Ornithorhynchus_anatinus Locus Mono:SNORA57
snOPY snoRNA Orthological Gene Database
Ornithorhynchus_anatinus Mono:SNORA57
Ornithorhynchus_anatinus
Mono:SNORA57
Contig168568
SNORA57
382..530
904
CCTCCCCTTACATAGAGACGAACGGAACCAATCAGAGCCTCGGGAAGGGGGGCGAGAAA
CAAATGAAAAAAAGCCCCTCTCGGACCGGCGGGCGGAGGGGACCAATCAGAGTCATGCAG
TTGGGGCAACGGGCGGCTATAGGAAAGCCGAACATCCCGCCCTAGGGAGGGATGGACCAA
TCAGAGAGGGGGGGCGGGGAATAAGACCAATCAGAGCGGAGGGCGGAGCCTAGGACCAAT
CAGAGCGGGGGGCGGGGCCTGGGACCACTATATAAGGTGTCGTTGCGGCTACACTCCGTC
TTTTCCCCTCCGTGCGCGTCGGAGGGGGCATGTGCGGGCGGTGAGTGACGGGCGAGGCAG
GGCTGCGGGGGTGTTTGTCGATCCTCTATTTCTTGGCGGGGTCCGGGTGCGCAGTCCCGC
TCCCTGTGATGTTCGGAGGTAGAGGGAAGGGGCTCCGGCCTCCCCGGCGTTATGTCTTCG
GTCCCGGTGGCTGCCCGTCCGCCGGTTCTATCCTCACTCGCCGGGACAAGCGGCTCCCCG
GGTCTTGGCGCGGGGCAGACCGCCTTTCTCCCGGCCCTCACGCCTTCTTCTTATCTTTGC
AGGCTGCCGGGAGGCCGAAGAGTTGGACCTAGGCGACAGCCCGCACTCTTCCCGTCCCAT
CTCAAATAAAATATCAAAATATCCACGTTCTGGACTTTTCTTGTGTCTTTTCTTTAGGGG
TCGGGTTTGGGGGGGGGGGGGAGATGGAAGAGGGAGCGCGGTCTAGTGGAAAGAGCACGG
GCCCGCGCTGCCAGTTGTGACGTTGGGCCAGTTCGCTCCTGAGCCTCGGGTTTCCTGCGC
TGTAAAATCGGGATTAAATACATTCAGTCGCGTTCATCGAGCTCTTCATGTGTGCAGAAC
ACCGG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved