Ornithorhynchus_anatinus Locus RPL7A
snOPY snoRNA Orthological Gene Database
Ornithorhynchus_anatinus RPL7A
Ornithorhynchus_anatinus
RPL7A
Contig11099
SNORD24, SNORD24, snR47, SNORD36, snR47
3685..3761, 5310..5382, 5683..5741, 6040..6114, 7300..7373
9849
TAATCCCGGCTCTGCCGCTTGCCAGCTGGGTGACTTTGGGCAAGTCGCTTGACTTCACT
TGACTGGGAGAAGCAGCGTGGCTCAGTGGAAAGAGCACGGGTTTGGGAGACAGGGCTCAT
GAGTTCGAATCCCCGCTCTGCCACTTGTCGGCCGTGTGACCGTGGGCCGGTCACTTCACT
TCTCGGGGCCTCAGTTCCCTCATCTGGAAAAGGGGGATGAAGACTGTGAGCCCCACGTGG
GACCACCTGATTCCCCTGGATCTCCCCCAGCGCTTAGAACAGTGCTCGGCACCTAGCAAG
CGCTTAACAAATACCAACATTATTATTCTCTGGGCCTCAGTGCCCTCATCTGGAAAATGG
GGATTAATAATAATAATAATAATAATGCTCCCCCAGCGCTTAGAACAGTGCTCGGCACCT
AGTAAGCGCTTAACAAATACCAACATTATTATTCTCTGGGCCTCAGTGCCCTCATCTGGA
AAATGGGGATTAATAATAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCTGTGGTGGATTC
AGAAGTGAAGTGACTCGCCCACGGTCACACGGCCGACAAGGGGCAGTAGCTGGGATTCGA
ACTCATGAGCCCTGACTCCAAAGCCCGGGCTCTTTCCACTGAGCCACGCTGCTGCTCTAA
AACTGTGTGCCCCGCGTGGGACAGCCTGATCACCTTGTATTGCCCCAGCGCTTAGAACAG
TGCTTTGCACCGAGTAAGCGCTTAGCAAATACCACTGTTTCTTCTATTTAGGAGTGAATG
GAGAAAAAGGCGGCCTGGCCCTTTAAATTCTCCCTGGGCCGAATCCCGCGGCGGCGGCGG
CGGCGGCGGCGGCTGTTCTCGCGAGAGTTGATGCCCGCTACATATCACCCACAATCCTCC
GCTCCCTCTCTCTCGCCCCGATGGCCAAGATGGTGAGTGTTCCGTGGTGGGCGCGGGGGA
CACCTCTCGCCATCCGTCGCCATCCGTCGCCATCCGCCCTCGGGGGAGGCCGGGCGGGGA
TCCCCAGACCCCCCCCCCGGCCCCTGCGGCTCCCCCTCTCAGCCCGGACGAGGCAGCCGC
AGCGGGGAAATGACCGCTCCCTGGTCTCCCGGCAGCCGGTCCTGCCCGTCCTATTGAGGC
GGCGCCGACTCTGCGCGGAGCCCTGGGGCCGTGCGTTTGGCGCCGCATGGAGGCGAGCGG
TGGGGCGCGGTGGAAAGAGCCCGGGCTGCAAGTCCGAGGTCGTGGGTTCGAATCCCGCCC
CCAGCTGGGTGACTTTGGGCGAGTCGCTTCTCTGGGCCTCAGTGACCTCCCCTGGAAAAT
GGGGATGAAGATGGGGGATCACCTTGTAGGCTGCCCAGCGGGCATCATAGTAGGTGCTTA
ACACACGCCATCGTTATTATTAAACAGGGAAGTCAGATAACAAAGCAATAATAATAATAA
TGTTGGTATTTGTTAACTATTACTATGTGCAGAGCACTGTTCTAAGCGCTGGGGCAGATC
CAGGGTCATCAGGTGGTCCCACGTGGGGCTCACAGTTAATCCCCATTTTACAGATGAGGG
AACTGAGGCCCAGAGAAGGGACTCGCCCGCAGTCACGCAGCTGCCAAGTGGCAGAGCCGG
GATTCGAACCCATGACCTGACTTCCAGGCCTGGGCTCCACCCACTAGGCCATCCTGCTGC
TCAGCATGGTTGCGGAGACGGTTTACTCTGGAAGGTCCTAGAGTGGAGACTTGCTTTCTT
CCTCTCGGGGACCCCGCCGCAAACCGTGCTGATGATAATTGTGATATTTGTTAAGCGCTT
ACTCTGTGCAGACCACTGTTCGAAGCGCTGGGGGAGATGCAGGGTAATGAAGTTGTCTCA
CATGAGGCTCATAGTCTTAATCCCCATTTTACAGATGAGGGAACTGAGGCCCAGGGAAGC
GACTTGCCCGTCGTCACGCAGCTGATGGCCATCAGTGGTCTGTACTGAGCGTTTATGGCT
TGCAGAGCACTGGGCCAAGCGCTTGGGTCGGCAATAACAATGATGGTATTTGTTAAGCAC
TTACTGTTTGCGATGCCCTGTTCTAAACGCTGGGGTAGATACAAGGAGATCAGGTGGTCC
CGAGTGGGACTCGCAGTCTTCGCCCCCATTTCACAGGTGAGAGGGAACCGAGGCCCAGAG
AAGTGAAGTGAGCCCGTCGTGGGCAGAGATTGTCTCTCTCTCTGGTTCTAAGCGCTTAGT
ACGGTGCTCTGCACACAGTAAGCGCTCGGTAAGTACGAGCGAGTGAATGGCGTGGCCGCT
GGATGGGCCGCCAACTCCCAGGGCAACCATCCCGCTGATAGCCCTCGGTCCGGCGGACGA
GGATGCCGAGAGGGAAGAGATGCCTCCTCCACGTTGGCTGTCCCGGTGAAGGACCGATTT
GTGTCTCTGGGCCTCGACGTGTAATTGCGTTAAGTTATTTGTTAGGCGCTTACGACGCCA
GGGACTGTGCTGACCGCCGGAGTAGCTAAACAGTTTGGACACGGTTCCTGTCCCAGATGG
GACCCCCGATCTTAATCCCCATTTTTACAGGTGGGAAAGCTGAGTCCCAGAGAAGTCGAG
CGACTTGCCCGAGGCCCCACGGCCGACAAGATCAGTCGTTTGGACTGTGAGCCCGTCACT
GGGCGAGGATGGTCTCTAGCTGTTGCCGAATTGGACATCCCAAGCGCTTAGTACAGTGCT
CTGCGCATAGTAAGCACTCAGTAAATACTATTGAACAGGATGCAGAGGTGGGATCGGAAC
CCAGGTCCCCCGACTCCAAGGCCCGTGTCCTCTCCGCTAGGCCACGCTGCTTCTCTACCG
GTTTCCGAGTCTTGGAGCGCTCGACGGAGGCGCGGGGCAGGAGGAGCGGGATGGAGCCCG
GAGACTCAATTGTGCCCTTCCCTCTCTTTCAGCCGAAGGGAAAGAAGATCAAGGGGAAGA
AGGTGGCCCCGGCCCCCGCCGTGGTGAAGAAGCCGGAGGTCAAGAAAGTGGTCAACCCCT
TGTTCGAGAAGCGGCCCAAGAACTTTGGCATCGGTGAGGGGGAGTTGGGCGGGGGGGCAG
CCGTTTCGTTGGGATGGTAATAACGTGTTACACGAACAGCTCTTCGTCAGGGAACTCTTC
CACTGGCCTCCCTGCCGTCCGCTGGTTGCCTTTGTGCCGTTCCCCGGGGCAGTTAGTGGA
TTACGTTTTGCCCAGGGAGGCGCTTGCTGATATTCCATCTGGGTTGTGGCGGGGGGGGAG
GGGGACACCGAGCTACCCCCGCCGGTGCAGATGATGCAAAAGAACATCCGCTGTCAGAAT
GGTCGTGGTGACACGTCGCTAACCACCAAGATCGCTGATGCACGCTTCTCCACACTTCCC
GAGCGTGGCGGCGTGTGGTCGGGGGGAGCCTCAGGGTCGGATTCTGTTTTCCCAGGTCAG
GACATTCAGCCCAAGAGGGACCTCACCCGCTTCGTCAAATGGCCCCGGTACATCAGGCTT
CAGCGGCAGAGGGCCATCCTCTACAAGCGTTTGAAGGTGCCGCCGGCGATCAACCAGTTC
ACCCAGGCTTTGGACCGTCAGACGGGTAAGACGCGGACCCTGCGATCGGCCGCCTCTAGG
CCCCCAGATCAAGAGCTGTAGCCTGGTGATTGCCATGGGGCGTGGGGGTCTGGGTGCCCG
GCGTTTGGGAAAGGACAGTGTGAGTCGGGAGACTCTGCTGTGCTCTTCCAAGCGCTTAGT
TCACTGGGCTTGGAGACCGTGAGCCCGTTGCTGGGCAGGGATCGTCTCTGTCTGTTGCCG
AATTGGACATTCCAAGCGCTTACTACAGTGCCGTGCATCCGGGAAGTAAGCGCTCGATAA
ATACGATGGAATGAATGGTCTGTCCACCGACAGAGCGCGGGCCTGGGAGTCGAGGTCCTG
GGTTCGATTCCCAGCTCTGCCACCGATCTGCTCTGTGACCACGGACGAGTCACTTCACTC
CTCCGTGCCCGTTACCTCATCGAAAAACGGGGTTCGAGACTGCCCTACGTGGGGCGGGGT
CTGAGTCCGACCCGAGGGGCTTGTCGTCGCCCCATTACGGTGCCTGGCACGTAGTAAGCA
CCGAATGGATACCATTAATTGGATGATCCCGGCCCACAAGGAATTCACAGTCGAGAGGGG
AAGATGGGAGGATAAAGTACGGCTCGGCGAGGTGTGCAAATAGGGTGTGTGCATGTGGGA
TGAATATCAAATGCTGAATGGGTGCAGATCATCACCCGTCCATTTGGATTCGTACCCTTT
TAGTACTTGATATTCATCCCCCAACACGTGTAGGTGATGCAGAAGGGAGGGCACGTGAGC
GTTTATTCAGTGAAGGGGAGGTGATTTTAGTGGGGGTGTCGGCTCTGAAGGGGGGAGAAT
TCCCGACCAGAGGGCAGGCGTGATCAAGGGTCAGTGGCCGGATGGATGAGGCTGAGGTAC
GGTGCGTAGGTTGGCTCGGAGCTCTTCACCTCTGCCGGTGATGATATTGGTATTTGTTAA
GCGCTTACTATGTGCCAAGCACTGTTCTAAGCGGTGGGGGAGATAGAAGGTAACGAGGTG
GTCCCAGGTGAGGCTCACGGTCTTGGTCCCCATTTGACAGATGAGGGCGCTGAGGCACGG
GGAAGAGAAGTGACCTGTCCAAGGTCACCCAGCTGACGAGTGGCAGAGTCAGGATTAGAA
CCCTTGATTTAATCATCTGAGCGTTCCCGAGGTTATCCAACCAGCCCTTGGTTTGGTTAG
ACGGATCCGGATCAGGTCTCGCCCCGTGTGGCTTGAAGGGAGGCGGCAAGTCCTGGTTCT
CACTGGACCGCAGTTCTCGGCTTACCCTTGTTCTTCCATTTCCTTTTCACGAATTGAAGT
GTTTATGGCGCCCCGGAACTTTCCCGACAGTGCAGATGATGATCCATATATTTGCTATCT
GAATAGCAGTGATTACAGCCTTACCACCAAGATCGCTGATGCACTAGCTCTCCCAATAAA
AAAAGGACTGCGCCTCTAACGTCAGAAGACTCAAGGAAGCCGGGGGCTGGGGTGGGATTT
TTTTTTTCCTTTGTTCCAGCCACTCAGCTTCTTAAGCTGGCCCACAAATACCGACCAGAA
ACCAAGCAAGAGAAGAAAAAGAGGCTGCTGGCCCGAGCTGAGCAGAAAGCCGCGGGCAAA
GGGGACGTACCCACCAAGAGACCCGCTGTCCTCCGAGCAGGTGAATAGATCCCTCGTTAA
CTCTCCCCACCCCGGGGTGGGACGGGCTACTGCAGTGATGTAAGAATTTCTTCACCTGAA
AGAACCGTGTCGATCGAACGTACGAGCTTTTTAACCCTGAGCCGTAGCCGTCCCGGTCCC
GCTAGCGGGGAGCCCGCCTGCTCTGCCGAGGGACGGCACCCTAAGTCTGGCTACCCTGCA
GGTGTCAACACGGTGACTACCCTGGTGGAAAACAAGAAGGCTCAGCTGGTGGTGATCGCA
CACGACGTGGACCCCATTGAGGTAAGCTCTTTGGGACTGAAACTGCAGATAAGAGTTTTT
TTTTCCGTGTAGTACTGAGGTGCCGGGGGGGGCAGATAAAATTCTGCCATGTGTTGTGAG
ACTGGAAGGGGAGGGATTTTCAGCTAGAGAGTCTTGGCTTTTGCAATGATGTATGAATTT
CTTCACCTGAAAAAGAATGAAGAGCAAATACACGAGCTTTTTAACCCTGAGCAAAGGCCA
CAGACAACCGACGGGATTTTGCTCCCCGTTACCGCTTGGAACTAATCAGAGCCCGCGGAT
TTTTGCAGCTGGTCGTCTTCTTGCCCGCCCTGTGTCGTAAGATGGGGGTTCCCTACTGCA
TCCTCAAGAGCAAGGCCAGGCTGGGACGCCTGGTTCACAGAAAGACCTGCACCAGCCTCG
CCTTCACGCAAGTTAACCCGTGAGTGAGCTCCGCGCTTTGGGTGATGTGCAGTTTGGGGG
GTGGGGGGGTTGGTCTCTGCCCCGCTGCTCTCCTGGAGCTCATTCCCATTGCCTTTTAGA
TGGAGTCGTACTTGAGTGCGTCTGCTTCATCTTCAGCCCTCAGTATGTGGGTTCGAGAAC
TTTGACGCATGAACCTTTTGCCAATGATGCGGAGAATTTCTTCACCTGAACGATTATGTG
GCCGCTTTACGATCCTGAGACAAAAGGCCCGAGTACGGCGGAGTACAGAATCAGGGCCCC
CAGCAGAACGTAGCGTTGTGTGCGCACAGATTAGCGAGAGCACCCCTGGCTTAGATCAGA
GGCCCAGTTTAACGGACAGGCAGTAACCCAAGCGGGGGATGGAAGGACAGGCGGACTTCG
GTTCGAAAGGGGAAAAAGGAAAAGGGGTGGAGAGGCAGAACTGACTCTCTTTGTTCTCAA
CAGCGAGGATAAAAGCAACCTGGCCAAGTTAGTGGAGGCCATCAAGACCAACTACAACGA
CAGATACGACGAGGTAAGAAGAATTCCCAGTGCAGGCCCTTTATCAACCAGTGGTATAAA
GGAGAGGTGTAAATCAGATTACATAAGTGCCGTGGGGCTGAGGGAGGGGTGATGAAGGGA
GTGGGAGAAGAGGAAGCGAGGGCCTAGGTGTCTCGGGGGCAAATCGTCAGATTTTGAAGG
CAGGGAAAGTAACTGTTGGCTAGGAAGGAGGAGGGTGTTCCGAGCCCGAGGCGGAACGGG
GGCAAGATGAGATTGAGGTAGGGTGAGTCGGTTGGCGTGTGCGGGCTGGGTGGTAGGAGA
TCAGGGGACAAGCTACTGCTGTACTTGGCTACTTCAGGGCTAGTTAAATGGTAAGTATGG
TATTAATNNNNNNNNNNGAGGTGCCGGGGGGGGGCAGATAAAATTCTGCCACGTGTTGTG
AGACTGGACGGGGAGGGATTTTCAGCTAGAGTGTCTTGGCTTTTGCAATGATGTATGAAT
TTCTTCACCTGAAAAAGAATGAAGAGCAAATACACGAGCTTTTTAACCCTGAGCAAAGGC
CACAGACAACCGACGGGATTTTGCTCCCCGTTACCGCTTGGAACTAATCAGAGCCCGCGG
ATTTTTGCAGCTGGTCGTCTTCTTGCCCGCCCTGTGTCGTAAGATGGGGGTTCCCTACTG
CATCCTCAAGAGCAAGGCCAGGCTGGGACGCCTGGTTCACAGAAAGACCTGCACCAGCCT
CGCCTTCACGCAAGTTAACCCGTGAGTGAGCTCCGCGCTTTGGGTGATGTGCAGTTTGGG
GGGGGGGGGGGGTTGGTCTCTGCCCCGCTGCTCTCCTGGAGCTCATTCCCATTGCCTTTT
AGATGGAGTCGTACTTGAGTGCGTCTGCTTCATCTTCAGCCCTCAGTATGTGGGTTCGAG
AACTTTGACGCATGAACCTTTTGCCAATGATGCGGAGAATTTCTTCACCTGAACGATTAT
GTGGCCGCTTTACGATCCTGAGACAAAAGGCCCGAGTACGGCGGAGTACAGAATCAGGGC
CCCCAGCAGAACGTAGCGTTGTGTGCGCACAGATTAGCGAGAGCACCCCTGGCTTAGATC
AGAGGCCCAGTTTAACGGACAGGCAGTAACCCAAGCGGGGGATGGAAGGACAGGCGGACT
TCGGTTCGAAAGGGGAAAAAGGAAAAGGGGTGGAGAGGCAGAACTGACTCTCTTTGTTCT
CAACAGCGAGGATAAAAGCAACCTGGCCAAGTTAGTGGAGGCCATCAAGACCAACTACAA
CGACAGATACGACGAGGTAAGAATTCCCAGTGCAGGCCCTTTATCAACCAGTGGTATAAA
GGAGAGGTGTAAATCAGATTACATAAGTGCCGTGGGGCTGAGGGAGGGGTGATGAAGGGA
GTGGGAGAAGAGGAAGTGAGGGCCTAGGTCTCTCGGAGGCAAATCGTCAGATTTTGAAGG
CAGGGAAAGTAACTGTTGGCTAGGAAGGAGGAGGGTGTTCCGAGCCCGAGGCGGAACGGG
GGCAAGATGAGATTGAGGTAGGGTGAGTCGGTTGGCGTGTGCGGGCTGGGTGGTAGGAGA
TCAGGGGACAAGCTACTGCTGTACTTGGCTACTTCAGGGCTAGTTAAATGGTAAGTATGG
TATTAATGTGCTTATGGGGCTCTCAGTCTAAGGTGAGGGGGGGAAAGGGTATCGAACCCC
CAGTTGAAAAGGAGGAGGCTGAAGCCCAGAAGTTAAATGACTTGCCTAAGGTCCCACGGC
GGACAGGGTGGTGGAAGGATTGGAACCCAGGTCCCGAATCTCCCGCTGCTTCCCCCGTGA
CTCTGTCCCCCCCACCAAAGTCTTCGGTTTTTAACCCGACCCCCCCCCCCCCCCCGTTCG
CCTTTCAGATCCGTCGCCACTGGGGCGGCAACGTCCTGGGCCCAAAATCGGTGGCCTCGC
ATCGCCAAGCTGGAGAAGGCCAAGGCTAAAGAACTGGCAACCAAATTTGGGGCTAACTGT
GCCTAAGTGCTATTTTTCCTGTACAGAATAAAGGTGCGATTTCACACTTGTCCCCGAAAG
TAGCCGGGCTGAGTACGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNAGTCGGCCCGTCCCGAAATGAAGGAAAATCAAGTCCCCCACCCCTCACACCACCC
CACTTACTCAGCAGGCAGAGGAATGGGCTCAGCGGTGACCCGCGATTCCAACTCGGCAAT
CAGCTTCAGTTTCCATTTCCGTCGCTGAACCTGAGGGGACGGCAGAGCGGAGCCCGGCCT
GTCCGCTCCAGGGAAGCGGGATGGGGCTCCGGCTAGGTGTGGCCCCCGAGGGCTGGGAAA
CTTCATTTCACTTCATTTCGGGAAGGGCCGTGGGGCACTTCTGCGTGCGGGGGGGGGGGG
GGAACCCAAACCGACCCGCGGGCCGCGCGGGTCGAACGGGCGAAGTCGGGACAACTGCCA
CCCGGTGCCGAGGACGGGGCCGGGGCACGCGGGGAATCCCCCTACCGCTACCGTGGCATC
CCTCGGGCTG
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1351, 3332..3452, 3835..3984, 5479..5619, 5821..5900, 6188..6318, 6783..6852, 8708..8849
1349..1351, 3332..3452, 3835..3984, 5479..5619, 5821..5900, 6188..6318, 6783..6852, 8708..8788
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved