Ornithorhynchus_anatinus Locus Mono:ACA64
snOPY snoRNA Orthological Gene Database
Ornithorhynchus_anatinus Mono:ACA64
Ornithorhynchus_anatinus
Mono:ACA64
Contig11953
ACA64
1001..1130
2130
CTCACTCTACGTGCCTCAGTGACCTCATCTGTAAAATGGGGATGAAGACTGTGAGCCCC
ACGTGGGACAACCTGAACACCTTGTATCCGCCCAGCGCTTAGAAGAGTGCTTTGCGCATA
GTAAGCGCTTAACAAATGCCATCATTATTATTATTAAGTACCTGGGAGAGAACAGTACAA
CGCAGTTGGTAGATAGGTTCATTCCCCGCAGCAAGCTTACAGTCTAGAGGGGAAGACAGA
CGTTAATATAAATAAATCATTTTTAAGATGTGATTTCTAGATATTTACACAAGTGCCGTG
GGGTTGGGACGAATACCGAATGCCCAAAACTCACAGATACAAGTGAATAAACTCAGAAGG
AGAGGGAGCCGGTTCCCCGGGAATCCAGAAGTAGTCAAAGTTACCTTGGGGGGAAGAGGG
GGCAAAAAGTAAAGAGGAGGGGAATTTCCAGTCCCCTTCGGCAGTCTTGTACGTCGCATC
CAAGACTCCTGCCCAGGCAGGAGCGTCACGTCCCTGTCGTCTGTAACTACTTAAGCAAGC
GCTTAACAAATAATAATAATGTTGGTATTTGTTAAGCGCTTACTACGTGCAGAGCACTGT
TCATGGGTAATCAGGGTGTCCCACATGAGGCTCACAGTCTTAATCCCCATTTTACAGTTG
AGGGAACTGAGGCACAGAGAAGTTAAGTGACTTGCCCACAGTCACACAGCTGACAAGCGG
CGGAGCCGGGATCTGAACCCATGACCTCTGACTCCCAAGCCCGGGCTCTTTCCACTGAGC
CACGCTGCTTCTTCTGATAATAAATACCATTATTATTGTATTGCGGGGTCAGCAGGTTGT
CCCAAGGGGGCGCACAGTCTTCATCCCTATTTTCCAGATGAGGTCACTGAGGCCCGGAGA
AGTGAAGCGGCCTGCCCAGGGGCACACAGCAGACAGGTGACCGGGGCGGTTTTAGAACCC
AGGTCCTCCGAGTCCCAGGGCGGGCGAGGCCCCCGCCCGACGCCGTCTGAAAGTCGCCCG
CGGCCTGACCCGTGGCCGCGAGTGAGACCCCGGCGCCCACAGACACGGGGGCCTAAAGCT
TGTCGCCCACTGCCCTGTAGTGTCGGTGACAAAACCCAGGCCCCGACAGGCCCCCCTTGA
TGATGATGATGATGGTGGCATTTAAGTGAATGCTCTGTGCAGAGCACTGTTCAAAGCGCT
GGGGTAGATACAGCCTAATCAGATTGTCCCACGTGGGGCTCACAGTTTTTAATCCCCGTT
TTTGCAGATAAGGTAACTGAGGCACGGAGAAGTGAAGTGACTTGCCCACAGTCACACAGC
TGACCGGTGGCAGAGCCGGGATTCAAACCCATGACCTCTGAATAATAATGTTGGTATTTG
GTAAGTGCTTACTATGTGCAGAGCACTGTTCTAAGCGCTGGGGGTAGATACAGGGTAATC
GGATTGTCCCACAAGAGGCTCACAGTCTTCATCCCCATTTTACAGATGAGGTCACTGAGG
CCCAGTGAAGTGACTTGCCTATAGTCACACAGCTGACAAGTGGCGGAGCTGGTATTCGAA
CCCACGACCTCTGACTCCCAAAGCCAGGCTTTTTCCACTGAGCCCCGCTGCTTCCCATCC
TTCCCCTCCCCTCAGCACTGTGCTCATTTGTATATATTTTTATTACCCTATTTATTTTGT
TAATGAGGTGTACATCCCCTCGATTCTATTTCTCGTGATTATGTCGTTTTTGTCCGTCCG
TCTCCCCCGGTTAGACCGTAAGCCCGTCGATGGGCAGGGACCGTCTCTCTCTGTTGCCGA
ATTGTCCAGTCCGAGCGCTCAGTACAGTGCTCTGCACGTAGTAAGCGCTCATTAAATACT
ATCGAATGAATACTTCAGTTTGGTCACCCGGTTCCAGTATCAGCGAAAGCTCCTTCGGTC
GATCACCAGAGCACTTACTGTGTGTAAAGCTCTGTGCCAAGCACTCGGGCAAGCACAGTT
GAGTAAGAGACACAGACCCTGTCTTCAAGGAACTTACCGTCTGACGGGAAAGGCTGGCGA
GCACCAGACGTTCTAGTCTTGGGTGAGGAAAGTCCCGTCCAGAGAGGTTTTTACCTGCAG
CGCGATCAGACGTTGAGGATGACCGACCGAA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved