Ornithorhynchus_anatinus Locus Mono:SNORA7
snOPY snoRNA Orthological Gene Database
Ornithorhynchus_anatinus Mono:SNORA7
Ornithorhynchus_anatinus
Mono:SNORA7
Contig125412
SNORA7
289..428
963
CTACATTGCTGGATGGTATGAGTGCGAGAGCCGACCAAGAGGACCTGCTAAGGGATGGT
CTGGGCCTTTGAGTTAGTGGAGCAGCAATAATGAAGGGAAAAACAGGTGTGGCCTAGTGG
AGAGACCATGGGCCTGGGAGTCGGCTCATGTGGGCCGGCTCCTCCGCTTGCCTCTTGTGT
AATCTTGGGCAAGTCACTTAGTTTTCTGTGCCTCAGTTCCGTCATCTGTGAAATGGAGAT
TGAGACTGTGAGCTCCATGTGGGACATGGACGGTGTCCAACCTGACTAATGTCTTCAGGG
TCACCGCACCTGGAGAGTTTCCAGTCCTCTACCGATCTTGACTATGGGAGGGAGAGTCAA
GCAGAGGCCCGTCCATTCCATTCCTAGTTTGGTCAGTGACTAGCGAGTGGAAGGCAACCT
GCTACAAGTCAAAACTCACCTGTGCCGGGCAGCAGCGGCACGGGAGAGAGTCGAGGGCGG
AGACGCAAGTTTACTGCGTGGAGAGAGGCAATGGTAAACCTCTTCTGTATTTTTACCGAG
AAAACTCTAAGGATCCACTACCAGAACGATTGCAGGTGGAGGTGGAGGGTTTTGGGAGAG
ATGTGTCCACGGCATCGCTATGGGTCGGAGGTGACTCGACGGCGTAAGACAGGATTGTGT
GTTTGGAAAACTGCAATACAGTGGAGGTGGTAGACCCGATTGCTGCCCACAAGGATTTGA
TAGGGTACAGGGGGAGGCAGAAGTTAAAATAAATTACAGAAAGGGGAAATGGTAGAGCAT
AAGAATATAGACACAGGCAAGTGCATAGGTGACACAATGGGGAGAGTGAATAGGGGAAAG
GAGGACTTAATCGGGGAAAGCCTCTTGGAGGAGGTGTGTTTTTTTAAAGAGGGTTTGAAG
GTGGGGAATGTCGGTTATGAAGGGGATGGGAATTCAAGGCCAGAGGGAAGAAGTGGGCGG
TCAG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved