Ornithorhynchus_anatinus Locus ENSOANG00000008361
snOPY snoRNA Orthological Gene Database
Ornithorhynchus_anatinus ENSOANG00000008361
Ornithorhynchus_anatinus
ENSOANG00000008361
Contig14117
SNORD83, SNORD83
2031..2106, 3580..3656
6074
CAGGTGAGAACATGTTAACCCCACCCTCGCGCTATTCGCCCCACCCTCTTCCCCACAGC
ACTTAGGTGAATATCTACATGTTAGGTTAGAATATAGAAACATACGTTATGTATTTATAT
TAACGTCTGTCTCCCCCCTCTTAACTGTAAGCTCATTGTGTGCAGGGGACGTGTCTATTT
TTGGATATTCGTTAAGTGTTTATTATGTGTCAGGCACTATCCTAAGCGCTGGGAGAGATG
CAAGCTAATCTATTTGGAGGTAGTCGGTGTCCCACGTGGGGCTCACAGTCTTAATGCCCA
TTTTACAGGTGAGGAAACGGAGGCCCAGAGACGTGAAGTGATTTGCCCAAGGTCACACAG
CAGAGGAGGGGCAGAGCCGGGTTTTAGAACCCAGGTCCTTTAGACTCCCGGGCTCCATCC
ACTAAGTCGTGCTGCTTCTTGACCAAGTCTGTGATGTTGCACTCCCCTGAGGGCTTACTA
GAGTGTTCTGCACATAGTAAGCGCTCCGTAAATAACCCCGATGACTGGGCCCCGAAGTCC
AACCCTAAGTCCGTTACCTTGGCAACCACTCCCCGCACAGGACCCCGTGGGAAAGCGGCG
CCGGTTCCCCCTCCCCCATTCATCGTCAGCCAAGGTGTAGATGCCTGATTTTTTTAAAGG
CCTGAGAGGAAGAATTCCGAGATTCCACCTAGAGCAGGTGAACAACCGATGGCTCAAAAA
TAAGAGTGCCTCCGATACCGCCCCGGTTTTGAGCCGACAGCTCTGGTCCTTTCAGGCGAT
TGCCTGGGGCAGCCCCGGAGCGCGTGGGGCGGCGGAGGGTGGGAGTCATCTCCCGCGTCG
CGCTGTTGCTGGTGCGCACGCGCGCCTGCCTCCTTCCGCCCGGGAAAGGAGGGGGCGGGG
ACTGTGTGTGTGCGCGCGCGTGAGGGGAGGGGAGGGGAGGGGGGGGGAACCTGACAACCC
GGAAGTGGAAGCCGCTTCCTTCAGGCTGCGCCGCTGCCGCCGGCGGGNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNTTCCCCATCGGAAGGGCATTTTATTGAGCGGCCCTTCCC
GCAGGGCACCGGGACTTAAGCGCCCAAGGACTAAGCCAGCGTCCCAGTGTACTGGGACGG
TGCACGGCTCCCCTCCCGTCCTCACGGAGCTTACGGTCCGGGGATGTTGTTGATCCGTTT
CGCCGCAAGTTGGATTGGGCGGGAGTTGACTCTCCCCCCGACCTCCACCCCCCAAAAAAA
ACCTAAAATTCGGGAAAAACTTAGGTATTTAGAAGACGAAACACCTCCCGGTCCATTGCC
CGGCTCTTAGGATGATCCTTGGACTCCCAGAACAGTGACCGGGAACGGGGAGGAAGATAA
ATGGGGCTAGGAAAAAAGTTTTGGCGGGGGGGACGGACCCCAGACGGCCAGCCACATGAT
GTTTTTTATCGAGACAGAGCGCCCTGTGCGGAGATGACCTCGATCTATCACCCTTGACTG
ATGGTGGCTTTTGGGGGGGCGAGGAGAGTCTGGTAGACCCATCCAGTCCGTGGTATTTAT
TGGACGCTTACTGCCTGCAGAACCCTGTACTAGGCCTTTGGGAGCATCCAGTCCGGCAGG
GTTGGGAGACACGGTCCCAGCTTGCCCATCTAAGTTTTTGTAAGTGTGGAGGTGCTTGAA
TCAGATCCTTAAAGAGCTCCTCGTTTCCTTCTTCCTATAAGGGAGTCGTCCCACCCTCTT
CCAGTGAGAGTTTTTTCCTCATTGATGGGACATTAACCCCCACCCCCAGTTTAGGGCCCG
TCTTTTTTCCCTAGAGTGTTGCTGAGTCTTTTGTCAACCCGTCTTTTCTCCTCTGAGTTT
TGCCAAAACTAGGGGCAGGGTTTTGAGGGAGGGAGAAGAGCTGTTGGACGGTAGTTAGTC
ATAATAACGATAACAGTAGTTATGGGCCTTGCTAAAGCGTTTATTATGTTCTAAGCACTG
GGGTAGAGACAAGGTAATCAGGTTAGGCACAGTCTTTGTCCCTCCTGGGAGTCGCAATCT
TGGTCCCCATTTTATAACTGGTATAACTGAGGCACAGAGCAGTGAAGCGGCTTCTCCAAG
GTCACAAAGCAGATAGGTGGCAGAACCGGGATTAGAACCACGATCTCTGACTCCCGGGTC
CGTGCTCTTTCCACTAGTCCATGCTGCTGCTCTAGTTGAAGTGCCATTTTACCATAATCT
CCCTGTGGGCAGGGATCTTGTCTCCCAGGCGTGTTGTGCTCTGCCCACGTAAGCACTCAC
TAAGTATTGGGAAATGGTTACAACTTGGGCCCCAAAGCCGCGGTTTCTCCCGCCTGCCTA
GGTTTCCTTCCCGAGGCCAGCGCCTCCCTCCGCCGCTTTCCCAGCCCCGCTTGGATCCCG
CTCGCTCCCCGGCCAACCCCGCGGGTCTGACCATGGCGGAAAACGACGTGGACAACGAGC
TGCTGGACTATGAGGACGATGAGGTGGAGACGGCCGCTGGGGGGGACGGGGCGGAGGCCC
CCGCCAAGAAGGACGTGAAGGGCTCCTATGTCTCCATCCACAGCTCTGGCTTCCGTGATT
TCCTGCTCAAACCGGAGCTGCTCCGCGCCATCGTGGACTGTGGCTTCGAGCATCCCTCTG
AAGGTGAGTGGCCGGCCCTCCGGCTTCAGGTAGGGCCCGGGAGGGAAGGCTGGCCGGGCC
CGCCGTGACTCTCCTCTCTTCCCCTGCAGTGCAACACGAGTGCATCCCCCAGGCCATCCT
TGGCATGGACGTGCTGTGCCAGGCCAAGTCGGGCATGGGCAAGACGGCCGTGTTTGTGCT
GGCCACGTTGCAGCAGCTGGAGCCAGTCACCGGCCAGGTAGGACCTGGAGAGGGTCCCAG
CTGGGGAGGTTATGTGTGTGTATGGGGTGGGGGGTCCCCGGCCACATGATGCAATAGTCT
GAGACGGGAGCGCCACGCGCCAGGACGACCTTCATCTATCACCCTTGACTGATGGCTGGG
GGCCCGGAGAGGGGCTGGGGTGGAGGTGCGGGAGCCAGTGTTGGGGGGGGTGGTTGAGCC
CACAGCCCCTGCATCGTCCCCCGCCTCAGGTATCTGTGCTGGTGATGTGTCACACCCGGG
AGCTGGCCTTCCAGATCAGCAAAGAGTACGAGCGGTTCTCCAAGTACATGCCCAACGTCA
AGGTGAGGGGATTTGGAAGAGGGAGAGATGGTGGTGGTGGCTGTAGGAGGAGGGCAGGGG
GCAGCCCCGGGGTCACCAAAGGGAGGTTGCGGACCCTGGCAGGGTGAGTGAGGGGACTAG
GATTAACCAACGGACAGTCAGGTGTCTTTACAAGCCGATTTACTCTCGGTGACCTGATTA
TCGGGTTTTGGCCTTTGGGCTCCCCAGGGCCTTCGGTCTGTCCTGGTCATCCCCACCTCA
AGTTTCTCCGAGCTCCCCTGGGCCCTGGGGAAGGACCTGGCAGGCAGGGAGAACAAACAG
ACACAACTGAGCCACTGGAGGCTTCTGAGGGAGCCCCAGAGTGGATGGGTAGTTCCCCCC
GCCCCCATCTCAGATTGGGAACAGGGGAGCCCCCCCAACCCTCAGAGGCTTGGACCCTTG
CTCCTGGGGGCCGCAGCACACAGCGGTGTGTGCTGGAACCACATGTCCCAACAGCTCAGG
TGCACTTCTTGTCTTGCTCAGCCAGGGCCCATGCTCCCTCTGATGAAAGAATCAATCAAG
GTAGATTGGGGCAGAGTTGAAGTCGCTGGCCAAAACATGACTTTGTCAGATGTCAGGGGA
GTCCTATGACCAAAGGACTTCTGTTGATGCTCCCCCCTCCCCAGTATGGAAAGTTGTTCT
CCCCCCAGTGCTTTCCAAGCACGTGAGCCCTGAGTGGAACCAGTGGGGAAGCAGGGAGAT
TTTAGGACCGTTTCTTCCCCCCAAAAGGCATTTCGGGGGGTGCAGCGTGCCGATCTTGCT
GACCCCCGATCTACGCTGGCAGGTGGCGGTATTCTTCGGGGGCTTGTCGATCAAGAAGGA
TGAGGAGGTGCTGAAAAAGAACTGCCCCCACATCGTGGTGGGCACCCCGGGCCGCATCCT
GGCCCTGGCCCGCAACAAGAGCCTCAACCTGAAGCACATTAAACACTTCATCCTGGACGA
GTGTGACAAGATGCTCGAACAGCTCGGTGAGCCAGCCCCCCGTGACCCTAGCCGGCGGCC
CCCGGGGCAGGGGTGGAGAGGCCTGGGTTTGGGCTCCGGCCGGTCCACCCTGACCTCCTC
CCCCGCCCCTTCGTGTTTGCAGACATGCGTCGGGATGTCCAGGAGATTTTCCGCATGACC
CCCCACGAGAAGCAGGTCATGATGTTCAGTGCTACCCTGAGCAAAGAGAATCCACCACAN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGGGGGAGGCATCGCTCAG
CAGACCTGCAGAGGCCAGACCCTCTCCCTCACCCTGCCTCCCTCCCCTCCACCCCTCCCC
ACCCCCCAACCACCCGGACGCTCCGGAGACTCGAGCCCGGCGGGCGGGCGGCCGGCGAGC
CAGCCAGCGCGGCGGACGGCGGACGGCAGATGGCGGCGGTGGCAGCCAAGGCCACGGGGA
CCTCGCCCGGGAGCTGCGGATCAGCCTTTTGTTCCGTGTCCAAACCTAACGCTACCACGT
CCACCGCGAGCCGGGGCCGTGCGGCGCGGGGGGTTTTGTTGCGGTTTTTGGTTTTCTTTT
TACCTTAACACCCCT
  Untranslated Region
  Coding Sequence
  snoRNA
3001..3302, 3389..3516, 3749..3841, 4642..4825, 4942..5038
3092..3302, 3389..3516, 3749..3841, 4642..4825, 4942..5038
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved