Ornithorhynchus_anatinus Locus Mono:SNORA7
snOPY snoRNA Orthological Gene Database
Ornithorhynchus_anatinus Mono:SNORA7
Ornithorhynchus_anatinus
Mono:SNORA7
Contig11046
SNORA7
1001..1147
2147
ATTTAGTTGCCATTGTTTTTACGAGATGTTCTTCCCCTTGACTCTATTTATTGCCATTG
TTCTCGTCTGTCCGTCTCCCCTGATTAGACTGTAAGCCCGTCAAACGGCAGGGACTGTCT
CTATCTGTTGCTGACTTGTTCATCCCAAGCGCTTAGTACAATGCTCTGCACATAGTAAGC
GCTCAATAAATACTATTGAATGAATGAATGAATTAATAGAGTGAATAACGTTGAAATCCA
TTAAAAGCCCATTCGAGAAATGGGTATCTTAGTAAAATATGAGGTTTAGAGACTCCACAA
AACCCAGATCATTATCATCATCATCTTCTCCTTCTCCTCCTTCTCCTCCTTCTCCTACTC
CTTCTCCTTCTTCTTCTTCCTTTTATAAAGCTCCTAATCAACCAATTAATAAAGATTCAT
CAGGGTTTTATTTCCAATCAATTAAGAATGGGAGAGTTAATTAAGCCCTGCTTCACTTAT
CAGAATAAAATTGGCAGAGATGGACCAAAACACTAGCAGTTCTAATTGTATATCTTTATT
CCCATTCCTTGGATCTTACCAGTTCCTCGGGTCATTGTAATGGCCAATGCAAAACACCCA
GTTCTTGAGCATAATTATCATGATAAATAATAATAATCATAATAATAGTATTTGTCTCAA
ATTTGAGCACCATGTGAGACAGGGATTGTGTCCAGCCTGATTACCTTCTATCTACCCCAG
CATTTAGAACAATGTTGGGCACTTAGTAAGCGCTTAACAAATACCATTTTTTAAAAAAAG
AAAAGTATGGGAATGCCTGATGGTTGGATTGAGACTGTGAGCCCCACGTGAGACAGGGAC
TGCGTCCAACCCGATCTGCTTGTATCCACCCCAGAGCTTAGTACAGTTCCTGGCACATAG
TTAAGCGCTTAACAAATGCCATAATTATTATTATTAACCACTGGTGACATCCTTCGAGGC
CTAACAGGAATAATGAAAAATAGTTGGCAAATGTGGGTAGCCCCCTCTCAGGATGGCATT
TGGAGAGTTTCCAGTACTCTACCAATCTCAGCTATTGGAGGGAGAGCAAACCAGAGGCTA
CCCATTCCATTCCTAGCAAATGGCAGGCTAGCGAGTGGCTAGCGAGTGGCAGGCCATCTG
CTACAAGTCAAAACTCACCTGGGCTGGGCAGTAGCGGCATGGGAGACATTCAAGGGCAGA
GACCCAAGGTAGGGGCTGGGAATCAGAGGAGAGTCCGTGAAAGAGAGGGATAGAAAGATC
GGCCCGAGAGATAGGAGAAACAGAATAGGACGACACCAGTGAAGCCAAGGTTGAATAATG
TTTCCAAGAGAAGAGGATGGTCGACATTGCCGAAGGCAGCTGAGAGGTTGAGGAGGAGTA
GGATGGAGTAGAGGCCATTGGATTTGGCAAGAAGGAGATCACTGGTGACATTTGAGAGGG
AAGTTTCTGTGGAGTGAAGAAGGCAGGAACCAGATTGAAGGGGATCAAGGAGAGAAATGG
AGGAGAGGAACTTGACACAGCAGATGTAGAAGATTCGCTCAAGGAGTTTGGAAAGGAATG
GTAAGATGGAGATGGGGCGATAACTGGAGGGAGCTGTGGGGTCAATGGTGGGTGTTTTAG
GCCAGGGGAGACACGAGTATGTTTGAAAGCAGTGGAGAAGAAGCCAGTGGAGAGTGAACA
GTTGAAGATGGCCGTGAAGGAGGGAAGGGGGTTTTGATAAGGTGCAAAGGGATGGGGTCA
GCTGTGCAGGTGGACGGGGGTAAATTTTGAAAGAAAGGAGGAGCTCACCTCTTGAGATAC
TGCTGAGAAAGGTGGGAGAAGTGAAGAAGGGGCAGGAGGAGAGAGGTAGAGGAGAGTAGC
AGGAAAGATTTCAGGGAGAATATGCCTCATAGCTTCAATTTTCTGCACTAAGTGCTTACT
GTGTACAGAGCACTGTACTAAATGTTTGGGAGACGGACAATAGAATACACTGTCAACCCA
CATATTCAGTCCATCACTAACTCCTGTCAGTCCCCACCTTCACAACATTGCTAAAATCCA
CGCTGTCCTCACCTTCCAAACTGCTACCATGTTAATTCAATAACTCATCCTATCCTGCCT
GGATTAGGAGAAGCAGCCTGGCTCAGTGGAAAGAGCCCAGGTTTGGGA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved