Ornithorhynchus_anatinus Locus RANBP1
snOPY snoRNA Orthological Gene Database
Ornithorhynchus_anatinus RANBP1
Ornithorhynchus_anatinus
RANBP1
Contig17918
SNORA77
4227..4307
6978
AGTGCTGTGCTAAGCACCCGGACAATTCCTTTACAGTGGAATTGATAGATTCTCTTCTC
CCACCACCCCCCACCGTCTCCCTTGCACTTCCAGCCTTTATTCACTGCTTCCTTAGCCCC
ACGGCACTTAGGTTGACGTGAGTAATTTACTTCTATTAAGGTTTTATTTTCCCCTCTGGA
TTCCAAGCTCGTGGTGGGCAGGGAATGTGTCTAGCAATTACATGGTACTATCCACATGCT
TAGGGTAGTCGTCCATACACGGGCATTCAGTAAATATGACCGAATGGTAGGTACAGTCCC
TGTCCTTGAGGACCTTACAGTCTCCAGTGCAAAATCCCTTCCTGATAGGGGCCGGCGTAC
GGGAGTGCTCTGGGCCTGAGAGTGGGGTGAGGATGCAAGTGCTTAGGGATCGCAGGTAAT
TAATTAATTAATGTTGGTATTTGTTAAGCGCTTACTATGTGCCGAGCACTGTTCTAAGCG
CTGGGGTAGACATAGGGGAATCAGGTTGTCCCACGTGGGGCTCACAGTCTTAATCCCCAT
TTTACAGATGAGGGAACTGAGGCACGGAGAAGTTAAGTGACTTGCCCACAGTCACACAGC
CGACAAGTGGCAGAGCTGGGATTCGAACTCATGAGCCCTGACTCCAAAGCCCGTGCTCTT
TCCACTGAGCCACGCTGCTTCTCCAACCGCGCCATTGGGGCAGAACGGAGGGAGCATGGA
GTGGGGAAAGTTAGGCTTTAGGGAAGGATTCCTGGAGGAGATTTGACTTGGGGAGAGCGG
TGGTCTGTCCGATGTGAAGGGGGTAGGAGGTCCAGGCCAGGCGACGGGGTGAGGCAGGCG
CAGTAGGGAAGGGGTCAGAGGACGGGGTGTAGGCTTGGGCTGCAGTGGGAGGTGAGTGAG
ATCAGGTAGGAGGGGGAGAACTGGTTGTGGGCAGTTACCTCGTACTCCTTTTGGGCTCTC
GGAGCAGCTCTGAGAAAAGGCTCAATTCCTCCGGATCCTCTTCCCTCTCCCCACAGGAAG
CAACGGAGGAGCACGACACCTCCACCGAAAATGCAGACGATTCCAACCACGACCCCCAGT
TTGAGCCCATAGTTTCTCTTCCGGAGCAGGAGATCAAGACGCTCGAAGAGGATGAGGAGG
AACTCTTTAAGATGTAAGCGGCTGGTCCCTGGCGAATGGGGGCTCCCTGGGTGGGCCTCG
GAGCCAGGGGCTCTGGGTGCTCTGGGTCCACGGTTTCCGCACGTCCCGAGGCAGGGGCTG
AAATCAGAGCTGAGGGGGCGGCAGTCAGGCCTGGTGCTTCACAGGGTTGGAGAAGCGGGA
GACCCGAGCCCCAACGGGCCGCCTCCCCTGGTTACCTCCCGAGGGAGCCTTTGAGGAGAG
CCCACCGGAGTCGGTGCCTCTTTGGGGGCATTGAGGTCGAAGGGCGTCAGCCACGCTCCT
TGTTTCTTCCTCTACTCCACCGGCCACGGGTCCCGAGGGAGCGGAGATGTCTGCCTTGCC
AGTGGGGGAGGAGGAGAGCCGCCTGGGTGGATTTGATGCTCAGGGCTCCCCTGGGGGAGG
GCAGACCGTTGGGCACCATGTCAGTGTCAGTCGGTGAATCTCCCAGCCAGCCCCCTTGCT
TCGGATCCCGTTCCGAGGCTCCTCAGAAGTAGCGCACACCTTCCTCTGGTGTCCGGACGG
TCCTCTGCCCTAGGAGGAGCCCCGTGCCAGCCCCTGCTCTACCCTACCTAGAAGGCACAG
GGCTAGGCTCCACACACGGCTCCCTCGGTTCCCCCCAGCGGCGCTACCCCCATTCCGGCC
CTTTGCCCTGGTGGGATGGGGGTCCCAGGGCTCTTCTCTCCTTAGCCGGTCCCCTCCGGC
TTCTTTGCCGGGGACCCTGTCAACTCTCCTCTCTGCCCTCTTGACGGCAGCGATTCGCAT
GGGCCTCTCCCCTCTCCCTCTCTGGCCCTGCCGTCCGGTCAGGCTTGCAGCGTATAAAAG
TGCCAGTGGCGGGGATGCGTGGCCAGTGCTTTGGATCCCTCGCTGCTGGCGTGGGCCCCT
GGCGACGCTCCGGGGCCCCGATTGGCCGCGGGAATAATTCGGGCCGGGAGGGGTGGGAAG
ATCGGGTGGGCAGAGGGGCCCCCGAGTCCGGTGTGCCAAAGCGGGCCCCCGTCTCTCCTC
AAGGCGAGCCAAGCTCTTCCGGTTCGCGTCGGAGAGCGAGCTCCCGGAGTGGAAGGAGCG
AGGAACTGGGGACGTGAAGCTGCTGCGGCACAAGGAGAAGGGAACCATCCGCCTCCTGAT
GCGGCGGGACAAGACTCTCAAGATCTGCGCCAATCACTACAGTATGTGGCCCCCCGCCTC
CCTGCCCGCCCTCCCGCAGCCAGCTGCCACAGCATCTGAAAACAAGTGTTAGAGTCAGGG
TGGCTGCGGGCCCTCCTGCCAGCGGGACCGAGGCCGCCTGGCTTAGGCGAGGATGTGGCA
CGCACCCTTTCCCGTTTCTGTGCCCCGGGGAGGCCGGGCAGCCTCGCGGCCCCCGGGCAC
CGGCAGCTGAGAAAGCAGTTAATTTATTATTACGGTGGCATTTCTGCAGCACTCAAGTGC
CAAGCACCGTTCTAAGCATTTGAGGTAGATATAAGGAAGTCAGGTTGAACACAATCCCTG
TCCTTGGGGCTCACAGTCTTAATCCCCGTTTGACAGATGAGGTGACTGAGTCAGAGAGAA
GTCAAGTGACTCACCCGAGGTCACACATCAGAAAGGTGGCAGAACCGGGGTGAGAACCCA
CATCCTCTGACTCCCAGGCCCGGGCTCTTGCCACTAGGCCGGGCTGCTTCCTAGTTGGAG
AGCCTCGGGAGCCAGCAGGCGGCTTGTTCGGTGGCGTCTTGGAAAGTTGGCACCTGAGCC
AGCCTGCTCGGGTGGAAGCCCATTCCACGGGTTCCGAACGTGTCCCCAGGTGCGGCGTCC
TCCCTGTCTCTGCCCTGCTGGGGACATTTGTCCCTGGGGCTCCGTGCCCACCCTCCACCT
CTCCTTAGGGTCGGGCGCAAGCCACCCCGAGTGGGTAGGTGGTATTGGGGGGTGGGGGGG
AGTGGACATCCCTTGTGGTTTGTGGGGTTGACCTGGCCATGAGAACGTGACCCCGAGTGT
CGTGTCTGTTGGGAGGGAGAGGGGCATCAAGTCCGGCGTCCTGGTGTGGCTTCTCCGTTC
CCCCAAGGGGACCGGAGGGAGCCGCCCGTCCCTGAGACGTGGGATGTGGCCCGACTGGGT
TCCCCGCCCCCGCCACCCTTGGGGGTTGAGCCGGTGGTTCCGCTGGGCCCGACCGGGAAC
CGCGGTCTCTCTTGCAGTCACCCCTCTGATGGACCTGAAGCCCAATGCCGGCAGCGACCG
GGCCTGGGTCTGGAACACACACGCGGACTTCGCCGACGAGAGCCCCAAGCCCGAACTCTT
GGCCATCCGGTTTTTAAATGCAGAAAGTAAGTGAGGGCGCTCGGGCGGGCGGGCGGGCGC
CAGCCGATTCGTTCCAGGGCCTCTGCCGGGGCCGGAGGAGCCGAGGGGCGCGGCCGGCAC
GGCCAGGGACGTGCCCTCGGTGGCGTGGGTCTTGGGGTCGATCGATCGATGGTATTTATT
GGGTGCTCGCTCTGCGTGGAGCACCGTGCCGAGAGCTTGGGAGAGTGCAGTATAACGGAG
TCGGTAGACACGTTCCCTGTCGCGACCAGATGATGGTCTAGAGGGTTTGGAGGCGGCCTC
CGGGCAGGGACCTTGGGTCTGCAGCCCAGCCGGCATCGGCGGGCCCCGGGGTTCAGACCT
GTGCTCTCGTCGGGTGGTGTGGCTCTCGTCGGCTGGGTCCACGGAGCCCGGAGTCCCGAG
GCGGCCGCCGGTCCCTCCAGAGTGCCGACAGCCCCGATGATCCTCATGCGTCGACGGCCC
GGACGTCCGTACCCCCGGCCACCGCCCCTTCGGGACCCGGGGGCTGTGTACGTCGGGGTC
AGTCCCGGTGGCTCGGCTCGGCGTCCCGCCGCAGAGACGACGAGCCTTCCGGCTGCGGGC
GTGGGTGGGATCCTCCCTCGGCTTGGCCCGTGACCCTCGCTCGCAGCCACGGTCGCCACC
GAGCCTACTCTTCTTTCCCCTCTGCCGACAGACGCGCAGAAATTCAAGGTCAAGTTCGAA
GAATGCCGGAGCGAAATCGAGGAAAAAGAAAAGAAAGGTAGGGCCTCGGAGGCCGCGCCC
CTGCTTCCGTTCCCGCTCGGCCTTCACGCAGGCTCACTCTGCGCCTGGCCGCGCTCCTCG
GCCTTGGTGCTTTTTCCGCCTGCCAGAGAAACTCCCCGGGCCACTGCTGGCACCTCTGGT
GGCGGGGGGGTGGCCGTGGCGGCCGGTGGGGTCACATCCGCCGCCTCGGCCGGTCTGCGG
GGCGGCGGCTCCCGGGGGTCGGCCGCCTTGACGTCCTGCCTTCTGGGGACGGGCGTGGGA
TGCTGACGGGGTGCGGGCGGCCCAGAGAGAAGGACTGGACCGTGCCTCGGGGCCGGGAGG
GGTGGCGAGGGGCCGGGGGGAGGGGACGTGCCTGGGGCGATTGGCCAGGTCCGGGCTTGG
CTGCAGTGGACCGAGAGGGAAGCGCGACCGTATCCCGCCGCACACCTCCTGCTCCCACCG
CCACTGTTCGGCCCGGGTCCTCGGGTGCGTCCCCAGCAAGCCCGGCCTGGGCCCGCTCCG
GGTCCCGTCAACTAACCTCGGTGTTTCCCGGCAGGCTCGGGCAAGAGCGACAGCCCCGAC
GACGTGGCCGAGAAACTGGAGGAGCTCTCTGTCAAGGAAGAGAGCAAAGCAGAGGCTGAG
GAGGAGGAAGGGAAGGAGGAGGAGAAAAGCCAGGAGAAAAACTGAAGAGGTGGGATAAGT
CATCTTGGGCTGCGCAGTCTTTCCTCACCTTATGTTTTTGTTCTTTTTATTTTCCTCCCT
CGGGATCTTGGATTTTTTTTTTTTAAATACACAAGGGACTTTATACAAAGAATGAATTCC
TACCATGTTTTTTCTAAGCTTTTGCCCTTTGGAAGATGTCTTCAGAAAATCCATATTCCC
AGTCATGAAAATGTACTGCGCTCACTTTCTTTTCCACAGTGGAAACAGTTATTTATAGCA
TCCAAAAGAGCCAATAAAACCAATTTGAGCAGCGTGGCCGTGGCGGGCCTGAGTTGTGTG
AGCCGTGGCCCTCGGGACCCCGGCCCACGGGACCCCGGCCGCCCGCACCGGGCTAGGTCC
TCCAACGGGGGCGGATGGGAGGACGGGGACGGTTCCTTTCAGGGATCCCTCGAGATCTGG
GAGCGACGAGGGGCACGGGTGGACACGCGGTGACCGGCCTGCCCCACCGCTCCGGGAATG
CCGGTTGGCCCCGCCGCCGTTTCCCAGGTCCAGCCCCTCCCATCCGCGGCCCAGGAGCCG
GGGGGTGTCCGGGAGTTGCCGGGGGAGCCGGCGCCGGGATCCCGCTTGAGGCCAGCGCCC
CACCCCTCCCCGCATTGTCGCCACCAGAAAGAGGGCCCGGGAGGGGTGGGGTCAGGGTCA
CTCGGTGGCGAGCGGCCCGCGCCGCCCCCTCGGGAGGATGTCCCCGTATACGGCACCGAG
CCCGTCCGATGCCATTTGAAGAGCAGCCGGCTTCGGCGGCGCCTGCCCCAACTGCCCCCT
GAGACGTGGAGCACCCCCAGCGGAGCACCCTACAGGCCCCGAGCGGGACGCCCACACCCA
GGCGGGCAGAGCGGCGGAAAAACCCCGGCCCCGGTCGGGTGCTTGGACCGGCGGACGGCC
TCGTTTCCACCCTGTGACCCCCCCGCCCCCGCCAGACCTGGCGGAGGTGCCGAGGAGACC
CTCGAGGCTACGGCGGCTCGGCTCCCGGGGGAGCAGGGGCCGTTAAAGAGTGATGAGGAA
AGCCCGGCGGCCCACCGTCCCCGGTGCCCGTGCTCTCCGGTGGAAACCCGTGCCTCGGTT
TCGGCAGCTGCCGCCCCGGCTGGCCCCGACCCCCGACGACGGGATCCTAGGCAAGCGCGG
CCACCTCCCCCCTCCGGCCACCCCTCGGGCCGGGGCCTCCGTCCGGGGTCTCTCTCCGCT
GGATGCCCCCCGTTTCCAAAGGGAGAGGGAACTTGCTCAGAACCAAACCGAAGACTTCTT
TCTTCAACCGTTCGACCGTTTTGACTTGTGTTCTGTGTGCGTGTGTGTGGGCGAGTGTGC
ATGTGTGCGTGCGCGCGCGCGTTGGGTCTTGTGATGCTCTGTGAGTGACCGGGCCGGGGT
CCCAGGGTCGGAGAATGGTGGGTGATAGGGGGAGGGGCGGGGGGTGGCGGGGGGGTGGGG
TCGTGGGTCCTGGGCCGGGCGCGGCGCTCACACAGATGCGGGTCGGCCGGAAGGCGCCGT
CACACGTAAACCGGCGGGACGAGACGCGGGAGCGGGATCCTCGTATCTTGCCGTCCGACG
CCTCGCGCTCCCACGCGTTCCCCTGCGGCCACGGACCCGCCGGGTGGGGGGTGGGGGGAG
GGCTGGAGGGGGCTCCTGTTTCCATGCATTGTTTCCAGTGAAGTGTGCGAAAAGGCTTCC
CCCCCTTCCTGAAGAGTGAACTTCTGTTGTCGCTTCCTGTAACTTTGTGTTCTGAGAGAG
AATAAATGCTACCATGTGGAAACTCGGTCCTTCCGTCTCCAGCTTGTCTGAGAAACTAGC
TTCACGGTCCCCAGCCCCCCGGCTCCCCCGCCCCGGGGCTTCCGAGCTTCCACGGGCCAG
GGAGCTTCGGGATGGGGGCGGTTGCGGCGCCTCCCGTTCGGTGGTATTTGTCAAGTGCTT
GCTCTGGGCCGGGCATTAGAATAAGCGCTGGGGTAGTCGGGTTGGACGCAATCCCTCTCT
CGCATGGGGCTCACGGTCTCAGTCCTCATTTTACAGATGAGGTCCCTGAGGCCCAGGAAA
GGGCGGTGACTTGCCCAAGTTCACCCGGCTGACAAACGGAGCTGTGGAAAGAACCCGTGA
CCTGACTCCCAGACCCGGG
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1152, 2163..2320, 3317..3445, 4111..4176, 4714..4797, 5950..5978
1001..1152, 2163..2320, 3317..3445, 4111..4176, 4714..4797, 5950..5978
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved