Ornithorhynchus_anatinus Locus Mono:SNORD22
snOPY snoRNA Orthological Gene Database
Ornithorhynchus_anatinus Mono:SNORD22
Ornithorhynchus_anatinus
Mono:SNORD22
Contig108934
SNORD22
3..129
1129
GGTCCTAATGAAGAAAACCAGCACCTGTCTTACTCCTTGTCCTGGCCCCAGAGCCTGCA
AAGGCGAACCCACTGGGGTCGGCTGGGGGAGAAGATGATAATCTGTTCCAGCGGGAACAG
TCTGAGGGACCCATGTTTAAAAACAAATGAATTTTTTGTGGTTGAGCTTTAATGCCTCAG
CTGCATTCCCTTCTTGCAACAAACGTGGCTCAGTCATTACGTCTTATCATGACTTTGGAG
AGCCTTTTCACTGCTATGTAACCCCTCAAGTGATTAGCTAAAGCATATCCAACTGGCCAT
ACCTATATCATCTCCTTTTACCGTGTACAATTTTCTGCTTAAGTCCACTATACATATATG
CTGTGCACATCAGTTGAGAACATGCACCTTGCCTTTTAGAGGATTTTAAGTAACACACCC
TTTTACATAACTTTTTTTCTGCAGATGCTGTTGAGCATTTAAGCTCAGAACAACAAAACA
TGGTGAAAACAACCCTTCTCATTCTTTAAATAAACTTTAAAAGACTACAGATTTGTGTCT
TGTGATTTTTTGGTGGTGGGTTAAAAACTGTGGGAAGGGTACATGCCTTTCTTCCTAACC
TCACTAGTGGTTAAGGTAGTTTAACCCAAATATTCTGTACTTCATTTACTATTTAACCAT
CCCAACAAAGAAGTGCCCCAACTTTTAAACCCCAACTCCTGCATCTGCCAAAGTCTACAA
AGCTGCCAGCCAAAGTTGTGGCAGGAAAGGGGGAGCTAATGATGACCAAGAAATTAGGGC
TCCATTGGGGTTGCGGTGGGAATGGATAGCATGAGTGGTCTTAAACACAGGGGGCTAGTT
TTTCATCCTTGGGCGATACCCCCATCAAAAGTAGCTGGAATCCTGCTCCCATTAACTGTT
GTCCAAGAAATCAGCAGGGTGGGGTGGAGAGAGCACTAGCCTGGGCTTGAGAAGGGCTGG
GTTTTAATTCAAAAACATGTCTGTGTGATCTAGCATGAGATTTACTTATTGCCTTAGTTG
CCTCATCTGGAAAATGGGATGCCCACCTGTGAGCTCCAGGACAGTGAGCATCAATTTTCT
TTTATCAACTCCATTTTATCCAATGCCTGCCACAAAGCAAGCATTTAAAT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved