Ornithorhynchus_anatinus Locus Mono:SNORA7
snOPY snoRNA Orthological Gene Database
Ornithorhynchus_anatinus Mono:SNORA7
Ornithorhynchus_anatinus
Mono:SNORA7
Contig126707
SNORA7
438..592
1024
GCACTCAATAAAAAGGGAAGCAGCAATATGCACTCAGATAAAGGGAAGCAACATGGCCT
AGTGGATAAAGTGCAGGCCTGGGAGTCAGAGGACGTGGGTTCTAATCCTGCTCTGCCACT
TGTTTGCTGTGTGGCTTCGGGCAAGTCACTAAACTTCTCTGTACCTTAGTTTCCTCAGCT
GCAAAAATGGGGATTCAATATAATAACGTTGGTATTTGTAAAGCGCTTACTATGTGCCGA
GCACTGTTCTGCTCCCCCTCCTACTTGGACTGTGAGGCCCATTTAGGACAGAGATTGTAT
CTGGCCTGATTGACTTGTTCCTACTCCAGTGCTTCGAAGAGTGCTTGATACACCGTAAGT
GCCTAACAAATACCATAAAAAATATTGATTGATTCCTACTACTTTTGCTACTGCTACAAC
TTCTGCTGCTATTACTACCCCCTCCCAGGTTCACACCTGGAGAGTTTCCAGTCTCGGCTA
CGGGAGGGAGAGTCAAGCAGAGGCCTACCCATTCCATCCCTAGCTTGGCCACTCACCCGT
GCTGGACAGCAGCGGCACGGGAGAGGGTCGAGGGAGGAGACTCGAGTTTACTGCGTGGAA
GGAGGCAGGGGTAAACCACTTCGGTATTTTTACCAAGAAAACTCTATGGATACGCTACCA
GAACGATTGCAGATGGAGAGCGGGGCGTTCTGGGAGAGATGTGGGGCTCTGGGGAGGTGA
CTTTGCCTCGCTGGTGGGACTTGCTTGGAGTGAGCACTACCTCTCTGTAGCCCATGTGCA
AATATTATTACCGCAATTATTATTGTAGTTAGAAGCTTTTGAGGAGTCGAAAGATGCAGT
AGTGATAGCATTTATTAAATCGTTTACGTGTGTAGAGTACTGTACTGGGTGCTGGGAGAG
AATACACAGGTGGGAATTGAATATGGGCCCTATCCCTTGTGGGCTCCCACTCTAAAGACG
GGAATGACATTTCAGAAAGAGGATCCAGCAGCTGCGTGACCTTAGAGCCCAGAGGTTTGA
GGGGG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved