Ornithorhynchus_anatinus Locus Mono:SNORA13
snOPY snoRNA Orthological Gene Database
Ornithorhynchus_anatinus Mono:SNORA13
Ornithorhynchus_anatinus
Mono:SNORA13
7
SNORA13
1001..1110
2110
ACGAGTGGCAGAGCCGGGAGTCGAACCCATGACCTCTGACTCCGGAGCCCAGGCTCCTT
CCACTGAGCCATGCTGCTTCTCTGACCGTATGACCTAATATGGCTTTGAAGATAGGGAGA
GTGGTGATCTGGGGTGTTTGAATAGGACGAGAACACTCTCAGAGGGAGGAAAGACAATGT
TGCCTTGCTTTCCGACCTGAGGCTTTTTTTGCTTTTTAAGATAAAAAATCTTATTCAGTG
CTGCCCTAGTTTCAACAATGGCACACTGGTAATAACAAGGGACTACAACGATACACAAGA
AAGTATCGTAGATGGAAGTGTTTTGGGACGGCCTTTCCGGTTTCACATTGCGGGCTAGAG
TACAATGCTGCAACACTGTTGCCTTTCACTAATTGATTTTCTTTGAGACAATTTCATCTG
ATGTTAATCCACAATGGCCTCGCCAATAATTTACTTCCGTAGTAACTAACAGTTACACTG
ATAAATAACAGTCCCTTCTCGGGTCAATGCTCAATCTAGGTTAGTTCCCACTGTTAAAAC
TTGAAGCTTCTGGATTCCGAAGATTTNNNNNNNNNNAATCATATGCAGTCGTTAGGAAGC
AGGAGGGGTTGGTGGAAAGAACACGGGCTTGGGAGTAAGAGGAGGAGTATTTTATTTCCG
GATCCAGCAGTTTTGATTATATCCTGCGTGCCATCGGGCAATGTGCTTTTACATTTTTGT
GGTTCAGATCCATCATCTGAAAAAGGGGGAGTAAGGGTGTGAGCCCCATGTGGGGATGGT
GAAAAGATATTGCCCATTCTGAGGATGTGGGTTCTAATCCCGCCTCTGCCACTTGTCTGC
TGTGTGACCTTGGGCAAGTGACTTAACTTCTCTATGCCTCAGTTACCTCATCTGTGAAAA
GGGGGTTAAGACCGTGAGGCCCACGTATCTTGTATCTATCCCAGCGCTCAGAACACTGCT
TGGCACATAGTAAGCACTTAACAAATATCCACATTATTATTTGCTACGGTAATGACTGGG
GTGTCAAAAGAGGCACAAATTATATGCTCTGCAGCATGTTTGATTTTAGGAGTTACTTCC
TTTATTCTTTTGCTGCTTTTGAGGGACATTGTTATGGCTGAATTGTACTTTCCAAGTGCT
TAGTATCAGTGCTCTGCACACAGTAAATGCTCAATAAATACAATTAAATGAATGAAAGGA
TTGACAGCAAGATTGATGGGATCGAGGCATAGTGAGCAACTTGGCACTAGAGAAGCAAAA
TGTCTATTACTTCTATTACTACTATTGAAGAAAAAGCCTGGAGATTTTGGGAGAGAGACA
TAAACCTGCCAACTCCTCAGATGTTTCGTGCCCTGGCAGGGCCTCGACCTATTTCTAGGT
TAAAAGCCAAAACCCCACCAACTCTGTAGGAACTGGTTGCTTTCTTGCAAAGCTGGAAAG
TATGTGAACATCATGTGTTGCTCTCCCAAGATACCAGCCCTCCCTGTTCACTCTTCAAGG
TAACTGTAAGTTTATCTTGGAAATTATGGGGCGTTCACAAGAGAATGGCCTACAACTCAG
CTGTCAATCAAACAGCAAGGGAAGGGCCATCAGTTCTCTGCCAATTAATGGCAGCTAATA
ACTCTGTGTGGCCCCCAAGTGAGTCAATGACTCGAGGCATCCGGCAAAAGGCATAGTCAT
AATAATAATAATACTAATAATTATGCTACTTGTTAATCACTTATAATATGCTGAACGCCA
TCCTAAGCGCTGGTGTAGATAATAGGTTGGACCCAGTCCCTGTCCTAGGTGGGACTCACA
GTATTAATCCCTATTTTACAGATGAGGTCACTGAGTCCCAGAAATGTTAAGTGACTTGCC
CAAGGGCACACAGCAGACACAAGGCAGAGCCAGAATTAGAACCCAAGTCCTTATGATTCC
CAGGCCTGGATTCTACCCACTAAGTCATGATGCTTCTCATTCACATCCAAAGACTATGGT
CCCAACAAGCTGGGTATCAGCTGATCCCCAAATCCCGCAAACAGATCCTGAAAGAGGTGG
ACGAAACCATGACCATCACAAGACATCTTGGCTTTGAGATTTTTTTTTGGCAAATGGAAA
TATTTTGCCCT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved