Ornithorhynchus_anatinus Locus Mono:SNORA30
snOPY snoRNA Orthological Gene Database
Ornithorhynchus_anatinus Mono:SNORA30
Ornithorhynchus_anatinus
Mono:SNORA30
Contig172642
SNORA30
498..626
931
TGCCTCCAGTTTCCCACATCTGCCAACGTGGGGATTTCAGTGCTCGCTCTCCCTTCCCA
TTTAGACTGAGCTGCATGTGCCACAGGGACTGCGTGTGATCTGATTAACTTGTGTCTACC
CCAGCGCTTAGTAAAGTGCTCGGCCTCTAGTACGTGCTTAACAAATTCCACAGTTGTTAT
TCTATGTGTCCGTATTTATAGGCGGAAATTATGCTGTGACTGCGTCCTTGAGCTGATTTG
TTCAAACAACGAAACTTCATTTTGAAACTCTTATTGAATTTTATAATGTCTCTCTCTCTC
GCTCTCTCTCTCTCCCTGTCCCCTCCCAAATCAGCATGCCAGATAGTACTGATGGATCCG
GCTTGAGGGGGATGGTGGGGGTCCGAGGCAAGCGGGAGTTGGAGGGAAGTGGGGAAGAGG
AGCGGCATTTGGGGTCGGGGGTCACGCTAGAGGAGTGGTGGCCGGGGGCGGGGAAGGGGA
GGCGGTACTCCCAGGGACCCAGCACTTTCACAGGTCCGCCTCTGGTCGTGGGGTCGGGAT
TTGGTAGCTGGTGCTGAGAGCAAAACCCTCGGGCACTTCCTCGCCCTGGCCTTGGGCCGG
TGGCAAGAGTGATCGAAGGGGACAGAGGCCCAAGAGGAGAGCGGGCTTCTCGCCGTCGTC
GTCGTCAGTATCGCAGAACCCTCAGCTAAGCACTCGGGAGAGTCAGCACAACAACTCCCC
GCCGTTCCTTTTTCTCCCTCCTTCAGGGCCGGCCCCCGGCCCCCGGCCCCCAGTGTAACA
AGCGGCCGTGGCCTCGCGACGAAGAGGACAAGGAGTTTTCGGCCAACGAGGACGAAGGTC
AGCCCCTCGGGACTAGCTTCCCCGAGCCCTTTCCCCGCGGCGCCGGCCGCCCGGGCCCCT
CCGCTCACGTAGCCCTGCCTCCCCTCTCCCGC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved