Ornithorhynchus_anatinus Locus Mono:SCARNA17
snOPY snoRNA Orthological Gene Database
Ornithorhynchus_anatinus Mono:SCARNA17
Ornithorhynchus_anatinus
Mono:SCARNA17
Contig177900
SCARNA17
634..771
859
GTTGCTGTGTGTTGCAGCTGTGGCAGTTGCTGCTGTTCTTGCAACGGTTGCTGCTTTCC
TGCTGGTCCTGGTGAAGCCCGAAGGCCGCGCGCGCCGCCTCGATCCCGTGACGGGGCGGA
GCGCGCGCTGCGTCTTCACCTTTCACCTACTTTCCCTCCGCCGGCCCCGCTGCTCAACCG
CAACCCCACATTCGTCACGCTCGGCCCTCCGACCCTCGAAGATTTAGAAGCGGGGGGTAG
AAAAAAAACAACCCCCAAACAACTTTCGGTTGACGTGCTCCGCTCCACGTTTCAACTTTC
TCTCCATCTTTTTTTTTTTTAAAAAAAAAACCTCTCTCAAACTAAGGCTGGCGGCGGGGC
GGTTGGTCCCCTCTTCATGCCATCTGGCTGGGAATTTTTTCTGTCTGGTGCTCCTTCGGG
GTCCCCAACTATGCTAAGTCAGTCGGTTTTGGCGAATCTGCGATAGGAGGAAATGGGATG
AATGATGGGCGGGGACGCGCGAGCTCGGGGACGCGCCGGGCGGGGGGGCGGGGACGCGCG
CGCCCGGGGACGCGCGCGGGGGCGGGGTGAAGCCGGGCAGAAGTGGGCTTGAAGGACAGG
CTTGGGCAGACATGGGGGAGGAGTGGGCAAGGGCTTGGCAGGGCAGTTGATCGACCCCAC
ATGATCCCATTATTTTCCTTATATGATCAGGCTTCACGACAAGGGCAGCCCTTGTTCGAA
GCCTGAGGTGATTCTTTTTTGAGAGCTGGCGATGGGGCTTAGGGTTCAGCGTGGGGCCTA
GCGCAGCCTAGGACTGGCAGGCTTTTGAGGGGCCTGTCTACTGTAGTGGAGAGTAGGGTG
GCCATTTTGAGGGCTTGGGG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved