Ornithorhynchus_anatinus Locus Mono:SNORA74
snOPY snoRNA Orthological Gene Database
Ornithorhynchus_anatinus Mono:SNORA74
Ornithorhynchus_anatinus
Mono:SNORA74
Contig170277
SNORA74
450..652
872
TAGATGAAGGACCATTTAGGTCGACCCCGTCCCTGGTCCCGTGCTGCAACCGACGCTAG
AGAAGCGGCGTGGCTCAGTGGAAAGAGCATGGGCTAGGGAGTCCGAGGTCATGGGTTCGA
ATCCCAGCTCCGCCACTCGTCAGCTGTGTGACTGTGGGCAAGTCACTTCTGGGCCTCAGT
TGTCTGTAAAATGGGGATGAAGACTGAGCCTCACGAGGGACAACTCCAGCGCTTAGTACA
GTGCTGTGCACATTGTAACTTTGTGCTTAACAAATGGCAATATTATTATTAGGAGGAAAG
GGAAGGCAGAGCCCAGACTCCCAGGTCCAAATTGCGCTGGGCCGCACCGCCTCCCGGTAG
GAGGGAAGACGGGGATCGAACCCCCGGCCCAGAGAGGCGGAGCGTCTTGCCCGGAGTCAC
ACAGCCGGGCAGAGGGGTTAGCGCCGTGGATCCAGCGGCTGTCAGCTGTCCAGGTGGGCG
CGGTACCTGCGATAGCGTTACACCGCTGGGACATCAGGGCGCCGTCCAGACGACCCTCCG
CCTCCGCCGCTGTTTTAGCGTCGGGTCCGGCTGGGCCCGGGCGGCGCTTTGCGTTCCCGA
GAGTGGACGGACTCTTGCCCCGTAGAGTCGGCCCTAGATTGGATGCAAACATCGGATCCG
TCCGGCGTCCCCCGGGGGGGGGGTTCGGGGGTTCACCGCCCTGACTTGACCTGTGCTTTG
TCTTCGCAGCCTGCGCGTTGAGCGCCGAAGGATGGGGAGCCCGATGCTGAGCGTCCACTG
GGACACCCCCCCGGTGGGTGACACGTTGGGGTGACAGTTGGGGGAGGGAAGACCAAACGC
AGCCACGAGGGCTGGGGAAAAGAAGCATGGGGA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved