Ornithorhynchus_anatinus Locus Poly:SNORA7
snOPY snoRNA Orthological Gene Database
Ornithorhynchus_anatinus Poly:SNORA7
Ornithorhynchus_anatinus
Poly:SNORA7
Contig137485
SNORA7, SNORA7
901..1038, 2001..2138
4138
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNCGATAAATAGAGTCAAGGGGAAGAACATCTCATA
AAAACAATGGCTAGAGCATTTGTGTACATATCCTTAATTTACTTATTTATATTAATGTCT
TCCCCCCTCAGGGTCACACCTGGAGAGTTTCCAGTACTCTATCAGTCTCGACTTTGGGAG
GGAGACTCAAACAGAGGCATATCCCTTGCATTATTAGCTTGAGCAGTGGCTAGTGAAAGG
AAGCCAATCTGCTACAAGTCAAAACTCACCTGTGCTGGACAGCAGCAGCATGGGAGAGAG
TCGAGGGCAGAGACTCAAGTTTACTGCACTGAAGGAAGGAATGATAAACCATTTCTGTAT
TTTTACCAAGAAAACTCTTTGGATACACTACTAGAACCATTGTAGATGGAGGTGGGGCAT
TCTGGGAGAGATATGTCCATGACATAACTATGGGTAGGGAGATGACTTGACAGCATGAGA
TAATATTAATATCTGCCTCCCCTTCTAAACTGTAAGGTATTTGTGGGCAGGGAACAATTG
TACCATGTATTATACACTCCCAGGTACTTAGCATAGTACTCTGAACATAGTAAATGCTCA
GTTAATCCCATTACTGATGAATTGATTCTGAGCATCACAATTGTGTGGCTATAGCCTGAA
TTCACTACCTTTTTAGCTTGCTTTCCAACAATGCCCAAAGGAACAAAGCTAGTGCCTCTA
CAGCAGCTAAGAAGGTCAATGGATTTTGGCGAATCATCAAACTCCAGAGAGAAGCAAACG
TTTTTCATAGATGGTTCCTCCCATCCCACTTTATGGAAGTATGACTCAGACTTGTCATCT
GGTCACACTCAGCTCCTGGATGGAAGTTTCCCCCTTCCCATTAAAGTCAAATGGCCAAAC
GGTGAAGTGTCTATTAAGGGGAGGAGGCAGTCTAATAAGGAGAGGAGGCAGCGGTCCTCC
CAGACCCTGAGGCCCCCGTGAGTATCTCTCAGATGTGATGGGCTGGCCAACGGAACGGGA
GATACCTGGCTATCCATTCAATTGTTGTCTGGTGGACTCAGTGGGGGCAATATTGGACGG
GCAAGAGCAAGAATAAGAAAGGGATGGCACCGAAAGAGGATGCCAGTGAACGTCATTCTG
AGACAGCTCCCTCTGAACACAACATATCCACCTGACGGTTTAGAGGAAGGACTAGAAATA
AAGCCCGTCTCTTCAGATTGGCCCCTCTCAGGGTCGCACCTGGAGAGTGTCCAGTACACT
ATCGGTCTCAGCTACGGGAAGGAGAGTAAAGCAGAGGCCTACCTGTTCGATTCCTAGCTT
GGGCAGTGGCTAGTGAGTGGAAGACAATCTGCTACAAGTCGAAACTCACCNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved