Ornithorhynchus_anatinus Locus Mono:SNORA17
snOPY snoRNA Orthological Gene Database
Ornithorhynchus_anatinus Mono:SNORA17
Ornithorhynchus_anatinus
Mono:SNORA17
Contig146041
SNORA17
383..515
869
AAAACGTTTCTAATTAAAAAAATGGGAGGATGCAAGGAGATAACTCGTGTGAAAACATA
TTTCAATAAAGGGGCAAGAAGAATTCCAAGGAGAAAGCCTTTGCCTCTCTCATTGGGGAA
AAGTTAGATTTGAATCATGATGAGTCCCCGTAGGGCATAAGCTTCGCGACGTCACATTTT
CACAGACTACATTTGTTTTGAAAATCAACTTAATGTCCGCTCTTGCATTGGTGCCCTGAG
ATCTTCCTGCCCTCTGAATTCACACTACACCAGCGCAGCTTGCCACCTGACTTTGCTTCT
GGAGAGGGTTCCTTCTGTCTTAAGCACCCTTTTCCTACATTCAGAGGCTGTGTGGCTCTT
TACAGCCATCTTGCCAATGCAATGCTGTCCTACTGGTGTCACAGGCGTGGCTACTCTTCT
GTGTCTGTGCCACTGAGTGGCAAAAAGGAAGTGGCTTTGTCTATACTCAGTGTTCAAAAC
TCCATGAGCACTCAGAATGGTTAATGGACCAATATATTCAATAGGGGTGAGAAACAATGA
GGCCGTGATATCTTGGGATGGAACTGTACGAAGTGGAGTATCGGGGGGCTTTTTCCTGAC
CTAGAACATCATCATTATTATTAGAGATTTATTATTATTAGAGAAGCATCATGACCTATT
GGCAAGAGCATGGGCTTGGGAGTCAGAGGATGAGGGTGTTAATCCTGGCTCTGCCCACTT
GTCTCCTGTGTGAACTTCAGCAAGTTACTTCACTTTTCTGTGCCTCAGCTACCTCATCTG
TAAAATGGGAATTAAGACTGTGACCCCCACGTGGCACAACCTGATTACCTTGTATCTCCC
CCAGCACTTAAAACAGTGCTTGGCACATAG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved