Ornithorhynchus_anatinus Locus ENSOANG00000022476
snOPY snoRNA Orthological Gene Database
Ornithorhynchus_anatinus ENSOANG00000022476
Ornithorhynchus_anatinus
ENSOANG00000022476
Contig12565
SNORD126, SNORD126, SNORA79
2017..2091, 2425..2501, 3467..3611
5999
CACTAAGAAAGTGGGGAGGGGCGAAGGAGGGGGCTGGGACGGGGCCCGGACCTGAAAGC
TCGGGAGATGTCCATGTCCAGCGCGGGGGCGTAGAGGCGCCAGGAGCCCCCTCGGTCCTG
CCATTCCCAGCGCAGCCCGTCCGTGCGACCCTGGCCGCCCTGCGGGCACGGGGACACCTC
TAATTCCGCCCTTCGAGGGCCCCCGTTCCTCCCGGTCCGGCGGCGAGCCGCCATGGAGTC
GTGGTGGAGAAGGACGGGCGGTCCCGAGGCCCGCGCGGGCCCCCACGGACAGAAGGGAGG
AGCCGGCCTCATTTGCATCTCTCCCCGCCGCTCTACCTCATGGGAAGTCGCCCTAAGGTA
AAGGCCGGGTGATCTCCGGAGCTTATATAGACTTCCGCCGCCGCATCCTTAGCACGTGGC
AGTGGGAAGCTCAGCGGAGGGGCCACGGGCGGAGTGCGCATGCGTCACTCTCTGGCCAGC
CCTTGGGAAGGTCTGAGACGAGGGCCAGCGGCGGCCCTAGCAGGGCCCCCCCCGAGCCGC
GGGGGGGTGAGTTCCCAGAGAAGGGGGCCTCGCGCGGGGGCCGACCGGGCAGGAGAAGCC
GCGCCGCGCTGGCGCCCCCTAGCGTCCGCCCGGCCCGCGGCGGATGCCCCTCCCGCCGGG
GCTTGGAAACGACTCACGGCCGGCGGGCTGAGTGCAATGGCTGAGGGGGGGCACGGTTGC
TTTGCCGCCGGCTCCCTAACCCAATTCAGACTACTCTTCCCTGCCACTTTTGCCGACTTT
TGCTGCACATACATTCCCGGATGACGAGGGAGGCTTCCGGTTAGGGGCGGTGCTCGGGCC
TCCCTAGCCAATCACACTCTTTCTTGCCCCCCAAAAGCGCTGCCATGCGGCCCACCCGCT
CTCTTTTCCTGCAGGTTCCATCCGCCGCCATCTCCCATCTCGTGCAGCCTGGATGGGCCG
CATCTGCCACCTCTCTTCGACTTGCAGCTGGGTTACCCCCGCGCGGGACCGTAGGAATGA
AGGACCGTCTCCTTTTTGGCGGGGGGCAGGTACCGTGTTTCCGTTTACATTTCTAAACGC
TGAATATTGCACCGAATGGGTGTCGCATTTTAGGGCCCTTTCTCACTCTTCCCTTGCCTG
GCCTGATGGTGAAGGAAGGGTGGGAGTTTCTGCTTCGGCCAAGTGCGGGGGCTTAGGGGG
AGAGGGAATTTCGTACTGGGTGAGCTCCCAGTTACCAGACCAGTCCAATCTCGTGATTTT
TGACGTCAGAGGCTGGGGGTGGGGGCATTGATCCGCACTTAGAATACCTTAAACTATAAT
ATAAACTTGAATATAAAATATAATAGCGTAAAATAACTCCCTGCCGCTACCCGGGAGCCG
GAGATACCCCCTCCTGCCCCTTTGGACAAAATGGCACCGTCTAGTCCAGGCTTCTCCTGG
TCTAACTCTCCCCCTCTCCCTCCAACTTGCTCAGAGAAAGGGGCTTCGGCACTTAACATG
CCCCTGGGCTCCTCCGCACTTTCAGCCGATTGCAACTCTGGTGCCCTGATGCTTCACCAG
CTCCAGCCCAGTGAAGGAGCCACGTGGGTCTTCAAGTGTCCTCCCTGACGGCCAGAACCA
GCAGCCCGACATGGCATGGGGACCAGCGTCAGGACGTGCCTATTTGGGAGAAGGTAAATC
AGTCGATCAATCGTATTTATTGAGCGCTTACTGCGTGCAGAGCACTGCACTTAACGCTTG
GGAGAGGTATAAGCCAAAGAGGGAGCTGTAACTTGTCTGGTGGGAAGGTAGCCCCTGCCC
CTAATGGGGGTGGGGGCTTTGTATCTGGTCCTCTCGAATGGAACCATTGGTTCAGTCGTC
AGTGATGAGGATGAAGTGGCCGAGCCGTTTGGGGAGGGTGGTGAGACAGGAGCAAGTGAG
TGGAGCAGGAGGAGAGATGGTTAAGATGATGGTTTCGTTGCCATTTTCCCCTGCCTACCT
GTTCACTTATGGTTGATGGAGATCCAGGGCCAAAGGCCATCTGCTGGGATGAACTGCATG
TTCAGTCCGTGTTTCACCTGATTCCTGATTACACACATGCACTGAGCAGAGCCCCCAACT
CCATGACTTTCTGATGTGGGATTGCTGGGGGAAGGGGATGGGGAAACAGGGTCCTCCAGC
TTTCATGTGGATCTTGTTCCCTAGAGACTTGAGATGGTGGCAAGGACCCCGTGATACCTG
TTATTTGGCCTTGCCCAGGCTGGAAATGCCCTGGAATCGGTGATGAGGAAGAGAGGGTAA
GGTTCGATTGACTGCATCCATGCCATCTGTGGGTGAGGGTAGAGCTTGAACACGTGGGCC
CCCCTTAGTCAATCTGGAGGAGCCCACTCTGTGGGAGCAGCCCATGGCGCGCCAACCTGG
GCTGCCCCCTGAGGATCACCTGCCCCCCCTGCCTTGATGAAATGCATGTTCAGTCCGTGT
TTCAGCTGACCACCCTGATTATACACATGCGCTGAGCAGGAGGGAAGGGTCTCTCGCCTG
AGGCCTACTTATGGCCATCCTGCGGATGGAACTGGGCATTATTGCTCCCCTTGATTCTAT
TTATTGCTATTGTTCTTGTCTGTCTGTCTCCCCCGATTAGACTGTAAGCCCGTCAAAGGA
CAGGGACTGTCTCTGTTACCTATTTGTACATTCCAACCGCTTAGTACAGTGCTCTGCACA
TAGTAAGCACTCAATAAATGCTATTGAATGAAATGAATGAATATCTGGTCACTGGGATTG
AGTAGGGAGCCAGCTGTAGGACCAATCCATCCATTTATGTGTTGCACAGTAGTCACATGG
TGGCATGCTGACTGGGAGTTCTCGTCCCCACTGCCAGTTCCTGAAAAAGGGCTGGATTTT
GGTAGGGCCCAGAGGTTTTCAGGCCTTATCTCAGCAACCTTAAGGCAGCATCATTGTCTC
CTTGCAGGAAACCCCAGAGAGACCCTTCCTCAGGAGGAACAAAACCCCAACTGAAGTTGA
CTTTGTCTTTTTCAGCCTGCACTTCAGGATGGTAGAAGTCTCAGGGGTAAGTTCTGGGAG
AGTGGCAGTCTGAGTTCTGAAGTCTTCAAAAAGGCTCCCAAAGTGTTATGATAGTTATCT
AGTTACTGTGGTAAATAGGGACAAGCAAGCCAAGTAGATTTGAAAATGAATTCAATTGCT
TAGTACAGTGATCTGCACACAGTAAGTACTTAATAAATACCTTTGATTCGAGTAATAACT
TCCTTTGGACTCATGTAGCCTCGAGTAGCTGTGCCTGATGGAAAAATCAACTGCTTGCCT
GTTGTCCCCATCATTTGGAGCTGTGCCAACACAGCCCAAGCACTCCCCCGGGGAGTGTCC
AGTCCAGTGTCTAGCCATTAACAAGGCTACAGCAGCTAGCCTCATGCCCCCCTCCTTGCT
CTGTGGTGTGTGTCTGTGTTCGCGCACACCCGTGCCTCCCAACCCCCTGATGGCTGTTCC
TCTTGCTGTCTGGAGCTGTGGGCAGTGGGATTTTAGTCCATCACAGAGAAAAGTGGCCTG
TCTTCACTCGGGGCACCATGAGATGGGTCGGCCATCTATTCGTGCCTCCGAACTTTGCGG
GGTCAGACAAGCATACCTTTTTACAGAAAATAAAGTGTTCTCCTATATATAGCATTAGAA
TGACTCTTCCTATCTGTTCACAGGCCCTGGTCTCGCTCGAAGAGGTCCATTATTAGACTG
GAGAAATGGGTCTGGGACCCAACCCTTGAAGCCTGGAATTGGAGCAAACCCTAACAATAT
TTAGTCCCTCTAATAAAATGGGCCTGAGTCACTCATCTCTGTTTGCACAAGGGCACTGAA
ACTGCACATGGCATAGCGGGAGGAGTTATTACTTAAAAGTGGCTGCCAGCATGTAGGGCA
GTTTCAGTCAAGAAAGGGCATTTGGTAAGTGCATGCTGACTGCAGAGCACTATGGGAGAG
TTTCCAGAAAAAAAAATCCTACATTCTCTTCAAGGTGCTTACAAAATATTTGAATGAATG
AATATGTACGGCTGAATAAAGAATTGAAGATATAAACCTATCTTGTTCCTCTGTATAATT
ATAATTGCTCTGGGTTGTTCTTGGGTTGGTGTAATCAGTTAAATGGGGATTAAGGTTGTG
ACTGTCCAACTCAATTTGCTTTTATCCACCCTGGTGCTTAGAACAGTGGCTGGCATGTAA
TAATAATGTTGGTATTTGTTAAGCGCTTACTATGTGCAGAGCACTGTTCTAAGCGCTGGG
GTAGATATAGGGTAATCAGGTTGTCCCAGGTGAGGCTCAGTTAATACCCATTTTACAGAT
GGGCTAGCTGAGGGACAGAGAAGTTAAGTGACTTGACCACAGTCACACAGCTGACAAGAG
GCAGACCTGGGATTCGAACCCATGACCTCTGACTCCCAAGCCCGGGCTCTTTCCACTGAG
CCATATAGTAAGAGTTTAACAATACCACCAAAAGGGCCGTTTCAGGTTTGACGGTGGGAC
TATAAACTTGTGGGCAGGGAATGTGACCAATATGGTTGAACTTTTCCAAGTGCCTGCCCT
GCATACAGTGAGGGCTCAATTGCATATATTTTTTATTACCCTATTTATTAATGAGATGTA
CATCACCTTGATTCTATTTATTGCTATTGTTTTAATGAGATGTACATTCCCTTTCTGTCT
CTTCCCCGATCAGGGACTGTATCTGTTGCCGATTTGTACATTCCAAGTGCCGAGTACAGT
GCTCTGCACATAGTAGGTGCTCAATTAATACTATTGAATGAATTCGTTGATTGTTGGGAA
AGGTCGNNNNNNNNNNGTGGATTCTCCCAAGCCGGAGCTCTTTCCACTGAGCCACGCTAT
CTAAGTAAGAGGGGAAAGGGCGGCGGAGGACTGAAGGGAGGGGCTCCCCGCGGGATGTTC
AAGGCGGCTTCCGCCTCCCTGTTGGCCGTTGCCTCCGTTGGGGAGGGAGGGAGGGAGGGA
GGGCGCGCGAGACGGAGGGAGGGCGCGCGAGACGGAGCGACGGCGCGCGAGACGGAGCGA
CGGCGCCTGCGCGGTGAAGCGCCGCGCAGGCGCAGAGAGGCAGCGGGCTTTTCCCGCGCT
TTCCCCTCAGCCCGCGCGCCGTCGCCTTGGGGGCTGAGGCGACTCCCGGCCTCATCGCCC
AAGTGAAGGCCCGGGGCTCCCGCAACGGACCCTCTGAGGTCTCTAGGGCCGCTCCCCCTC
GAAAATCCCCATGTCCGGAGAGGTCCAGGAGAGCAGGCCTTGTTTTTCCTTGGGGAGTTT
CTCCTCAACCCCGGGTGTGATCCTAATAATAATGTTGGTATTTGTTAAGCGCTTTCCCTG
TGCAGAGCACTGTTCCAAGCGCTGGGGTAGATGCAGGGTCATCAGGTCCCATGGGAGGCG
CACAGTCTTAATCCCCGTTTTACAGAGGAGGGAACTGAGGCACAGAGAAGTGAAGTGACT
TGCCCCCAGTCACACAGCTGACAAGAGGCACAGTCGGGATTCGAACTCATGACCTCTGAC
TCCCTCGCCCGGGCTCTTTCCACAGAGCCACGCTGCTGGGGAGAGGGTAGTGTTGAGGGG
GCTGAATTCCCACCTCCTGTGGAGTGTCGCAGCTGCCCCAACACGGTGTTCTTGGGGTCT
GCCAGGTCCACAGGCGGGTGGAGCGACCGGTTCTGGGCCGAAGCCGGCCAGGCGCCCACC
CTGTCTATACCCAAGAAATGCCACTGGAGGAACCTGGATTTCTGCATCCCACAATGTGGC
CTCAGGCCTTCCAGGCCACAGGGAAGGGACTCAGGTGGCAGATGTGAGCATGGAGACAGG
CAGATTTGCCCCCAGACCTCGTGCTGACGACCTTCCTACCGGACCTCCCCCACGGGGTTC
ACACCCCACTAACGTTGCCCCATGTGGGACTGGTTCTTTGTCTTACCTATCTTGCACCTT
CCCCAGCGGCCTGGGAGTCAGAAGGTCACGGGTTCTAATCCCGCATTCCGCCACTTGTCT
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1041, 1521..1672, 2184..2275, 2947..2999
1635..1672, 2184..2262
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved