGGGTAGATACAGGGTAATCGGGTTGTCCCCCG
TGAGGCTCCCAGTTAATCCCCATTTTACAGATGAGGGAACTGAGGCTCAGAGAAGTGAAG
TGACTCGCCCGCAGTCACACAGCCGACAAGTGGCGGAGCCGGGAGTCGAACCCATGACCT
CTGACTCCGAAGCCCAGGCTCTTTCCACTGAGCCACGCTGCTCCTATGAGAAACAGCGTG
ATGTAGTAGGAGGTTCACAGGCCCGGGAGTCAGAGGACCTGAATTCTGATCTCGCCCTCG
GCTTGTCTGCTGTGCGACCTCGGGTAGGTCACTTCTCTGTGCCTCAGTGGCCTCAACTGT
AAAATGGGGATTAAGGCTGAGCCCCACGTGGGACTGAGTCCAACCTGATTACCTTGTAAC
TTCCCTGGCGTTTTGCACTGTCCCTGGCACATAGTGAGCACTTAATAAAGGTGTGAAAAC
TGCTGGCCTGATATTCAGTCACGTTTATCGGGTGTTCACTCTGTCCACTTGGGAGAGTAC
AGTCCAGCAGTAAGCAGACACATTCCCTGCCCACAGGGAGTTTACAGCCTAGACGGGAAT
AGACGTTAATATGAATAAAGAAATCACAGATAGGTACAGAAGTGCCGTGGACCTGGGCAG
GGGGATGAACACCGAGCGTTTATCTGTCCCAAGAGCATTTATTTGTCCAGTTAGGTATTT
CCAGACCCTAATCAGTGTTAAATTTTGTTTACCTATTGTTGAAAGATGAGGTTTTTTTGT
ATTGGTCGTGATTCCTATCACAGCAAAAGCTTTATTATTCAGCATTTTACCAATGCCATT
TCTGGTCCCCTCTGCCGTCAAAGCAGTCTTGGTCAGTAGCGAAGCGGGACGGCACAGTCG
ATGGAGCCAGGGGCCTGGGAGTCGGAAGGTCATGAGTTCTGATCCCGGCTCTGACACTTG
TCTGCTGAATGACCTTCGGCAGTTCACTTAGCTGTGCCTCAGTTACCTAATCTGTAAAAG
GGGCATTGAGACTGTGAGCCCCATGTGGGACAGGGGCTGTGTCCAACCCAATTTGCTCGA
ATCTACCCCAGCGCTTAATACAGTTCCTGACACACAGTAAGCACTTAAATACCATTATTA
TTAGTAGTTCCCAGAGAGCAAGAATTTATAGTCATCAGAATATGTCTGAGTCTTCTCCCG
TGCTAACGGGGAGCCTGGTAAGTGGCGTGAATTCCTCAGGGCCACTACGTATGCTTTCCT
TGGAAGTCCTTGTGGGTCTGGGGAGATATCGGTGTTTTTGCATAGTAAGGAGTCAGTGCT
GGACTGGCAAATGGCAAATTTAAGAACTTGAATTTAAACGTGGAGTTTGCAGACTACCAG
TGGTGGGTATTTAATGAGTACATACTCTGGGCAGAGCAGTACGCTGAGCACTCGAGAGAG
TCCGGTACAGTTAGCGGGTATGGTCCGTGCCCTCAAGGAACGTGCAGTTTAGCCCGGGAG
GCAGACAATAAAGATACGGGTGCTGTGGGATGAGTTCCTAGGGGACAAGAACGCAAGGGC
GGAGCGATTCAGTGAGCGGAGAGGGAGATCAGGAGCAGAGCTGAGAAACTAATCCCGAAA
GACCAACTGGAGATAGATGAGATGGCAGGAGAGCTTCGGTCCGCTGGATGTGAAGGGTGA
GGGAGGTCTAGGCACTGGGAGGGTGTGAGCGAGAAGACGTCGACGGCGAGAGAGCCGCTC
AGTGAGTTTCCACTGATAACTGTGTCTTGCGGCCCAATCTGCAAAGCCCCGGGCATCCCT
AGCTCTGAGTCGAAGAACCTCCCAGCGTGCTGAATAGCGAAAGCTCCTGCTGTGGTGGAT
TTTCATTAGCTCTCGACACTAAAGCTATCTGGGGCTGGGGTGGGGTTCCGTGTCTTGCAG
AATGCCCACGACGGAGAGGTGAACGCCGTGCAGTTCGATCCCAGTTCCAGGTTATTGGCA
ACAGGTGGCATGGACCGAAGGGTCAAACTCTGGGAAGTGTTTGGAGGTGAGGTGGTCATC
GCGTGAAGGGGGAAGAAAACGGGTCACAGGGAAACAGGGTGGAAGCAGCATGGACTAGTC
GGTGGAGCACGAGACTGCCGGGACTCAGAGGGCCTGGAGTCCAGTCCCGGCTCCACCGCG
TGTCTGCTCCGTGACCTTGGACGCGTCACTTCACTTGTCCGTGTCTCAGTTGCCTCGTCT
GTAAAATGGGGATTAAGACCGCGTGCCCCATGTGGGACAGGGATTGTGTCTGACCTGATT
AGACTGTAAGCCCGTCGACTAGACTGTAAGCGCGTCAAAGGGCGGGGACTGTCTCATCTG
TTACCGATTCGTACATTCCAAGCGCTTAGCACATAGTAAGCGCTCAATAAATGCTATTGA
ATGAATGAATTAGTTTGACTCTGCTCCACCACTTAATACGGTGCCTGGCGCATAGCACTT
AACCAATACCATAAAAAAAGAAAACCTGAATATTTGGTGTTTCATAAGAGTTGAAATCTC
TGTAGATGATTATTTAATCTTTCTTTCTATCACCGTTTCTATATTGGCGCAGTGAAGCCG
CTGTTCGAAAGTGATCTCTTTCCGTGTGCTTTTATTTGAGTTAACACATTCTAATCTATT
CTCTCCTTCTCCCCCCGATCTTTCCCTTTTTTGTGCGTTCAGATAGGTGCGAGTTAAAGG
GCTCCTTTGCTGGCAGTAACGCGGGAATTACAAGCATTGAATTTGATAGTGCCGTAAGTG
TTACCTAATACCATTCAATATAATGTACTGAAGGTGGCCAGATGTACTTTTTTTGAAGTC
ACGAGGTAATTGAGCAGCTCACAGATAAGCCCGAAGGTGAGTCCTGTCTGGATTTCACTT
CCCCGCTTCCCATCCCCTGTAATTGCTGCCTCCTCCCCCCCCAGGCCTGAATGGTTTCCA
ATAAAAGTATCTTTGTTCCCAAGTACCATTTTCACATTTAGCAGTGGGGAAAAAAACAAG
CTGTGGACTTCTGTAGCAAAAGGAGGAAAAGAGTATGTACGAGAGGAGCGGTGGCTCTAC
GTCATCGTTACCCAAGAACACTCCCCGTTCCCATAGTTACCTACGACTCTCAGCTTTCAA
ACTTCCTATGGTGGTCTTGTGGGTAACTTGGTACATACCTGAAGTGAAATGACTTACGGG
TGGTACGCGGATCTACTTAGAGCCTCCCTGAGTTCCAATTCCAATTCTACTTTCCATTAA
TAGAGTAGGACAAGAAAATGGAATGGGGGGGTGTTTGGAATAGGAAACCGCAAGGGTGGT
GAGGGAGAGATGAAGGGGACGCCTAGAGGAGGGGTGAATTGTAGGAAATTTAAAGTTTAT
TTCCAAAGTTTTGTTAAAATTAAATTGGAATGACTCAGATACTTGCCTACAGAAGCACTG
TGGCCTGGTGGGAAGAGCATGGGCTTGGGTTTTAGGAGACCTGGGTTCTAATTCCAGCAT
TTCCCTAATGCCTGCTGTGTCACCTTGGACTAGACGCTTCTCTGTGCTTCCGTTTCCTCA
TTTTGTAAAATGGGATGAAATACGTGTTCGTTTGATTCCTTAAACTTGGAGTACCGTGTG
GGACTGGGCCTGTGTCTGCTCTGCTTACGTACCCCGGCTCTTAGGACAAGTGCTCGGTAC
GTAATATGTAACAGATACCGCAGTCCTTGCTACTGCTATGTCAGAAAATGTACCTTACGT
TTGCTTCTGGGAAAATCTCTTCTGAATTGATTGAAAATGTTGTTTGCTGTTTGTTCCCAT
AGGGCTCTTACCTCTTAGCAGCTTCAAATGATTTTGCCAGCAGGATATGGACTGTGGATG
ATTACTGGTTGCGGGTGAGTCCCCTGGAAACAAGTCAACACACCTGTCCTTCTTGCCTTT
TGGGTGGCTACTTGGAGGGCATGAAAATTGTTGATTCCATGTCTTTTACAAATTTTAGTG
TTTGCTGCTTCTAAGAAAACATAGGTTTCTATTTAGGAAATTTCTCCCCCCTACTGTCCC
ATTGTGCTCTTCCTACGTAAGCAGTTGGAGTCCAATTTACATTCTTCTACTGTTGTCCAA
GCTCCAGCTGAGAAGCAGTGTGGTCTGATGGATCGAACGCAGGCCTGAGTTCTAATCCTG
GCTCAGCCACTTATCTCCTGGATGACCTGGGGGAAGTTACTTAACTTCTATGTCTGTTAC
CTCTCTGTAAAGGGAGATTAATAATAATAATAATGTTGGTATTTGTTAAGCACTGACTAT
GTGCAGAGCACTGTTCTAAGCGCTGGGGTAGACACAGGGGAATCAGGTTGACCCACGTGG
GGCTCACAGTCTTCATCCCCATTTTACAAATGAGGGAACTGAGGCCCAGAGAAGCGAAGT
GACTCGCCCACGGTCACACAGCTGACAAGTGGCAGAGCCGGGATTCGAACCCATGACCTC
TGACTCCAAAGCCCGTGCACTTTCCACTGAGCCACGCTGCTTCTCTACCGTGAGCCCCAC
GTGGGACATGGAGTACGTCAAGCCTGATGAACTTGTAGCTCTCCCAGTACTTAGTATAGT
GTCTGGCACATAATAAGCGCTTATCGGATACCATAAGGTTTGACCGTCTCTGAGCTTTTA
TGGAGAAGATGTGGATATTCTGCCTCCTACAGACATGGGAAATCTGTGGCAACTAGGCTC
GCCAGTATGCTGCTCGAAGTTCTACCTATCACTTAAATTATGACATCTGTTGTACTTCCA
GAATTATGTATACATTTCGCCATGTGGAAAGCGGACTACGTGATGATGATAACGTTGGTA
TTTAAGCGCTTACTATGTGCAGAGCACTGTTCTAAGCGCTGGGGTAGATACAGGGTAATC
GGTTTGTCCCACGTGAGGCACACCGTCTTCATCCCCATTTTACAGATGAGGTCACTGAGG
CACAGAGAAGTGAAGCGACTTGCCCACGGTCACACAGCTGCCAAGGGGCAGAGCCGGGAT
TCGAACCCAGGTCCTCCGACTCCCAAGCCCGGGCTCTTTCCACTGAGCCACATTTGCCAA
AAATGTTAATGCCATTCCGCTAAAACTTAGGCGCAAGCATTTCCATGAATTGTAATTGGT
TGGGTTTCGAGTGTTGGGAGAGGGTATGGGTGTCTCAGTTCTCCGTTAGGAGAAAGAACA
GAGTCATCTTGAGCGATCGTTAGTGGTCTGTACTGTGAGCAGAGCACTTTATTAGGTGTT
TGAGAAGTCACTCCGGTGTTGTGGTTGTGTGAGAGAGTTTTCAGTGTTTTCCCCAGCCAC
GGGAAGTGAATGAATTCTCTTCTGTAAACAGCACAGTGATTGAAATCTTTGCATGGACCA
TGGATATTTCTTGGAAGATTCCACATATCTCAAATATTACAGAGGCCATCGTTATTATTA
TTATTGAATATTAGGGGTGTGTGCGTATTCCCTTTTTGGAAGCTCTTTGGGATCTATTAA
TCACTCTGCTTCCCGGGTGAGAGGTCAGTGATGAATAGTAAAAGGTCTGACTGGCCAGAG
ACTGCGCTTTCATCACCATCCTGATTCCCTGCAGCCTCTTTTTCCATCAGACCCCAGTAG
TGCTCTGATTGGCGGAGGAACTGCTGAAATTGTGCGATGTCTTCTACTTTTGTGTTCGCC
GGAGTTCCGGGCGACACAGCAGTTGGGTAGGCGTCCAACAGGAGCAGTCGTAAAGGAGTT
TCGGTGGTGGAAGTTTGGAGGTCTTGGTTGTGATCTGAAGTTTTCAAGCTGAGACCTCTG
GGAACCCTTCTGTTTAACAGCGGTGATGCTTTTAAAGAATGAATATTATCACAGTAAAGC
CCCACCAAAAAAGCTAGGATTAGATTTGCTTATGCAAATTAGATTTGGTCACTATAATCG
AGTCTGTGGAATCAGTCCATGTTTTTCCCACTCCTCAAGAGCCTCCAGGGGTTGTCCATC
CACCCCCGCATCAAACAGAAACTGTACCCCTGGCTTTGAAGCAGTCAATCACCCTGTCCC
CTCCTACCTTACCTCCCTGATTTCCTTCCGGATAATCCAGCCTGCGGAATGTGCTGCTTT
CATGCCACCCTATTCACCGTACCTCAGTCTCACACATTTGGTCGCCCACCTCTTGTCCAT
GTCCTGCCTCCGGTCTGGAATACCCGCTCTTTTTATATTGGACAGTTATAAAAGGCACAC
ATCTCCTCCAAGAGACCTTACCCTACTAGGCCCTCATTTTCTCTTCTCCCACTCCCTTCT
TGCACGTAGACTTGCGTACTTTATTCATCCCTCCTTCAGCCCCACAGCGCTCGCGTACCT
ATCTGTAACTTATTTATTTTAATGTCTTGTATCTAGACTGAAGGTAAGCATGTGCACTCA
ATAAATAGGAGTGATTGGATTATTTGATCCACAAATTCAGTCAACGAAGAACCCAAGAGA
TTGGATACTAAAAGCACAAACGCATTTTAAACCATTTTGCTGTACGACTTAAGCAAGCTG
TCACAGATATTGCCGGGCCTTATATTCAGATTTTAAATGTGAAATTAACTTTGAGACTGA
AGGGGAGGGGAGGCTAGGTGTTTCTAGTCTTAACAAAAATATGTTATTCTCTCTTCTCCC
AAAGAGTCATCCAGTATTTTCGCTGGAGCTGCGTTTTGGGTTTGTTTTGTTTTGTTTGTT
TTTTAGCGGGGGTCTCTGCCCCTGGCCTTGAAACTTCATGCTCCCACCTCTCAAGGGCCT
GTTTTGCAAGCACTGGCTGAAAAACCAAAGCCTCTCTTGGAAATTCTCTGAGCTACTCCG
TTGGCCGAAAGGGTCACGGTTGAGTTAACCTAAGGCGAGTTAGCCTTCGTCCTGCCCCAC
AGAGACTAAATACACAATTTTCACAGCTCCAGAATGAAACTTGTGAAATCCCAAGAGGGG
AAGGTATGTGCTCACGGAGCTCTTCCTTTCCTCTGTCTCTTGCGTCTGCAGAAGGATGCT
AAATCTATCTTAGTTTACAAGCTGAGAATCACCGAACCTCAGAAGTTGTATTCCCTTTAG
CACCGGCCCGAATTAGGCCTAAGGAGGACCATTGATTTTTACACCGTTTTCTTTCTCTCC
CAGCACACGCTGACGGGACACAGTGGGAAAGTGCTGTCGGCTAAGTTCCTGTTGGGTAAA
TCACTTATTGTTTCAGGAAGTCATGACCGGACCCTCAAACTCTGGAATCTGCAGAGCAGA
ATCTGTAAGGAAACTTGCAACTTGGAGGCTCTTTCTGCTTCAGCTCAGAGATAAGCATGT
CGATAGATGGGGAAGGGTGTTTGCTTTAATATACTCCTTCTCTAATTGGGTGACATTCCC
AGCCTGCCGTCATTTTCAAAGGAGGTAGGGTGGGTGGTATTAGGTCTCACACTGGAATCG
CTGCTCGACGTGGTGACTCATTTACCTTTTTACGTACTCATTGCTCTCTGGGCCTAGGTG
CTCATGATGTTTTACACAGGGGAATGGGTGAAAAGGGAAAACAAGGTGAAACAGTGGGGT
TAATGGGTGTTGCCTCCCCTCTCTCAGGTACAAAAACAGTGTTCGCAGGATCCAGTTGCA
ACGATATTGTCTGCACCGAGCAGTGTGTGATGAGCGGACATTTTGACAAGAAAATCCGTT
TCTGGGATATCCGGTAAAAAAAAATAGCTCTTAAACCAGGTGCTAGAGAAGAAGGGCAGA
AAGAGCAGTGGTGGAGTAAATAGAATAGCGTGGGAATAAATGAATCGTCTTGTAAAACTG
AAGCAAAATGGATGTCTCACCAGATTTTTGACTTAAAAGAGATTTCATTGATTTTTCACT
TTCTCCTCTCGTAAATTTTCCACCTGCCTTTTATGCTTTCCTCGCCCCTCCATCTGTGGC
AAGGAAAGCCCCTGTTCGCGTTCCCCTCCTCTGTTAAGCAAAAAGGCGGCTCACACTAGA
GCACTAGCCAAACAAGAAGTGAAATTGGGATCTGAAATATTATTAGTTCTCTATTTCTTG
TCCTCATGTAAGAACCTCTCCAAGTGGGAGCTTGTAATTTGTAATATAGACCTCAGGTGC
TTCTTGTTTTTATCTCCATTCTTAAAGAAAAGAAGGAAATGGAAGCTGGCACTTAATGAA
CTTCAACCGGGCCTGTCAAAGCCAATGTCAAGCTCTTATTAAAGCTATTCATGCTCGATT
TCTCACTGGTTCTCCTCAGTGTGTGGGCTTCCCTAGTTCATTCATTCAGTCGTATCTATT
GAGCGCTCACTAAGTGCTTGGGAGAGGTTACAATACAACAGTAAACAATCACATTCCCTG
CCCACAGCGATGTTACAGGCTAGCAGGGGAGGAGGCACACATCGATACAAATAAATAAAA
TTACAGATATGTACGTAAGCGTCGTAGGGCTGGGAAGGAGGAAGAGTAGAGCGAGCAAGT
GAGGGTGACACAGAAGAGAGTGGGAGATGAGGAAAAGTGGGACTTAGTCCGGGAAGGCCT
CTTGAAGGAGATGTGCCTTCAATAAGGCTTTGAAAGGGGGGAGAGTATTGTCGGACTTGA
GGAGAGAGGGCGTTCCAGGCCAGAGGCAGGAGGTGGGCTAGGGGTCGGCGACGAGATAGG
CGAGAGATCGAGGGACAGTGAGAAGGTTAAGACTAGAGGAGCAAAGTGTGCGGGCTGGGT
TGTAGAAGGAGAGAGGTGAGGTCGGAGGGGGCAAGGCGGTGGACTGCTTTAAAGCCAATG
GTGAGGTATATTTGTTTGCAGAGGTGGATGGTCAACCACTGGAGTATTTTGAGGAGCGGG
GTGACGTGTCCTGAACGTTTTTGCGGAGCGAAGCGTGGCCTGGAATGGGAAGAGACAGGA
AGCCGGGAGGTCGGCCAGAAGACAGATGCAGCAATCCAGGCCGGATAGGATGAGTGATTA
TACTAACATGTTAGCGATTTGGATGGAGAGGATAGGGTGAATTTTAGCGAAGTTGTGAAG
GTGGGACCGACAGGATTTAGCGATGGATCAAGTATTGAAAATGGTCACCACCGGAGACTT
GAGTGCATTTAGGAATTTCAGGTGGGCTAAAGAGCCTATTTTTTTTCCTGGTTAAACCTG
TATCCCAGCATTTACGGATAGTTTCTCTTGTTACCTCTTTTCTTAGAGCTGAAAGTATAA
TCCGAGAAATGGAGCTTTTGGGAAAGATCACCGCCCTGGATCTGAACCCAGAGAGAACAG
AGCTCCTGAGCTGTTCCCGGGATAACCTGCTAAATATTATTGACCTTCGAGTCAATGCTA
TCAAACAGACCTTCAGGTAACCATGCTGTCCAATAGGTTGGAAGGCTCTTGTTTGGGGAA
TATCTATTCTGATGACGGGTGGGTTGGATGGGATCAGAATGCTAGCCAGAGTAACGTAAA
GCTGCATTTTTAGACACGACAACTGGAACCTGGAAAATTATAGCCTCAGTTTATTTGGTT
TCAGTGCTCCAGGATTCAAGTGTGGATCTGATTGGACTAGAGTTGTTTTCAGGTAAATAA
TGGTTGCTCAGACCCCTCATTCTTAGTGGAATTCTTAGGATGGAGGTCACGGGATTTCCT
TTAATTGTGACTGGCTAATTGTTACGGACTCCAACCAGAATAGTCTTTGGACCCATTAGC
GGAAAGAGTTTCATGCCTCAGCTAACCAGATTCAAGATGAGGGTGGCAGGTTACAGGGGA
GGAGGGGGGAGGTTGTATGTACTTTTCACCACTGTTAGAAGGGCTGATTATAGTCTAGTA
TTTGGCCCCACGGGTCCTGATATCTTTCCATTCTTCAACCCATTCTCTCCCCTCTCGTCT
CTCTCCGTTTCCCTCACCCCTTTCTCCCCCTCTCTTTACTCTTCGAGCAAGGCGTGCAGG
AAGCAGTCGATCTATCCCTGGCATTTATGGAGCACTTACTATGTGCAGAGCACTGTAGTG
AGCGCTCGGGAGAGTACGACAGAACAGAATCAGCAGACAGGTACCCTGCCCGTAACAAGC
TTACAGCCGGGGCGGGGAGACAGACATTTCTATGAATAAATAAGGAATTTATAGTGTATA
ATTTAAAGATAGGTACAAAAGGGCTGTGGGGCTGGGAGTGAGGAGAATATCAAGTTGTCC
AAAGGTCACACAGATCGAGGTGCATAGGTGAAGCGGAAGGGAGAGCGAGCTGGGGATGAG
AGGGCCCGGGTATGTAGCAGGATTGCTTGGGAATAAGATCACTGACTTGCTCAGCAGATA
CCATAAAGTATATTGCCGCAGGTCTTCCGGCAAACAAACCAGAGATAACCCAGAATACTA
AATAGAGAGAGCTCTGAGAACATTTATTCGTAATTACAGTAGAAGTCAGTCGATTTGTAT
TTATCGAGCTCTTACGGCGTGCAGAGCACTGTACTGAATGCTTGGGAGAGTACAACGTAA
GAGAATCAGCAGACACGTTCCCTGCCCGTAGCGAGCTCACAGACTGGAAGGGGGAGACAG
GCATCAATATAAAGTCATTTTTAGTACATAATTTAAAGATATGTACACAGGTGCAAAAAG
CAAAGATAAGTGGTGTTAGATACTACTTGCTTTATTCCTGACTTATTACCCTCTATCCTT
TTCGAGGAGGTGTCCCAAAACGCCATGTTTTTTTCAGCTTGGGGATACTTGGGGAGAATT
AAGGGAGATGGCCCTTTATGTCTCTGATACCGTCTTCCTTTCCCTGTTTCAGCCCTTTTC
CGATTCAGTCCCGAGCTGAATCTATTGCTCTACTGTCTTTCCTACTCCTTCCCAGGTAGG
AGTGTTCGGGGTAACGACGATCGATCGATCGAGTGGATTTGAGGGTTTCCTACGTGCCGG
CCACTGTGCTAAGCACCTGGGAGCGTAGACCTCAGATCATTTTCTGCGAGTTCTTTTTGT
GCTCAGTAACCGGTGGAATATGGCATTTAATGTTGAGGGCCATCTCTACCTGGTGTGCCA
AATAATTTTTAAGCGGGGAGAAATGATCCGGTGAGGTATTTGATTTTTTCCCAAAAGTAG
ACAGGAAGTAACTCAGTGGTGGTTTTCCTTATTATCGAAGTAAATAATACGGATAAGAGG
TGCCATTTGTGTTTTGTAACTCTTCCTTTCCCCCACCCGCCCCCACGGTTCTGTAGTCCC
GATGGCAGTTACGTGGCAGCCGGCTCAGCTGAGGGATCTCTCTACGTCTGGAATGTGCTC
ACTGGAAAAGTTGAAAAAGTCCTTTCAAAGTTTCACAGGTGAGAACAGAAGCCAAGAGAT
GATAAGTCTGGGACTGGAGGCGGGTGGAGATTGAAGGGACGGTGAAAGAAGAGATCTTCG
TATTTTGGTGTGGGTTATGTGTGCCCACCTTTTTGTTTTTGTGGGCGTGTGTGTGTACGT
GTATTTTTAAGCACTTGCTATCTACCAGGCTCTGTACTAAACACTGAAGCAGGTACGAGC
TAATCAAATTGGACACAGTCCGTGTCCCGCGTGGGGCTCACGGTCTTAATCCCCTTTTCA
CAGATAAGAGAACGGAGGCCCAGAGAAGTGCAGTGTATTGCCCAAGGTCACACAGCAGGT
ACTAGCAGAACCAGGATTAGACCCAAGGTCATTCTGACTACCAGGCAGGTGCTATCCAGT
AGGCCACGCTGCTTCTTCATTTGGGGCATGGGGGGGCTTGGGTCATAATAATAATAGTAA
TAATAATTATGGTATAGGTTAAGCACTTACTGTGTGCCAAGCACTGTTCTCAACACTGGG
GTAGATACAAGGTGATCAGGTTGTCCCCCGTGGGGCTCACCGCCTTCATCCCCATTTTAC
AGGTGAGGGAACTGAGGCAGAGAAGCGAAGGGTCTCGCCCAGGGTCGCACAGCAGACGAG
CGGCGGAGCCGGGGTTAGAAGCCGTGTCCCAAGCCCGGGCCCTTTCCACCAAGCCGCGCT
CGTAATGGGGAGAGGATGAGACATTGGCCAGTGCTTTGAGGGGGCTAGGCAAAAGACGGT
GAGAAAGGGGGGAAAAGAGGTCGGTGGGGGGAAGCCTGTCGGGAGAGAGGAAGAGGAAAA
ACAGTTGGTAGGGGCATCCGTCCTCCCAGGGTGGAGCCAGAGCTGTCTGCCCCAGTCCTA
AGACTTTTACCCGGCGGCTCCAATACCCCGATATCCAATTTACCCTAGTACATCCCCCAG
GCTGTCTGAGGGGACTACAGGAGAGGGAGGCCTACAGGTCCATCCATTTGAGCTCTGAAC
CCTGAGGAGGAGGAGAAGAGCCCCTCAAGGTTCTAGACAGGCCAGGGAGCCCCAGTTTGA
CCGCAGAAAAGCAGCCTGGCTCAGTGGAAACCGGCCTGGGGGTCAGAGGACCCGGGTTCT
AATCCCGGCTCTGCCACCTGTCTGCTCTGTGACTTGGCAGGTCACCGCATTTCTGTGCCT
CAGTTACCTCATCTGTAAAATGGGGGTTAAGGCTGTGAGGCTTACGTGGGATAGGGGCCG
GGTCCATCCTGATTAGGTCGTATCTACCCCGGGGCGGAACGCAGCGGCCGGCACAAAGTA
AGCCCTCAACGGATACCGCAGAAAAAGTCACCGTCAGGGGTCTGCCTCTGGCCTCTTTCC
AACCACCAGCTTAGGACCTGCATAAGCCGGGTAAAGAAAATGATCAAACAAGACCGAGGC
AGGAAGCGTAAATACTAGCTGAAAATGAGCGGGCTTCTTTAGTTAAACGGGGGTAAAAAA
AGAGGCTCGGGACCTTTTCCAGCCGTCACTCCAGTCGCTAAACAGTCTCGCGTTCAATTT
CCTGTTGTTGATTTTCCAGCTCTTCCATCAACGCAGTGGCTTGGTCACCCTCTGGTGTTC
ATGTAGTCAGTGTGGACAAAAGCAACAAAGCAGTCGTGTGGTCTGACTACTGACTTGGAA
GGCATGCGAAGAGCAAACACTTCAGGGGTCGTCAGCGAGGGAGCGCTAACCCGTGGAAGC
CCGTGGCTCGAGCTGGCCTTCGTTTGGGCTTACGGTCAAGTGCGTGGCTCTGATTTCCTG
GAGAAGAACTCGAGTGAAATGGTGGCCTTCCTTTGTACAGAATTTCAGAGAAGGAGCTCA
GAGCTCTCCTGTGGTCTGGAAGAGTAACACCGAGGTCGGGGGGAGATAACCCCTCATGCT
GCTGGCGCTTAGCAGGGGATCTGTTGGGTGTCTCTGAATTGGTGGGAGAACACTACTGGC
TTTGATTTTTGTCCATACCTCACCGGATGGAATTGACGCGAAGAGGGTCCGATCCTCCGT
CGGACGGCGGTGCCAATTATCCTAAATACGTGTGTGTTCGTTCCCCTCCGGCACTTTTCC
CCTCAGCCCTCACTTTTCCCGTCTCTGCGCGCTCTTCTTTTTCCAGGGCCTGAGGCGACG
GAAGCTTGAATTATGGTACAGGACGGTCCCTCGTGAGTCTGTAAAGTGGTGAAATAGTTG
TATACTCTCTTAGCAATTCCGACATTTCTTCACTGCGGGGTTGTTCCTGCCGTGGCATGG
GCTTGTTCAGCAGAACTGCTTTCATTTTCTCAAGCAGTCCGGACTCGAAAGCGTTTTCGT
TTTTTCACCTTTAAGGTCTCCCCTTCCATTCGGGATTCTGGCGCTTAAGAGAACCGAGTG
AAGGAGCGTTTTCATTCTGAACACGAATTTGTTACGAAATTGGAAGGTGAGGGTGTCTCC
TGCTTTCGGGCAGGGATGTGCTACTGCTGTGGTGGAGAGTGGATTGATTCCCTTACGCCC
CGTGCCGGGAGATAAACGCACCGCTCCTCACTTAAACGCACCCGTCCTGTCCCAAGGGGG
TGTGCGGTTGTGGGTGGCACGTAGGAAATGGCGGTCTCGAATGTAGGGAGCGGGTGCTGA
CGGTTCCAGGCCACCTGCCCCCTTTGCTAAGCACACATGCAATACCGCCTTGATGCTCGA
TGCCGGGAACACCCAACTTCGAGACATAGGAACCTCGGGAACTTCTCCATCCTCGGGTAA
CAAAACGGTAATGAGGCTGGAGGGTATAAGTCTGTGGGCTTTTGAACGTTTATCCAAACT
ACCTGTTTTTTCTTTACGAGCCAGGGGGCTTCAAAGCCCTTCTCTTCCACCTCCGTCCCT
CTCCTCACCACACACGCAAGCACCCACACGCCCCCCCCCCCCCCCCCGCCATCTTTTATC
ACTTCTTTTAATTTGCACTTTATTTTGCTTCCTTCCTGAATTTTTTTTCTGTGGAATTTG
GGAAATGTGTGTGTTAAAGCTAGATGAAAGGCAAATAATGCTTGTTTCTTTTCCTTAGTC
AAGGTATCTCTCCTCCCACCTACCTTCCCCAGCTACCCCCCCTTTATTTGTTTTTTTTCC
ACCTGATTGTCCAGATGACCTTTGCTGAGGGAAGTTAAAATACACGGGCCAGGGCAAATC
TTTTATTTATTATATTAAGCTGCCAACCAGAACTTGATTGTAAATAAACTTATCCTCTGC
TTTTAACGTACATATCCTTGTTTGTGTTTGGAGAAGCTCTCCTCTCCCCCCCATTAAAGG
AAAGGGAGTTTGTCTCCTCCCAATTTACTTTCCCACCACTGCTGGGTAAGGGAGATTTCA
TGTTATCTCTCTAAAGTATTCGAATTTTCAACAGTCACGGGTGATGAGAGGCTGCAGTTG
CATCCCATCTATAAATCTGGGCTCGAGAGAGAGAAAGTTTGCAATTAGATTTTCAGCTGT
AACGCTCCAAGAAGCAGCACTGTGGCTTGGTCTTTCTTCTCTTGGCGCTATCTCCTTGCC
ATCCCTCAGGTTGAAATGGCGTGGTTACTATCTGTTCACATGAAGAGGTGTATTTTCATG
GAACCCAAGGACTCCTTTAGTGGGAGTATATTCCAGGAAAGTTGTGTTGCATTTTACATT
ACATCGTTGATGAATTAGAGCTCGTTTTTCCGTCTGCACTGCAAAATTTCGGTGTAGTCG
CTTGTCAGATTGCCCCGCTGCATTCTTAGTGAAATAGCGTTCTCTGTGCTGATTTCCCTT
GCCAATCACAGTTTTGGTATCCGTGCACCCTTTTTCTTGATACCATTTTTATTTCCGTGG
TTTTCCGGAATAACACTGCCTGTACTTTCAATCACCTCCCTTGGCTATCCATGTATAGGT
TATTGATTATCGTCTAAGTAGGGGTCATAACTGTAACTGATTAAATTCCCCTTTTGCCGG
TGAATTCCTGGTATCAAAGAATATAAAACAATCGCAGTCGAATTCCTTGAATAGCACTAA
AACCATCGGGCCGGTAATGAAAAAAGCACTATTATCCCAGTCTCGAAATTAGCAACTGAC
TTGAAATAGGCTTAGACTGTTTTTTTGCCGGGGGGGGGGGGGGGGGGTTGTTTTTTGTTA
AATATAACCTAATGTTTAATGCAGTGATTTTAGCATAGCAGGAGGCAGGAACTCTCACTC
CCCTCGATCCTTCTGACCTAAGTAAGAAGTGCCCACTCCTAACTCCCCGTACCTCACATC
TCAAATTGAGATGATTTCTCCGTGGGTAGGAGTATACTTAGAAAACCTGGACTACGCAAA
AAGACACACAGGATACCCGTCCGTTATGTGAATTCCCTACTGGGGGAGGGTGATCTCCTG
ACGTCGATACAACCTGCCCCCAGTGTAGGTTATGATCCCATGACTGGAGAGATAAAAAAT
TTGCTCCAAATGCCTTTNNNNNNNNNNGGGTGGGGGGGGGGTTGTTTGTCTTTCCATAAC
AACCCTTCTTGAGTTTCACCTGGAGTGACAGAATAACCCTTACCTAGTCCCTTCGACTGG
CGTGGGAAACCTGTGATTCGTTTGTTTTACCCCTTTTAGCAAAACGCTTTTGATGCATAA
CGACGACGCCAGTACGCGTTCCTTTTGGCGTTAGTGTTTTTGTTTCCTACTCAGGGATAA
CATAATTTTCCTAAGAGAAATTAAGTGGTTTGAGAAAGTTGTCTATTCGCGTTAAGTCCA
AAACTTCCCTTCGGATTGTAGTTTTAGGCTCAATGAATCCGAGAAACAGTAAACTCCTGA
TCACCCATTTACCTCTGGCAGAATCTGAGCGTACAAGGCCTTACTCCATTCTTTCGGACA
GTATGCTCACATCAGGGATGGTTTCACCTGAGAAGCAGCGTGACTTAGTGGAAAGAGTGT
GGGCGTGGAAGTCAGAGGACAGGGGTTGTCATCCCAGCTCCGCCACTCTCCTGCTGTGTG
ACCTTGGGCAAGTCACTCAACTACTCCACACTTCACTTCCCTCATCCGCAAATTGGGATT
CAATCGCTGTTCTCCCTCCTGCTCAGACTAGGAGCCCCATTTGGGACCTGATTATCTTGT
ATGTGTCCCAGCACTTAGTACAGGGTTTAGCATAGAGTAAATCCTCAACAAATAGCACAA
TCATCA
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1555, 9411..9504, 13738..13843, 13996..14069, 14157..14408, 15412..15477, 29638..29724, 30603..30659, 30885..30932, 32144..32246, 37140..37245, 37902..37972, 39002..39073, 42303..42423, 42747..42852, 44326..44475, 44644..44691, 46316..46417, 47959..50545
1441..1555, 9411..9504, 13738..13843, 13996..14069, 14157..14408, 15412..15477, 29638..29724, 30603..30659, 30885..30932, 32144..32246, 37140..37245, 37902..37972, 39002..39073, 42303..42423, 42747..42852, 44326..44475, 44644..44691, 46316..46417, 47959..48052
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved