Ornithorhynchus_anatinus Locus ENSOANG00000029193
snOPY snoRNA Orthological Gene Database
Ornithorhynchus_anatinus ENSOANG00000029193
Ornithorhynchus_anatinus
ENSOANG00000029193
Contig12165
SNORA7
3353..3494
10154
CCCACCCGAAGCAAGGATTTGTCGGACGCTGAAAGCTCATCTGAACCCAGCCTGACCTC
AGCTGGGATGGCTTTAGGGGAAGGAGCGTGGCCTAGTGGAAAGACCATGGGACTGGGAGT
CGGGGGACTCGGGTTTTAGTCCCAGCTCTGCCACTTGCCTGCACTGCGGCCTTGGGCAAG
CCACTTAACTCGAAGCAGCACGGCCTAGTGGATAGAGCACAGGCCCGGGAGCCGGGGGGT
CCTGAGTTCTAATTCCAGCTCTTCCACTTGTCTGCGGGGTGACCTTGGGCAAGTCACTTC
ACTTCTCTGGGCCTCGGTCACCTCATCTGTAAAATGGGGATAAAGTCTGTGAGCCCCACG
TGGGACAGGGACTGTGCCCGGCCCGATTAGCTCGTATCTTCCCCGGCACTCAGAACAGTG
CCTGGCACACAGTAAGCGCTTTAACAGATACCATTAGAAAACGAAACAATACAAACTTCC
CTGTGCCTCAGTTACCTCATCGGTAAAATGGGGATACGAGACCAGTTCTCCCTCCATCTT
ATCAATCCATCAGTGTTATTTATTGATCACTTACTGTCTGCAGAGCACTGCACTAAACGC
TTGGGTTGGGGAAGCAGCGGGGCTCAGCGGCAAGAGCCTGGGCTTGGGAGTCAGAGGTCG
TGGGCTCTAATCCCAGCTCCGCCACTTGTCGGCTGGGTGACTTTGGGCAAGTCACTTCAC
TTCTCTGGGCCTCAGTGACCTCATCTGTAAAATGGGGATGAGGAGCGGGAGCCCCATGTG
GGACAACCTGATCACCTCGTATCCCCCAGCGCTTAGAACAGTGCTTGGCACATATTAAGT
GCTTAACAAGTACCATCATCATTATTATTACAATACAAAAGACACGTTCCCTGGCCACAA
CAAGCTTACAGTCTAGAGGGGGGAACCCTTGGGCTCACAGTCTAAGAGTGGCACAGGGAC
TGTATCCAACCTGATTATGTTGTATCTACCCCAGCATGTAGTACAGCGCTTGGCACAAAG
TAAGTGCTTCACCAGGATTATTATTAGTAGTAGTAGCAGTAATATTCATAATAATACCAA
CCCATTCCCAGAGGCTCCAGTTCAGTGAGCTGGTTGGATCTTCCTGGAAGGGAGGTGGTA
GTTTGAGATTCTGATTCCCTGGTGACGGGCTGGCCACTGTGTGCGTATAAACTAGAACAC
GGTGTTCCAGGACCCACTCTCTCCTCAGTGACACCCCTCCCCCCTTGACTAATATTAAAC
TCCAAGGCAAAGAAAACCTCCAGAAGTCATTTACGGGAAGCAGTATGGCCGGGGAGTCAG
AGGAACCGAGTTCTAATCCTGCATCTGCCAAAGGCTTGCTCTGTGGGTTCGGGCAAGTCA
CGTAACTTCTCCGTGGCTCAGTTCTCCTGTTCTCCCTCCTACTTTGACCGTGAGCCCCAT
GCGGGACAGGGACTGTGTCCAACCTAATTCGCTTGTATCTGCCCCAGTGCCGAGCACAGT
GTTTGTCGCATAGTAAGCGCTTCATTCATTCATTCGCTCGTATTTACTGAGCACTTCATG
TGTGCAGAGCACTGTACAAAGTACNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNCCTGCCCCCCTCGTGTTTTAAGAGTTTTAGACCTACA
GTGCAGGGACCGGGATGTTACCAAGCAGGGGGAGTGATTTCACTTAGGTAGCTGTCCTCT
AGGCGATGGAGGATACAACTCCCCTCTAGACTGTAAACTCGTTGCGGGCAGGAAACGTGT
CGGTTTCTTGTTATAATAATAATGTTGGTATTTGTTCAGCGCTTACTATGTGCAGAGCAC
TGTTCTAAGCGCTGGGGTAGACACAGGGGAATCAGGTTGTCCCACGTGGGGCTCACAATC
TTAATCCCCATTTTACAGATGAGGTAACTGAGGCACCGAGAAGTTAAGTGACTTGCCCAC
AGTCACACAGCTGACAAGTGGCAGAGCTGGGATTCGAACCCATGACCTCTGACTCCAAAG
CCCGGGCTCTTTCCACTGAGCCACGCTGCTTCTCTATATATAGTATATATATATATACTA
TATATAGTATAACAATATACTATTGTTATAGTGTACTCTCCCAAGCGCTTAGTGAGCGCA
CAATAAATATGACTGAACGATCGATACGACTGAATTCCCAGCTATCTTGGGAGCCGCAAC
TGTGCACGTGAAGGACCCATTTTGGTTGGGCCCGGGCTCGCTTGAAGGTTGGAGACGGAC
TGGGATGGGTGTTTTTTTCTGGTATTTGTTAAGCACTCGCCATAATGATAATAACAATGT
TGGTATTCGTTAAGTGCTTACTATGTGCAGAGCACCGTTCTAAGCGCTGGGGGAGATGCA
GGGTAATCAGGTTGTCCCATGTGAGGCTCACGGTCTTAATCCCCATTTTACAGATGAGGG
AACTGAGGCCCAGAGAAGTGAAGTGACTTGCCCACAGTCACACAGCTGACAGGTTGCAGA
GCCGGAATTCGAACCCATGACCTCTGACTCCAAAGCCCGGGCTCTCTCCACTGAGCCACG
CTGCTTCTCCGTGTGCCAGGCACCGTACTAAGCGCTGGGGTAGGTACGAGCTAATCAGGT
TGGACACAGTCCACGTCCCACATGGGGCTCACAGTCTTAGAGGTGAGGTAACTGAGGCGC
GGAGTGAAGTGACTTGCCCAAGGTCACACAAAAGACAAGTGGCAAAACTGGGATTAGAAG
CCAGGTCCTTCTGACTCCCAGGCCCGGGCTCTACCCACCAGGCCACGCTGCTTCTCGTTG
GGATTGAGCTGGGCCCCAAACTTCCTGCCTTTGCAGGGCTCTACCTTTCCCTTCCCCGCT
CAGGGTCGCACCTGGAGAGTCTGCAGTCAGTCCTCTACCAGTCTCGGCTACGGGAGGGAG
AGTCAGGCAGAGGCCTGCCCATTCCCTTCCTAGCTTGGCCAGTGGCTAGCGAGGGGAAGG
CAATCAGCTACAGATCAAAACTCACCCGTGCTGGGCAGCAGCGGCACGGGAGAGAGTCGA
GGGCGGAGGCTCGAGTTTACCGCGCAGAAGGCGGCGATCGTAAACCGCCTGCGTGTTTTT
ACCATGCGTAGATGGTGAGCCAGGCGTTCTGGGAGAGACGTGTCCGTGGCGTCGCCATGG
GTCGGGAACGCCTCGACGGCATAAGACCTTTCCCCTCCTTACACCCCTGGACTGCTCCTT
CTCTTTCCTCAGCCAAAACAAAACCCCTGCTTTTCTGCTGCAGTACGGAAATGTTTATCA
CCACCCTCCAACCCCGGGGAGGGAAATCTCCAGATTGCAATTACTTTGACACCGCCTTGC
CCGGTTTCCAGTGTCTTCTCCAACTTGTTGATATTTCAGTCCCTGCCCACCTCTCTCCTT
TAGGACCTTTCATTCTGGGTTTGGCTTAAAGGGAGGAAGAAGAAAACGATCTCAGAGGGC
AACAAATTCCAACCAGACTGACTTCTCTCCAAGGGACCGTCGGATCCTTGAGGGCAGGGA
TTGTGTCCACTAACTCTTATAGTATCTCCCAAGCGCTTAACGCAGTTCTCTGCCCACAGT
AAGCTCCCGACGGACATACCATTGATCGAAGGTTTTTGAAAAGAGGGGAGACGAGTGAAG
TGACAGTTTAGACACATGACTGGAGCAGCAGCGTGGCGAAGGGAGGGCGGAGCCTGAAGG
TCCAGTGAGACTTGATTTAGATTGCGAGTCCCACGTGAGACGGGGACTGCGTCCCGCTGA
TTCACTTCTGTCTACCCCAGCGCTTAATACCGTGCTTGGCACATAGCAAGTGCTTAAAAA
ATTACTGTTATCATAATCATCATCGTTATTACGGTTACCACCGGGCGGCTGATGCAGAAG
CCAAGTACCTCGACCCGGGCGGTGGCCTTTGTGGATGGTGAGGAAGGCAGGGATCCTGGA
AATGTTATGGAGGGAAAACTGACAGAATTTAGGGACAGAGTGAATACGAGAGTTGAAAGT
GAGAGGAAAAATCGAGGCTGATGAGAAGTTTTCAGGCTTCAGAGACATGGAGGATGGTGG
TGGTGGTGTCAACTGTGATGAGAAAGTTAAGTGAGGTGTCAATTAGACACGGTCTGGAGA
TAAGAAGGAAATACACGATTGTAGATGAAGTGAGAAATTGGGATTAGCAACTCCCAACGC
CCTGAGTCACATCAACCCGACACCTGTTATTAATACCCTTCCTCCTCACTTATGTATATA
TTGTATTATTATACACGCAGTTAATTTTTTATTTTGAAATTTCAATTTGTAAATATTTTC
ATGTTTCTCTCCCCCGATAGGGTGTGAACTCACTGTGGGCTGGGAACATGCCTTGTGTTT
CTGTTGTACTTTCCTAACTGTTCGGCGCACTGCACCTGGTTGGGCGGGGAGGTGTCAATA
CATACCAATATCACTATTGACCAATCAATCAACGGCATTTATTGAGCGCTCACTGCACGC
AGAGCACTGTACTAAACGCTTGGGAAAGCAGGATACACTCCAATTGGTAGACACAAATCC
TGCCCACAAAGAACCTAAGAGTCTAGTGGAGGAGACAGATGTTAAAATAAATCATGGAGA
AGGCGAACGGCAGAGTACACGTACCTCCGTGTTACGGGTCTGAGGTTGGGGTGAACATCA
AGTGCCTAAGGGGTAAAGATCCAGATGCACGGGCGACACAGAGGGGAGGGCGGAGAGGGC
AAATAAAGCGCTCAATCGAGGAAGGCCTCTTGGAAGAGGTGTGATTTTAGGCAGGTTTTG
AGGGTGGGGAGAGTCTGTCGGATGTGAAGTGGGAGTTCCAGGCCAAAGGGAGGATGTGGC
CAAGGAGACGGAGGTGAGATAGGCGAGACAGAGGCACGCGAGTAGCTTAAACACAACGTA
AGCACAAAAATAAAACTACGGCACATTGAGTCGGAGATTTGAATACTTTTCTGGGACCCC
ATCCTAAAAAAACAACAGCCCTCCCTTGACCCCACGGCTCCCTCTGGTTATTGTGCCATC
TCCTTCCTACCTTCCCTCTCCAAACGTCTTGAGTGAGCTGTTCACACCTGCTGTCTCCAA
TTCCTCTCCTCCAGTTCCCTCCTAGTTCCCCTCCGGTCTGGCTTCCACCCCCTTCACTCC
CCAGAAACAGCCCTCTCTAAGGTAACCAAGGACCTTCTTCTCGCCAGATGTGATGGCCTC
TACTCTATCCTAATCCCCCCAGACCTCTCGGAAGCCTTCCACACATCTCGAAATTTTATC
CGACCTCGGATTCACTGACGCGGCCCTCTCCTGATTCTCCTCCTCTCTCTCCGACCGCTC
CTTCTCAGTCTCCTTGGCGGGCTCTTCCTCTGCCTCCCACTCTCAGACAGTAGGGATCCC
TCAAGGCTCAGTTCTAGGTCCTTCCATTCTCCACCTACACCCGCTCCCTTGGCGAACTCA
TTCACTCCCACGGCTTCAATGGCCGTCTCTATGCAGGTGATTCCCCAATCTCCATCTCCA
GCTCTGACCTCTCTCCTTCCCTGGAATCTTGCAATTCCTCCTGTCTTCGGGACGTACCTA
CCTGACGGTAACTCCTCACCGTTGGCTTCAAAGCGCCCGATCGGCTCGCCCCATCCTGCT
TCACCTGCCCGATGGCCTACCACAGCCCGGCCCGCGCGCTCCGCTCCTCCGGCGCCCGCC
GACTCGCTGCGCCCTGATCTCGTGACCCCTTTCCCAAGTCCTCCCCCTAACCTGGATCTC
CCCCTCCACGGGAACCAGACCGCCACTCTCTCCACCCCCGAAGCATTACTAACATCACCT
CTCCTCCAAGTGGCCTTCCCGGATTAAACCCCTCTTCGCCCAGCGTGGCTCAGCGGAAAG
AGCCCAGCTTGGGAGTCGGAGGTCACGGGTTCGAATCCCTGCTCCGCCACTCGTCAGCTC
TGTGACTGTGGGCAAGTCGCTTCACTTCTCAGCGCCTCGGTTCCCTCATCTGTAAAACGG
GGATTAAGACTGCGAGCCTCACGTGGGACGACCCGATGACCCTGCATCCACCCCCGCGGT
TAAAACAGTGCTCTGCACAGAGTAAGCGTTTAACAGATAGCAACATTATCAACATCTCGC
TCTCCCTTCTGAGTCGTCTGGGCACTTCGATCCGTGACATTTCGGACATCTGCTATTCGC
CCCACCTCCGACCCCACGGCCCTTGTGTACGCATCTTCAAATGATATATTATAAATGATT
TATTTGTTTGAATGACCGTCCCCACCCTTCCCCCCCTTGACCGTAAGTTCAACGTGGGCA
GGGAACGTGCCTGCCGAGTCTGTCGCGGGCGGGGAACCCGTCTGTTTATCGCAGGCTTCC
AGGCGCTTAGTACGGTGCTCTGCCCCCGGGAAGCGCGCGATAAATACGATGAATGAACGA
ACGTCGTCCTCGTCCTCTCCCGAGCGCTTCGGCACGGCGCTCTGCACATAGGAAGCGCTC
AGCGAACACCACCGATCGATCGACGGCAGTCGGGGGAGCAGGGGCCCGGGAGTCCGCATC
TACCACCCGTCTGCTGTGTGACCTTGGGCCGCTCACTTCCCTTCTCTGGGCCTCGGTCAC
CTGGTCGGCAGAACGAGGGTCGAGACCGCGAGCCACCCCCCGCCCCGCCACCCCGCGGGA
CGGGGCCCGGGTCCAAACCGATCTGCTTCCATCCACCCCGGCGCCTGGTCCGAAGTGAGG
GCCGAACGGATACCCCAGTCGTCGTCGTCGTCGTCGTTATCGTTATTCCCGCTACCTTGA
GCCGTTGCCCTCAGAAAGGATCTTCGACGCGATGTGCCAGTTCTTCGGGCCGGGGGGATC
GGGAGGTCGAAACGCGGGGGGCAGCGAGGTCAGAGGAGCGTCGTGAACGCCGCGGGGGGA
AGTCCGCTGTCGGCGGATAAAGGGGCCGCGGCCTCCCGGTGCGACCCAAAAGGGGGGCGG
GCAGAAGCCCCGCTCGGGGCCGCCCGGCCGGCCCGCCCGCCGCCTCCCACCGGCCCCTCC
GGAGGCTCCGGCGGAGCGGGCCGCTCTACGCATGCGCGCTCCCTTCCCCTTCGCCTCCCG
AAAGAGGTTGACATCATCGGTCTGCGCAGCCCGAACCGCTTCGGGGGCCCGAGGGGAGTC
GGGACGACGACGAAGGCGGCGACGAAGAGAAGCTCNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNA
TATGCACATAAGATACCCTAGGGTAGACCCTTATGTCAAAGATCGGTTGCCTCACAGTGG
TCCAAGGGCATTGTTTGAAGACAAGGAGTCTTCAGCTTGTGAATAGACGGTTCACCACCG
GGGGGACTTCTGGCAGGTCTATGAACTTAAAGAAGCCTCAATTTCATTAGCTTATTTATT
GCTAAAATTATTCCGCATCAACAGCGACCAAAGGCCAAGATTAAGCATTTAACAGAGTCC
AGTCTAACTATAATCCGCCCCCCTGCCGCCGAGCGGGCCCGGTGAGAGCGGGCCCATGAA
GAGGGGGCTCTGCCCGGCGGGGGCTTGAGAGCGCCGGGCCAGCGCCGCGGCGGGCCCCGG
CCGCAGAGCCGGGCCGGCGAGGGGGGCATGGACGTGTCGGAGGCCCAGCGGGGGATGGAG
CCGGCGGCCACGGCCGGGCAGCGGCGGCGGCGGCAGGAGCAGGAGGAAGAGGAGGAGGAC
GGGGGCAGGCGGCCGGAGGCTCGGGCCCCGGGCTCGCCGGGACCGTGCGGCGCTCCTTCC
GACCGGCCCCGGCAGAAGGAGGCGGCGGCGGGCCGGGAGGAGCTGAGCTACGAGCTGCAG
CAGGGCTATCGCATCCTCAGCGAGTTTCTGCTGGAGAAGCACCGGGGGCTCACCGCCCCT
TTTTTGCAAGCCGAGAGGGGCGAGGGCGACGGCCCCGGCAAGTGCCGTCCCGGCGAGGAG
CCGCCGTTGGGGCCGGCCGGCGGCAGCCGCGAACTCCTGCAGTCGGGGCTCAGTATGTGC
CTGCTGAAGATGGAGGAGAAGTTCTCCCGGGGCCAGTACGGGAGCATCACGGAGTTCGTG
GCCGATTTCAGGTTGATGTTGGAGACCTGCTACCGGCTGCACGGGGTGGACCACTGGCTC
TCCAAGCAGGGCCAGAAGTTGGAGATGATGCTGGAGCAGAAGCTGGCGCTGCTCTCTCGG
TGAGTGCCGCCGGCCCATCGACCGATGGCGACGACCGGCTGGGCCGGGAGTGGGGCGTTT
TCTAATGGGGGGGGACGGGGGAGCGGCGCGGGGAGAGGAGGGTAGCCCGGTGAACGGTGC
GAACGCGGGGGGCGGGGGGGGACGCGAGAAGAGAGGATGAAAGGCGAGTGGGAGAGGCGG
CACTAAACCCTCCGCCCGGAGAGTGCGTTCTGCCAACACGGACGATGATCCAAAAGCGGT
CCGGACGAAAGAGGACCGACACCCCCCCCCCCCACTTTACGGCCGCCGGTTCGAACTCTT
CGGAGGTAGTTGGAGTTGGTTATTGACACGGAAAGGGACTAGGCTGCCCTCTCAGGGTCG
CCTCGCCGCCGCTTAGCGGAGTCGTGGTAAGCACCGTGTGCGCCGGGGTAAAATAGCCAC
AGGGCTCCCGTCGGACGTGGGCCCCGGCCCACGAGGGGCTCCAGCGGCAGACGGTTTGAA
GGAACGGTCGACGGTCACGGGGCGGTCAGAGCCCACTCGCCGGGCCAGCGTCAAAGGAGT
GAATTCGCTAAGCGGTGCTCCGACGGGGCGTCGCTCGGCTTCCCACCCTCCCAACCTTCT
GGATGGTTTGCGGAGCCTCGGAGGCCGGGCACGGGACAGACCTCACCGCCCCCACCGCGG
ACCTCGGAGTCCCAGTCGGTTGACGCCTCGGGCCCCCAACCCTCTCCCGCCCTCCACTCA
GACCGGGAGCCCGTCGATGGGTAGGGATCGCCTCCCGTCCGTTGCCGGGTCGTACTTCCA
AGCGCTCGGTCCGGTGGTCCGCACGCAGTCGGCGCTCAGTGGATACGATCGATTGAACGA
ACGGACTCCCGTGGAAGCTGCAGGGCCCCCGCCCCCGGTCCCCACCCCCAGCCCCGATGG
CGTTGGCCCCGTTACTCAAGGAAATGCTAAGTGGGAGGAAATTCAGTAATGCAGTCGAAA
GCGAATAGGGGGCCGTGCCGGGGCAGGTTAGTAGTTTCACTTCAACATTTTAATCTGCGG
CCAGGACCTGTCTCA
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1129, 8735..9154
1001..1129, 8735..9154
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved