Ornithorhynchus_anatinus Locus Poly:SNORD33
snOPY snoRNA Orthological Gene Database
Ornithorhynchus_anatinus Poly:SNORD33
Ornithorhynchus_anatinus
Poly:SNORD33
Contig153541
SNORD33, SNORD33, SNORD34
1001..1084, 1321..1403, 1599..1673
2084
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAGCTGAGCGAT
TGAATGGGTAGGGCCCGCCTGGCTGCCGATGACTGACTGAACAGATGCTCCTGAGTAAGT
GTTGCTGTGCCCTGGACCCCCTGTAGCAGTCCCCCAACCCCCGGGCCAGTGATGAGGAAC
ATTCACCATCTTTCGTTCGAGTCTCGCGACTGTGAGACCAACTCCATGCACCGCTCTGAG
GCCTCTCCTCTGCTCCCTAAATGTCTCCAGGCAGAAGTCCCTGGGTCTTGAGGGGGTGGG
GGCTGAGGGGCAGGGGCCAGAAGGACACTAAATAAGGTCAGCCATCCTTGTCTCCTAGGG
AGGTACCTGGTGTTCCTGAGGAACCGGATGGATATCATCCCGTCCAGAGGGCTGGACTGC
TCTCGAACCCTGACCTGCATCTTCTGACAGATGGTGAGAAGGGGTCTGGGGTGGGGGAAC
ATGGGTCTGTGATGATGACTTTCACTTTATTTCGAGTCTCACGACCTTGAGATCACAGCT
CCATGCACTACCATCTGAGACCCCTGAGAGGGTGGGGTTGGGTTCTGGGGTGGGAGGTGC
TGGTCATCTGACCTCCATCTTTTTTCCTTAGGGATGCTGTCCCACAAGATCAAATGGGGC
CAGGTGGCCCTGGAGAGACTTGAGGTGTTGGAGATTCCCCTCTGCCCTACAAAAAGGTAC
CAGACCCTTATTGTCCCTTCCCTCTGTACCCCCTTCCCCAAGGGCCGATGATGCTGTTCA
ATTACCTACATTGTTTGATTTTCCTGTGAGAAAACAGCTATATCTGAGGCCCCTAGGGAT
ACCAGCATCCATTGATGTCCCTGTCCTTTTCTGGCTCCCCTGCACCACCCCCCTGCCAAA
AAGGGTGGGGTGGAGGATCACTTGTCTTTTTAGGAGAGAATGACTAACTGGCGTTAAGTA
CTCACTCCGTCAAAACACTTAAATCCCCATTTTTCATGGAAAATGAGCCATAGAAGTTAG
CCGATCTCTTCCTCAGCAGACTGCTGATCTTTGTGACTCCCAGGTTACTGTTGACTCCCA
TAAACCACAATGTTCCACCGATACACGCTTAAGGAAACAAAGACGATAAGCACCTTCCTT
GGCTGAGGTTGCTCAGCCAACAGAGCCAGAAATAGAACCCTGGTACTGATTCCTAGGCTT
GGGTTCTTTCTACTAAGCCACCCTGCTTCCGTTATTAGTATTCTG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved