Ornithorhynchus_anatinus Locus Mono:SNORA25
snOPY snoRNA Orthological Gene Database
Ornithorhynchus_anatinus Mono:SNORA25
Ornithorhynchus_anatinus
Mono:SNORA25
Contig181828
SNORA25
14..142
843
TTCACTTAGGAAGAGGTCATTTCAAAGAGGGTTCGTATGGCTGTAAAACCAGCAGCCCT
TAACGCGATGACCTAATAGGAACTCTCTACAGGTTACCACTCTCACTAAGTAGTGCACTG
TGGTTTCCTCCTGAGACACAGTGTCCTGTCCCATGCTGCAGTTACTAATTTCTTTGTTCT
TTTTCAGGTCATCAGGGCTGGTGCGTTTGTAGAGAGCATCCCAAACTCTTCGATTAATTA
ATAAAATTTATTGTGTTGGTTAAAATTTTAGTATGAGTTTTTGGCGCGTAGTTTCTCGAG
AGTTCTCTGTAAACAGAAAGACAATCAGTCAGCATAGAAGATTCTCCCCTTGCCTTTCTC
CTCCAAAGCTAAATGTTGCCCATTCTCATTCCTTACCCTGTGAAATTCTTTGGCTCGGTC
CCTGGTTTTAGAAGTCACTTCCTTTCTTGCCTTCTCATCCCTCTGGTGCCTGTAAAAGGA
TGATTACAAACGCTACTGTAAATTGCCAAGACAGGCCGGGTCCTTCCTCCTTCGGTCACC
CAACCTACCTTAGAGGATGGTGGTGTAGGAGTGCTTCGGGGGCCGTCTTCTCTGGGGAAC
ATACTTTAACTTCACTCACTTTCTGTAATGCTGGACCTGGAGGTAAAACGTCAAAATGGA
AAATTATTTTGGTGGTGGGGGTGAATGGCAAGTGGTCCCGCTAACCTCATACTGGCTTCA
TAAAAACACACCTGAGAGCCTCCTCTGGGAAGAAAGGGTTTCAGTGTTCTCGCTGGGACT
TCCTGGGGTCAAATTGAAATTCAGAGAGATTCAGAAGTGTTTTTCACTTCCAAAAAACGG
AAGA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved