Ornithorhynchus_anatinus Locus RPL13A
snOPY snoRNA Orthological Gene Database
Ornithorhynchus_anatinus RPL13A
Ornithorhynchus_anatinus
RPL13A
11
snoMBII-202
4650..4739
6893
CCCGGGCTCTTTCCACTGAGCCACGATGCTTCTCTACAATTCGGCAACCAATAGAGACG
TCCCTACCCAACAACTAAGCTCCACCATCTGCCTGCTGTGTGACCTTGGGCAACTCAATT
CATTTTCTACCTCAGTTTCCTCACTTGTAAAAGGGGGAATAAATATCTGTTCTTCCACCC
TCCTAGATGGTGAGTCCCACAGGGAACTCATCGTTTGTTTACCCCAGCGTTTAGTATAGC
GTTTGGCCCATAGTAAGCGCTTAACAAATACCCAAATGTTATATTTCAGACAAAGAAATG
TTTGTTAGGGCTAAACCACATTGGGAGGGTTACCCCAAAACGGACCCGAATAATGTAAAA
CGTTTAGGGAAATAATAATAATGTTGGTGTTTGTTAAGCGCTCACTATGTGCAGAGCACT
GTTTTAAGCGCTGGGGTAAATACAAGGTAATCAGGTTGTCCCACGTGAGGCTCACAGTTC
ATCCCCATTTTACAGATGAGGTAACTGAGGCCCAGAGAAATGAAGTGACTTGCCCACAGT
CACCCAGCTGACAAGGGGCAGAGGTGAAATTCGAACCCATGACCTCTGCCTTCCAAGCCC
AGGCTCTTTCCACCGAGCCACGCTGCTTCTCTAAATCAAAGCGTCATCATTTCCGATTAG
ACCGTGAGCCCGTCACTGGGCAGGCATGGTCTCTCTCTGTTGCCGAATTGTCCATTCCAA
GCGCTTAGTACAGCGCTCTGCACCTAGTAAGCGCTCAATAAATACGATCGAATGAATTTC
CCACGGGAAAACAAGCGGCGCTGGGGGAAGGCCCAGCCTCCCTTATTTTCTGCGCGTCCC
CTTTAAATTGGGCTCCATCTTGGTAAAGGCAACTACGCGCCCTCGCGCCAGTGCCCCGCG
TCCTTCCTTCCGATTGGCTGGGGAGCAACGGAGCTTTTGATAGGCTGGAGGGGCTGCTAT
CCCGGCGTGCTCTGGGGCTGGATCTTCCTTTCCGCTCGGCCGTTCTCCGCGCCAGGAGGG
AGGTGAGTCGGAGCGTCGCCGTCGCCATTGACCATCCGGAGCCATCCGCGGCTGGGAANN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAATAATAGATGTTG
GTATTTGTTAAGCGCTTACTATGTGCAGAGCACTGTTCTAAGCGCTGGAGTAGATACAGG
GTCATCAGGTTGTCCCACATGAGGCTCACAGTCTTCATCCCTATTTTACAGATGAGGTAA
CTGAGGCCCAGAGAAGTGAAGTGATTTGCCCACAGTCACACAGCTGACAAGTGGCAGAGC
CGAGATAATCCCATGGGGATGGTGACTGAATGAATAATGATCCAATGGGGAGGGTAACTG
AATGAATGATTCCATGGAGAAGGTGAATGAATGAATGATCTCATGGGGATAGTGAATGAA
TAATAATGTTGGTATTTGTTAAGCGCTTATTAGGTGCAGAGCACTGTTCTAAGCGCTGGG
GTAGATACGGAGTCATCAGGTTGTCCCACGTGAGGCTCACAGTCTTAATCCCCATTTTAC
AGATGAGGGATCTGAGGCACAGAGAAGTGAAGTGACCTGCCCACAGTCACACAGCTGATA
AGTGGCAGAGCCGAGATAATCCCATGGGTTGGTGACTGAATGAATGATCCCATGGGGATG
GCGCACCTGGGAAATGGAGGAGCTTGGCCTAGGGCCAAGTGCACCGACTTGGGAGTCACA
GGTCGTGGGTTCCAATCCCCGTTTCGCCACCTGTCTGCCGGGTGACCCCGGGCAAGTCAC
TGCTCAGCCACCTCGTCCACAGAATGGGGGGTTGAGACGGTGAGCCCCACGTGGGACAAC
CTGGCGACCTCGTCTGTACCCTCCCCCGCCCTTGGCATAGCGCTTGGCACATTGTGAGCA
CTTAAATAGTACCAAGTTATTTATTGAAGAGGCTAGTCGGGGAGCAGAAGTGACGCAGGG
AGGCAGGCTTGGTGTCACCTGCCGTGTTGAGGGGTCACCCACCTTTGGTCCTGCAAGGAT
CCCGACTTGCGACCAGGCAGGCCGAGCTGTTACTCGGGGGTGGGTCATTGGTATGTATTT
TTATTCATTTGCATATATTTTTATCACCCTATTTATTTTGTTAATGAGGTGGCCATCCCC
TTGATTCTATTTATCGTGAAGATGTTGTTTTTGTCCGTCCGTCTCCCCCGATTAGACTGT
GAGCCCGTCAGTGGGCAGGGATTGTCTCTATCTGTTGCCGAATTGTACATTCCAAGCGCT
TAGTACAGTGCTCTGCACATAGCGCTCAGTAAATAGTATCGAATGAATGAATGTGGTTTT
CTCGGCCTGCAGAGTCCTTAGGCGCTGGGCTTCTTAACCAAAGTTGCCAGGCTTTGCAGA
CGTCAGCTGCTGCCCTAAGGAGAATGTCTCTTGTGCTTTCAGGGCCCTAGGCAGCCATGG
CGCCCAGCCGAAATGGCATGATCTTGAAGCCCCATTTCCACAAAGATTGGCAAAGAAGAG
TTGCCACATGGTTCAACCAGCCCGCCAGGAAAATCCGCAGGTAAATCTTTGGGGGGGCGC
TTGGAGGAGCATACAATTCAGGATCCTGAAAATTAGCGGCTTTAAAAAAATCTGTAAAGC
AACTACTGTCAGCCCTGAAACTAGAGGACTACTTGATTGTAACTTCCATCTTACTTTAGG
AGATGCTTTTTCTTGTGGGTGGTCAGCTGGAAATAAAGTTGCAATCTATTTGCAGTGACT
TTTGATTTATTGTCTTTGAAAAAGAAGATAGGGAGCCCCATGGGCCTGTGGATCGCACAC
TTGGGATTATTCATAACTTTTTCTGAAACTCGCTCCCGTGTGGATTTTAAGTCAAAACAA
ACGTTTATGCAGAAAGTACTGGATCAGGGAAGTAGTATAGTGAATAGAGACCGGGACGTA
CAGTGAATGTGCCAGGTTGAAATAATAAAATGCATAATCAGGCGGACAAAAGTGGTGGGG
ATGGGTGTAAATATGTGGAGTGCTGTGAGTGACTCCAGTTGACATAATTTTTGGTGTGGG
TAATTAATCGGGGGTGGTTTCCTAGAGAGAAGAGGTTTTGGAGGGTTGGGATCTGGGTAG
GGTAGGGAGGGAGGCTCGAGTTAGTGGAACAGGAAGCAAGGGATCAGGTGGAAGCCTTGA
GCAAGATAATTAGGTGAAGCTTAGGAAGGAAGTATATTGGGATGTAGTGAGTAAAAAGAG
CTGATACTGCCGGGGTAGCCTTTGGAGGCTTTTGCAGAACAAGAAAAGTTTCAAGGCATA
AGGCATACGATTTGGGACAGCGGTTTTGGCGTGGACTGAAGAGAGGCTGGTGGTCAGGGA
GGCCTGTAAGTAGGTTGTAACAGACCGAACATGATGCTCGGACCCAAGGTGGAGATGGGC
CCCTTCTATTCTCCACGGAGAACTTTATCGCTCCCATGGTTTTAGCTACCACTTTTTAAG
TCATCTCTATTTTGATGGTCCATCACCGCCTCAGACTTAATATGCTCAAAACATATTTAC
CACTCCTGTAGACAGCACCACCATCCTCCCTGTCTCACAAACCTGTAACCTTGGCATTAT
CCTCAACTCATCTCTAATTCAGCGCACGTTCAGTCTGAATCTGCCCTTTTCTCTCCATCC
AAGCACTTACCCTCTCTCAGGTTCCTTACTTCATCAGCCTCCTGTCTCTCCCTAATTCAG
TCCATATGTCACTCTGCTGCCGTCATCATTTTTCTATATAAAGTTCACTCCATGTTCCCC
TGCTTAAACCTCCAGTGGTTGCCCATCCACCTCTGCATTAAACAGAAACTCCTTAGCATT
GGCTTTAAAGCACTCGATCAACTCACCCCCTCCTGTCTGATCCCACTGATTTCCTTCTAA
AACCCAGCATGCTGACTTCAAGCCTAATGCCAGTCTACTCAGTGTACCTCAATCTCACTT
ATCGCCGACCCCCTCAACAATGTCCTGTCTCTGGAACTCCCTCCCCGCCTCGAAAGCCAT
CTTAAAATCACATCTCCAAGAGGTCTTCCCTGCTTAAGCCCTCATTTCCCCATCTCCCTC
TCCATTCTGTGTTGCCCTTGCACCTGGATTTGTACCCTTTATTCACCCTCAGCCTCACGA
TGCTTATATATTTCTAACACCTGTCTCCCTTTCTAGACTGTGAGCCTCTCGTGGACAGGG
AACCATGTCTGCCAACTCTTTTGTATTCTCCCAAGTGCTTAGTACAGTGCACCGCACACA
GTGAGCGTTCAGTACGTTCCATTGATCGGTTGCCTCGGAAGGGAGGAATTTGTCTTTTAT
CGACCTCCGCTTCTCTCTGTCCAGACGAAAGGCTCGCCAGGCAAAGGCCCGTCGCATCGC
CCCTCGCCCAGCATCTGGTCCTATCCGGCCCATCGTTCGATGTCCCACAGTTCGATACCA
CACTAAAGTTCGGGCTGGGAGAGGATTCAGTCTGGAGGAGCTGAGGGTGAGTACCGGTAT
TTCTAGGCTGGACATTACGCTTTGGTATTTTGGCCAAGTGTTTGGTTTTTCGCTCACATA
CCTTGACGTAAAACCTGGAAATACCGAAGGGTGTCACGGTCCTGGGCCGTCGTTTCCAAG
CCTTGGTTCTGAGTTGGCCTCACAGTCAAATGATGACACATTCTCCGGAATCTCTGTACT
GCCTCTGATGAAAGTATAATTGAACCCTTTTCCATCTGATGACTGCGGCTGCCGCTCAGT
TGAGCATGGAAGCTATTTAGCTAGAGAGGGGACAGCACCTGATACTTGTGTCTCTTGGGG
GGCGCAGATGGCCGGGATCCATAAGAAGGTGGCACGTACCATTGGTATCTCTGTGGATCC
CAGGCGACGGAATAAGTCGACAGAATCCCTCCAGGCCAACGTGCAGCGGCTGAAGGAGTA
TCGCTCCAAACTCATCCTCTTCCCGAGGAAACCTTCTGCACCCAAAAAGGGAGACAGTTC
TGTAAGTATGGCCGGGGTTTCGTGGTATCCGTGGGGCTGTTAAAGCATCCGCCTGGGGAA
TATCTTAGGACACTCGAGGAATCGCTTAACACTCTGAGGTTTCTTGACTGGTGTGAGATG
CACTGATGGCGTTTGGTTTTTTGTTTTTATAGGCTGAAGAACTCAAGATGGCCACGCAAC
TTAGAGGACCAGTCATGCCCATCAGGAATGTAAGTGAATTATTGGCTTGGGTGGAAGTTC
TCTTAGCAGCGTTTGTTTCTGCTTCACGGATAGGATTGAGGGGCGGTGTTAAATGGTGGG
CGGATATTGCAATTGGGGTTTGGCACCTACTGGTAAAAAAAAAAAAGGGTGAATTGAGGT
GTCCGTTGATTATAAGGAGCTTATGTGTCGGTAGAGGAAAAGATCCCAAGGAGTTGGAAA
GTTCAACCTAAATTCCAATTTCCTTTAAAAAATCAATTTCCGATCACGAAAGGCACTTCA
ACTTGTCTTCTTTACATCCTAGTTACTTCTCTGCAGTTTAGATCTCTGGTTTGACCCTGT
TTGTTAATGGTGGCGCCCGGGCTCTGAAATTGTTCCCCCTCTCCCTGACAATTTGTATGA
ACTAATTGGCTTTCCTGTCCTTGCAGGTCTACAAGAGAGAGAAAGCTCGGGTCATTACAG
CCGACGAGAAGAAGTTCAAGGCATTTGCAAGCCTCCGGATGGCTCGGGCCAATGCCCGTC
TCTTCGGTATCCGTGCAAAAAGAGCCAAGGAAGCTGCGGAGCAGGATGTGGAGAAGAAAA
AATAAATGGCTCTGTTGGGAACTTGCAATAAAATATGACAAAACATCCCTGAGTCTTGTG
GTTTGGGGCTAGAGGCAGACTGGAGACGAGGGCATCTGGGCTCCGTTTTGTAGGACCTGT
CTCCAAATGGTTGTCTGCAACTAGTTTTTCTGACAGTCGGACAACCCTCTGATTTAATCC
TAGCTGCGACGAGAAGAGACCCAAGACCTTGATCGGCCGTATTAATCAGTGGTATGTGAG
TGCTCGCTGTGCATAGAGGTCTGTAACCGATTCGTGAAAGCAACGATCTGAATAGTGTCC
ACTTCTAAAAAGCGTGGTCTAGTGGGTAGAGCAAGGACCTGGGTTCTAATCCCCACTCTG
CCACTTCTCTGTTGTCTGACCTTGGGCACTTGCCTGTTACCTCATCTGTAAAATGGGGAT
TAAAACTTGGTATGGACAGGGAACACGTCTGTTAATTCTGCTGTACTCTCCCAACCGCGT
AGAACGGTCCTCTGCACACGGTAAGCGTTCGATAAATATGATTGTGAGCCCTATGTGGGA
CAGGCATATCCAGCCTAATTTGCTTGTATCTACTTCAGGGCTTCATAGAGTGAACGCTTA
ACGAATGCCAGGATTATTATTAAGCACTTACTAGGTACTAAGTGCTGGGGTAGATAAAAA
GGTGATGGAATTGGACATCGCATCACCACCATCCTCCCTGTCTCTGTGGTGTTATCCTCG
ACTCGTCTCATTCAACCCACGTATTCAATCTGTCCCCAACTCCTGTCAGTTGAATCCTCA
CTGCGTCGCTAAAATCCACCCTTGCCTCTCCATACAAACTGCTCTCACATTAATCTCAGC
ACTCATCCTATCCCACCCTTTGTCTGGCTCTCCCTTTTAGACTGTGAGTCCATTTTTGGG
CAGGGATTGTCTCTGTCACCCGGTTGTGCCTTCCAAGGGCTCAGTCCAGTGCTCTGCACA
CAGTAAGCGCATCTGTGTCTCACAGGGCCCGCAATCTTCAGGCCCAGAGGTTAAGCAAGC
TGTGTCTGTGTGGGCTGTGAAAGCTACAAGCCAACCCTACAGCGGGATTCTAAAAATAGT
AATGATAATGTTGGTATTTAAGCGCTTACTACGTGCAGAGCACTGTTCTAAGAC
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1021, 2442..2559, 4344..4485, 4807..4980, 5132..5188, 5606..5893
2456..2559, 4344..4485, 4807..4980, 5132..5188, 5606..5764
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved