Ornithorhynchus_anatinus Locus Mono:SNORA7
snOPY snoRNA Orthological Gene Database
Ornithorhynchus_anatinus Mono:SNORA7
Ornithorhynchus_anatinus
Mono:SNORA7
Contig133087
SNORA7
19..156
1156
GTGGTTCTCGATCTTTCCCCCTCTCAAAGATTGCATCTGAAGGAGTTCCAGTACTTTAC
CCAGGGAGGGCTAGGGAGGGGGAATCAAGCAGAAGAATATTCATTCCATTCCTAGCTTGG
CCGATGGCTAGTGAATGGAAGGCAATCTGCTAAAATTCAGAACTCATCCGTGCTGGGCAG
AGGTGGCATGAGAGCGAGTCAAGGGCAGAGACTCAAGTTTACTGCATGGAAGATGGCACT
ACCAGAATGATCAGAGATGGTGAGTGGGGCTTTCTGGGAGAGATGTGTCCATGGAGTCAC
TATGGGTCAGAGACAACACAACAGCTTACAACAAGTCTCATCTTTGAAAATGAAAGGTAG
CTAGCAACCATTGATCATCTTCATTTCAATTGAGTTTTTTTAAGACTGTTTAGCCTGTCC
CAAAAGCGTGTAGCTCCTTGATTCATGCCACCATCAGTCCCCCAACACTTATGTACATAT
CTCTAATTTATTTAATTACATTCATGTCTGTCTCCTACTTTAGACTCTTGAGGTTTTTGT
GGGCAGGAAACATATCTCTTTTATTCAGTCAATCAATCAATCAATCGATGTTATTTATTG
AGTGCTTACTATGTGTAGAGCATTGTTCTAAGCACTTGGGAGAGTACAAGATAAACTAGC
AGACATCTTCCCTGCCCCAAATGAGCTTACTCTCATAAGTGTTTAATACAGTACTTTTGC
ACACAGTAAGTGCTCAATAAATGCCACTGATTTATTGATCTGATTGAGAGCAGGGATGTG
TTTTGAACTGCATTTGAATTGGAACTGTACTCTGGCAAGGCAGCTTTTCCTGTACTGGTT
GTCTGCAGTGTGCTTTTTTCAAATGCTGCAGCCAATCACTAAAAACACGGAATGTGCACT
TGCACAATCCTCTAGCACATTGGGCCTCTGCGCCTCTCAAAAGCTCTCCAAAGGCAGTCA
ATCTCAGAGAAAATTACAAGGGATCTCTCTCTATAAAAACACATAAGCCCACTAAGCCCG
GTCTCATTTAAATGGGAATATAATAAAAATTTGTCCCAAAGCTGGTCCCAGAATTTAATT
TCTCCTGGGCAAGTTGCCAACAAAGGAATGTTTTGTGAGAGAGAAAAAAGTGTGTGGGGA
AAATTTGTGCCCCTCTC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved