Ornithorhynchus_anatinus Locus Mono:SNORA7
snOPY snoRNA Orthological Gene Database
Ornithorhynchus_anatinus Mono:SNORA7
Ornithorhynchus_anatinus
Mono:SNORA7
Contig136012
SNORA7
615..753
846
GAAAACCGACAAAAAGCAGCCAGGGCTAGCGGCGCGGGCCCAGCGGTCAGAGAACCTTG
GTTCTGATCCCGGCTCTGCCAGTTGTCTGCAGGTGACCTTGGGCAAGTCACTTCACTTCT
CTGGGCCTCAGTTCCCTTATAATAATAATACTAATCATGTTGGTATCTGTTAAGCGCTTA
CTATGTGCAGAGCACTGTTCTCAGCGCTGGGGGAGAAACAGGGCGATCAGGTTGCCCCAC
GTGAGGCTCACGGTTAATCTCCGTTTTACAGATGAGGGAGCCGAGGCACAGAGAAGTGAA
GTGACTTGCCCACAGTCACACGGCTGACAAACGGCGGAGCGGGGATTCGAACCCATGACC
TTATCTGTAAGACGGGGATTAAGGCTGGGAGCGCTGTGTGGGACGGGGACTTTGTCTAAC
CCGATTAAGCTCGTATCTATCCCGGCGCTTAGCACGGCGCCTGGCTCGTAGTAAGCGATT
CAGAAATACCACGGAAAAAATGGTCTGAAGAAAACGGTAGCCAAGTATCAGCTTAGATCT
GGGGAGCCCTCCACACGACCAGAGCTTTTCGTTGGCAGAACAGAACGCCAAATTGGGCTT
CCTAGGCAGAACGGTCCCCTCTCAGGGTGGCACCTGGAGAGTTTCCAGTACTCTGCCGGT
CTCGGCTACGGGAGGGAGTGTCAAGACAGAGGCCTGTCTGTCTCATTCCTAGCTTGGCCA
GTGGCTAGCGAGTGGAAGGCCATTTGCTACAATTCAAAACCCCTCCGTGCCGGGCAGCGG
CGGCACGGGACAGAGTCGAGGGCGGGGACTCGAGTTTACCGCGCGGAAGGAGGCGACGGT
AAACCGC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved