Ornithorhynchus_anatinus Locus ENSOANG00000014000
snOPY snoRNA Orthological Gene Database
Ornithorhynchus_anatinus ENSOANG00000014000
Ornithorhynchus_anatinus
ENSOANG00000014000
4
SNORD127
8733..8820
18275
ctgcttgtgggtggtggtgccctttgacttttcgtacggtcaagaagatggtgatcctt
ctggcgtgtttccataggactttgtttaacgcaaggaaacagcagcagtggctatgcaga
attctactcctatggatgcctacagcatttccagcaatgggaaccccgccggcagttcgg
aagtggccacggagcaacctgctgatttcaggactgaaattatgaatgtgacggagatgg
aacagtcgcccgacggctctcccagtctgaacgaagagcccgccgacgagagtgaaataa
ccaatgtcggagagctaccggggacagatgttgaagcacagtttcctgcagaatatgaaa
agttttggaaagcggtagaagataatctccaggattttacaggctgggtgtacttgcttc
agtatgtagagcaggaggttagtaactatagttttggccgagagcaaaaaaaaaaaaaaa
tcagatctccctgcccttaacgagtttcttatctcagtatttatgcaatgacaaaatgct
tttccagtcaaacttttctttagtaattcagcatgtgaaactgtcttgaagaaaattccc
accttctcgtttggatttatctttttaaccaagttaatggtaccaccagtctccagatca
ttaactttgaaaaataaattattaagcattttaatgatctgttttgctttgagctgaata
gatgttaacaacactactccgtttaaaaggacctttcaagtaatactttcaagcttgaca
aattaacaagttctgttccagtccaagaattgcttgcttaaaaacgtatagtcgtaccgt
gagttcagaatttaattttagtgatacttgggcttgagggaatctaatgtgatcgagtgt
gacttaattatttgtctgtttagcaaagaagattggatgagttacatggaagcaataaaa
tcgatttattaaaaccacgctgctgtttttttccccctcccCTTTTCCAGAATCACCTAC
TGGCTGCCAggaaagcatttgacaagtttttcacacactacccatattgctatggctact
ggaaaaaatatgcagacctggagaagcgacatgacaacattaaacaatcagatgaggtag
gttccttgttggataaagttaacacctttgggtactgaaagccaaatgatgataaaaaca
agggctttttaaaatttttattttttttttaatttttttggctaGCAGTACCTTCCATgt
atggtgaaacaattttacagggtattttatttgcatttgtcactcttgtggcatttgtag
ctaatgttttctctctttgttggcaggtgcgttaaacctctacagtttgtcaagctttgc
agtgcaagcctctgtattacactgcagcttaacaagtagggcagggcttttctctcactt
acatttatttctcattttccaaacaatatagttggtttgctagtcacatttgctacgtct
tattgcatttttggtcagacgctgtcattgatgctctaatgggtctgtgccctatggtct
gtaccccaaagcctgcccacacaacccggtcagaacgcagggaccgctgcgctttgaaga
tcaagactctgcacgtggagatcagaacattgccatgttctatccaacctccacccaaat
ggtaatggtagattatttaaacaaaattccagtaattagtatttctaaggttcaccggat
aacacagtgcctctctgttacgaaccaattaattatttgaagtacagtttgtgcttttct
tcttaggtgtatcggagagggcttcaggcaatacctcttagtgttgatctttggatccat
tatataaacttcttaaaagagaccttggagcctggcgatgcagagacgtgccatacagtg
agagggtaggtcagccatctgataccgacacccggctagcgctccgatcgcgggggcgtg
tgccgcccccaccccggactccacagccgcggaagcacaaccgaagttgttgctctgagg
gcagaagtcaaatctcggaatagctgagccctttccgccccgcttggcggtccaagtcct
tcgtgttgaaagagctttccaaagtgtcggggtaattttccagtttctgcccactcgggg
atcagttaaattcgatttagcattccgtctgaatatcttcttaaaaagccaagagatgct
ttctcggcagcccgtcagaataattgacctagatacgacctgttgtttcagaacctttga
acatgctgtgctagctgcaggaacggatttccgcTCCGACAGATTGTGGGAAATGTATAT
AAACTGGGAAAACGAACAGGGAAACCTGAAGGAAGTCACGGCTATATACGATCGAATCCT
TGGCATTCCAACGCAGCTCTACAGCCATCATTTCCAGaggtgaggggataccgcaggttt
cggttaactccgttattaatctgctcggcaccgagtacagcttaacgggtgagaatgcga
gtgacggctcctcgtattcaggtcccgatagcgctgtagtacgccgggtcagagacgact
cccggcttgcgagtgatcgtcccggcatgcgtaggcaaggtggcttggaggggaaggagt
ggagaccggtgagtcccggggggggctgaagcctgacggcgtcagcccagaaagacagtt
cggggagaagggagcaggagagacctgacagagacactcaaccaaaaggcagagacctct
atgtctttgaaaacggatttactctgtcttctcagacatgttcacaaagatgaacacccc
aaaagcagagctcaaaaaatacacctgagcgcaccccaggtagaagagttacacagggag
ctgtgttctttcagaaccttgcagtaaggaagaattgcctcacgcttggcactctcctct
tgcctgacgctgcacttttgtgcgcggcattttcttgcgaaagcacatcagcctccgtcc
ggaccgacctgcgggggtcggaggaacggtccccagttctcccgtcgtgttccgtcctaa
acgtggagtgaaaaagcagggttcaggcagaactgagggtacggtggcaatcgaagaaca
gtgtgttaggtaaacccgtacccccgaacttgacggtctgacagacactgacgtagccag
aaactgaaagatccgtaactgacctcaaaatgtattgcgtataggcggaggagttaggga
attcagtagggtggagcgatactagagaaagggcgtctaaacgaggtggcagcaaggagt
tgtgtggaaaagcaattatgggcgtagcgggcgttggcggcccttggcagggtggcacaa
gaagcgatcctggcggcgtgccagcctccggccagagacgggatagcgagctcgtgccgg
tgactgcagggttttgccgattctggattcgggtcctcacttctcgccgtgcgtcccctg
tggcggcagggcgtgcccaggctgaaactggagtcttgggggcagggacttgaactgaca
agggttggcaattgttgccagggcatatcctgggctctcaggtagtgcgacttaccgcca
cctccaagacccccacgttgctctgccaccagagtggcaggggggagagtggcagaaatg
gggatggctggattacagcattagcttcccctgctattccccctcccatgtcccagcacc
cagttgtgtggtatgcctcatggagcatatttttgccagtggtttcccacaggaattttt
actagtaggattaacccatccctctggctgtcttcctcttctcttcccgtctgtttctcc
tgtatttcttggatcgttgacttcctccctctaactctgcctcttagactttccttccag
tcccctaagagctctgtctctcccccccgccatctcaccccattttcctttcttctggtt
cactttgttatgttttcccttgtgcgtttcctttattcttcagtctcctacccgtccagc
ggccagagctttagaggagtggggaagcacccctccaggggggcgtggggaaggccacac
gtgggcgaccccctcaagccctaaacaggatcggacgacaaagtcggacattcctccgga
gtcgtccggcttctgcttcttaacccgagagctggctgtggcctttcagccaggtgttcg
ttctgacccgcctaccccaactccagtcacggatctgacgcctgcattttaggggtgcca
ggtggccccaagcttctatgggccacgaggggcagtctgagcatggcaggaatgtttttt
gtcccggctagggcccgtgccctaaaactcggggtagctgttgagcagacaggcagcctg
ccatgaaagagtctctttcgtagccgagtagtttcctaaaagtgtactagcagtgggtac
ctctgagcaatggccatcattcatgtagaaggtgaaaaagctagtccctttcaggcattt
tatgagaaagtgaaatcctatgtcagctttactataactgcctgtgttttgtttttttaa
gctctttgtacgattcacaactcccttaatcatgtgaaagcctgtggtaccccaagtagc
ggggagaattcactgaaaatgtctttgagtgaacgtgaaatggggttgtaacctaccact
tcatcccctgtgtttgcctcttgctgccttttttcAGATTTAGAGAACATATTCAGAATA
ACTTGCCCAGAGATCTGTTAACTGCTGAGCAGTTCATTCAGTTGCGCAGGGAATTGGCTT
CCGTGAACGGTCATAGTGCCGATGACGGTCCACCTGGCGATGACCTCCCATCCGGGATCG
AAGACATAACCGATCCAGCAAAGgtaaacgtcacccacgggatagttttttctctagtgc
atggtaaaccatcggggctaccgcggattcctttcccactggactcgtgctttttagtca
gtcagatttattgagcgcttactgtgtgcagagcactgttctaagtgcttgagagaggac
agtacaacagccacattccccccatccacagtgagcttagaatctagagtatctagagtc
tggagcatttttaaacattaaaacactagtccttgtggcatttaggggagctacccgaag
gctgcccagctcaagtgtgagcagaatagtttgaggaaactgtgcacaagaaaaagtgat
ctttgaaaaaccaccttcagaatcagaaagaattgatgcgtgaagaagtcaagtgcattt
ttttctttgctaatttaattacgtgccatccttagtaaaaacaatacaaaggaaaattct
gtaattcatttgttattacttgctttttctttataagaatttcttcaaggactgtctgtg
tatgtcatatctaccccagtgcgtagcacagtttttcgcacatagtaaatgtgcttaaat
gctgtgattattctctagaccaaatagtgggtcgatcactgttcctagctcagagcttcc
tgacacttaagtaaaatgaaatttgggagtgtacagctaattttcttctcttttttcccc
ttccaagCTAATCACTGAAATAGAAAACATGAGGCACAGACTCATTGAGATTCATCAAGA
AATATTTAACCACAATGAGCACGAGGTTAGCAAAAGGTGGACATTTGAAGAAGGAgtaag
tatgtttgtgtaaaatattccttaagtaaaggtgcacggttctgcagggtagccccattt
caacactgtgtgacgaaacagttccattggggtttctattcttatttttaatttacctgg
aaattttttttattcgttcattcagtcgtatttattgagcgctcagtatgttcagagcat
tctgctaagagcttggaatgtacaattcgggcaacagatagagacaatccctacccaaca
tcttgggcatgctcaaaatatatccatctggcctctgactcacttctcttaagaactgaa
acattgtgaaactcctgaccagaatttttcaacaaagttgtatttcattttgattcagat
tttatttgactattctatttgactcccatcactgagttgaattttcataacaatgacttg
gcttttctatgtttaggcatataaattgcttacagttatttgattctttaataggttatg
attttttctatgtctctctctcattctctcattaaaagtaattagccgggggggggcggg
ggggggagacaagtaacatcttgctttgctgtggtacagagaacatgggcattgggtgat
ctagtgtgcgagggtcatttccgatgaatggagaaggggataatggccaatcttgtgtct
ccccatagctattggagcagccttattccctgggaagagggcacctggtggcctagatgg
gtctcctcctctccccacctcttcccctctctgactgcagcatgtaaatacctcataccc
agggaaaggtagcccggtggccggctttactctccttcccagtgagatctggccagacgt
gcccaagagtctttcccgtacctataccacccccccgcccgatttttggagtcatttgga
tgggtgtcatctggaaatcagctaactttcaaataaaatgaagccaattcttctagcata
tagtgggtggacttttgaggggtagaaaaatacatcatttgtggaggctagtcattgggt
tttattgctttaaattgggttagtttcaggctttgtttatgctttcatttttaggattaa
catagaagccatctatatttttcttctactcaagctcccctctagactgtggcttgttgt
gggcagggagcgtgtctgccaactctgtcatattttcccaggctcttagttacagtactc
tacacatagtcagctctcagtaaattccgttgattgattctgctccttcacgatgtttta
aaatgacataatttcctaaactgccagtggcgtacagagcaatgtaaaaataaatatcct
cgtttagcgtaggttagtggattccagggttggtctagaaacgtaacattcaaatctttt
tttttaattatgttggttttttttatggtggggactcacttctggacagaaaagaactga
tcatgcgttctaatcaccccagtttggagattttttttcaggattggaagaagggaagat
tccgagaattcaaatataaatgataaagtcttataggtcacgaaatttactgacgacagt
ggagatagacagttaatttttaatagcatgcagtaaatcttgtggaaaacaaccgttttt
cattcaaatagacttagtcgtggttttgaaaagaaagtttttgaagggtagaaatcaggc
catcacctagagctgttaaaaaaaaaaaaaaaagcaaaaaaaaaggccatatccaacata
ttgtttttcaaggacagtgtttgtgtctgtgaatttgcatcgccgtgttatacatctatt
ccagATAAAAAGACCATACTTCCATGTAAAGCCTTTAGAGAAGGCCCAGCTAAAGAACTG
GAAAGAGTACCTAGAATTTGAAATTGAAAATGGAACTCATGAACGTGTAGTGGTTCTCTT
TGAAAGATGCGTCATATCGTGTGCCCTCTATGAGGACTTCTGGATTAAGgtaagaaaatg
acctactactgagtttttgcagattgcaaacattgatctagtgactaaccttttgtacct
ctgtgaacgttgttcatataactatatctgttgcattaggagatggtctgcttgcaacca
gatttgactgctgcatatgccaagctcgttgcctctcttcgtccttccttacagaaacta
gtctagtggttcaataaaggtgctgaatgggtttaaaaatagaattttatcgttctgtag
tgtattcattgactggctccaccgtaactcattcaatgtgcactcttttctgtacgcagT
ATGCCAAGTACATGGAGAACCACAGCACCGAAGGAGTGCGGCATGTCTACAGCAGGGCGT
GTACGATACATCTTCCAAAGAAACCCATGGTTCACATGCTGTGGGCTGCATTCGAAGAAC
AACAGGgtaagggccgggcgcaccctgaaatgctcgtttcacttacggctctgtcctcgt
tcttccgcgtgctcccaccgtctgtaaatcgtcttctgtcggtcggtcaccccgctcagg
ttgcaagtaccttgctttctgtggtactctcctgcgtgcttagtacagcgcctagcactc
tcaggcactcagataccgtcgattccatgtctgtttttgaaccgtgccgcgtcggaccat
ccttcgaggggaaggatgcgtcgactaccctgaaaggtgctaaatatcagcctgatcctt
gcagGGAATATCAACGAAGCCAGGAGCATCCTGAAGACGTTCGAGGAGTGCGTCCTAGGG
CTGGCAATGGTACGCCTGAGAAGAGTAAGTTTAGAGCGGCGACATGGAAACATGGAAGAA
GCTGAGTGCTTGCTTCAGGACGCCATGAGGAATGCCAAGTCCAGTAACGAGTCTTCGTTC
TATGCCATCAAACTGGCTCGTCACCTTTTCAAAATACAGAAGAACCTTCCCAAAGCGAGA
AAGGTGCTCTGGGAAGCCATCGAGCGAGATAAAgtaggtttttatgtctcctggggcctt
ttaacatctcccaatcgagtgtgttctctacgtgggcaaccgtgatgacaggttcagtct
gtatgtgtaatgggtttcattactacatgaagacaccagtccctctaagctgatgttgcc
gtccttgattttcaaaacgtatcgcataagaaacgaagccgggtggcctcgtggaaagag
cacgggcttgggtgtcagaggacctgagttctaatcattgctctgccacttggctgtgtg
gcctcgggcaggtcgtttaacttctctgtgcctgtttcctcatttataaaagggggattc
aatcctccttctgactaagcctgagaagcagcatggcgtagcagatagagcacggatctg
ggagtcagaaggtcatgggttctaatcagggctccgccacttgtcggctacgtcaccgtg
aacgagtcatttcgcttctctgggcctcagttacctcatctataaaatggaccttgagac
tgtgagccccacatgggtcaggaactgagtccaactcgatttgctcgtatcctccccggc
gctcagtacaggaagcccgtaacaaataccatcgttattattgtcgttaagcttgtgagc
ccactgagggacagggattctgtccaacctccttacctggaatctaccccagagcttagt
acggagctttggcacgtagtaagcgcttcacaaataccacagtttttaaagaatgaatat
tcatcttcctatcttgtctcctttggtatttgagaccatggtagagcccaagtaattggc
attagcaagccaaactctccctgttggtgggagagaatcagcagggctcgtggacttatc
tccctggatctgggctgaaatcctccacgatagcattataaagagttttcgtactgtgat
ttatcttagtgttctgatttgttttaaagagaaaagtcatattattgtggaagcgcttac
tagattccctgtgttgtcgtttgtacagGAGAACCCCAAATTATACCTCAACCTTCTTGA
AATGGAATATAGCGGTGACCTCAAACAAAATGAAGAAAGCATCCTCACCTGTTTTGACAG
AGCTTTGCATGGCTCTTTGCCCATGAAGATGAGGATTACATTTTCTCAGCGAAAAGTGGA
GTTTCTTGAGGACTTTGGATCTGATGTGAACAAgtaaggccttaactctaaaaggtcaag
gagagtaagcacctgagatcttgggtttgaggtctaggtagtgtaaggctttttctgttt
tgtcgtggtttttccttggctttgatttgaagagggtggggagaggagccaggctttttg
tactgcgtagttggagagcacatttttctgaattcagtgggtttcaaccacttgtatttt
ggagagccaacagctgtcggacaggaaaggccgttcccgcgtgcctcgtctcatagacgc
caagggaatggacgcaccgttaagctttaaagctgagcgtgccttgccggattactggcc
tgagatccgtggaagggggaatgtcgggccgaggtcacagtattagcacatctttaacgc
gttctgtagccacggtcggagatcagacgctgggctggatggaccgtcggtcccaccctg
tgacggtttaatccttgaagtttggagtctaagctccttgtgtatgtgctgaactctcct
gactgcttagtacagtgcatcgttccccgtgggccctgaatagatgccgtcactcttacc
caggagatcattaagtctggggtttccctccgtctcgtgctcgggaaagcggcagtcttc
cccgaagctctgacggtccacgggtgccatgggtgaagagctagaagaaacgtaaccccg
ttcaccctggcagactcagcggtatcccgttgggtctctccctgctcttctccctgtcct
tccccactctcaacccaggcatccctctggggccgctcagggggtggggtgtgcaaacct
ggactctcttactggtattgccgtccctcctgagaatggagtctgactgagaactgccct
caacgaggctttctttcacaattatcctaatcctgtcaagggcaagcttttcctttcatt
gccgtactagctccggaggggcgagtaagctaccgtattggtgcctggtgccacagctcg
tcgccgaggggatggcaaccgcgttgggggattcccttcctccgcgcccctcacctgagc
gctgggtccagtttctccggaacgttctccagaatccattttaaagagagaaaccgcata
aggccctgcttgtcgttctcatcatttcccaccctgtctcttcccggagccaccggaggg
aggacaacccttgctcaccaaatgggggttcgcgtcactcgctactgcccgccgtccgtc
tcctctgccgtcgccgcggctcctgccggcccgggccgggccgagtagagacctgggaga
gcggcggtgggccgaccggaaacggtggcatcgggccccggagccgtattggagctgcgg
tttggaaatccccgggcctattctaaacccttgttaaaagacttattgcaagaggtcttg
ctgctcaccaaagcaatccatggttcggtctcattatttagtttccttggtttaaaaaaa
aaacaaaccagatttttggggtccaggttaaacgcactgtgacttttcctccttcctgtc
cctctcttgtagctttctattcttcttgtctcccttagtcacttgcatcttcctctccgg
ttctgttgatctgctttcctttatccttcctttgtttatccgtctctctctgttgcgtac
ctcattccccactgtccttggccttctgactgtttcttctctcttgctacaacggtttgt
tcctctctgactgattccctctttgctttcggtcctgtaactgcactgcagtctcttaga
ctttccatccttggcctccctcctgtgccctgctcttcttgaaccctttttttggttttc
cctccgccttttcccgctcaaccacactgcctccttacgtgcagtgctagcgttggcgcc
tggaaatgaccgtggaaaatggggcttgtgcgttctggcggccacagtggggtacagaag
ataagtgggtagatattcaaaactgtcgctggcagagggaaaaaaaaaatctatatcttt
atttacgtctaacatttaatgagtgtctgctttgtgcatagcatttttgtaggtccttgg
taatattacagagaagatactaaattgaagactggccccgctcccaaggaatttataatc
tggcaggggaagaagagacaaacagaaacaacttaacgtattgtagagaaccggtgcctg
tttctccccttccccgcccccagtgcaacggtagaaagagctccactccacctgtcttcc
gctccagctggggaaggggagggggcctggatgccggggctgtgagaactactctgggag
ggcagggctggagctaagactttttaccccccagctagcaaaactttccgtatcggaaag
gaaagggcggggggggtggggggggcgtgaatctgcagctcattcttgaccgactccgtt
aaaacggaagttgctcctacctttctttgccacattcaggccagatgtggatggaaggta
agagataagctgataattagcggctgagaggaagaatctcgcctttctcttgaggtcggg
atggaataaaagctcaaatgtgaccgatcggccacaaagggcttgggagggtgcgatcgg
cgccgggaattaggatcctttgcattgtccctgacccccttgggaaactggctcagttgt
tcctttccttgtccactgtgacaccatattcccctcctcttctgagttttaagtgttcac
gttaacaccgtcagaggcatggtaagttttaaaaatacaatgcttgcaagtgcccttctg
ccccgttctgtgaatatctagaagcagaagtcacttgaggaccaggtcacgactatattc
agagagagtcacaatctactcttgtagatttaaaaaaaaattcagttacatgctcttact
gtcttcagacagatttaagatatttaagttctgaatttattcactctcatttactctcac
tgaggaaagtgatttcattgggttcatccatccacctctatacttcaaatatgaacacgc
accatccttactcattggtgctattatgactaagatggcaatttttgagtgctttggatt
cttggagaggtagtctgcgcacagtaagcgctcagtaaatccagttgaatggatgaaagg
tggtggtattaattaccctacatgtaatgtttctccactgaactaaaacaatgggacttg
cttacagccaacttccaaatcccatcactgctggagaatccttctttttcactcatagct
tataaagaagacttcatggatgtgagtgaacttctgtttaacacaccttaactccgtaca
tttctcttgtctacatagttcatcagtgggcttatgtttagaatagattcccttcatgac
agtgcaaaatgtaatcagtgtactaagtacaagtccatgtggaacagggactgtccaacc
tgatttatcttgtatcttaccacggtgccggggcttggctcatactaagtactgaacaga
taacattttaatttttaaaaaataatagtttcgaataatatgtgataagtacaaaggtaa
agaattcctgctattaaaatggttgttttttaaaagtccagcctctcaaccaagccagcg
taaagtgtgcatagattgccttaaggcattgtaaaaaaaaaaaaaaaattccataaactg
tacaccttgaggtatcattgagggaatgaaatccgtgattattttttaactgctactttc
agcctttctcactcaagtagggtgaacaaaggaagccttgctcatggattccagacctgt
ttgctccttacattgaatcattattgcatagtgacttgatcagatatttttccaaccagg
agacctttccgacaggtccctcaccaatccttgtgaataatgaaatcgcagtactggaac
atactgtacgaagtatgtcccaggaatgattggcggggggggggggggggggtttctgct
ccagaactggaaggaaaaagtcagcttaatgctaccacataggtttaggaatttcatagt
taaacctgatcattcctttcgagcagatggcccttagaggcctatcttatttaaattgct
ctcaaatatgcaggatatgcatattcccagctactgacaagctccttgtgaggtgttgaa
tttttaaactgggggagagggtagccgggaaccgaggtgccgtgtgtgcattctaaatag
gaatgaaaacgggccaaccctcgaaggagatgcgcaaacagcagtttggaggcagtgggc
ggttttgaagagttcacaggtcggagatccaattatagggttttcctaaggcccattcag
aatggggttcttgctggagatctgcgatgaaggagaccggcagggcagcccagcgttaag
gaacgaaagcctggcagtgagcaccgttgctctgtggcacctctgcaggaggggctttag
tcacagtactgatgatgtcagcctaacatgagcatttcatctttctcagACTCTTGGATG
CTTACGACGAACACCAAGCACTACTGAAAGAACAAGATTCTTTAAAAAGGAAAGCCGAAA
ATGGgtacgtttataaaccaaacccacttcatagtaatgctaaccaattaggttcgagtt
tcattatgatggacactgtaagcatcctcccggatgatgaaaatctcacaagattcctgg
agtcctgacttctcggtacttcatatattgtagATCAGAGGAACCAGATGAGAAAAAAGC
ACATACGGAGGATGCAACTCTGGCATCTACACAGTTGATTGATGGAGATATGCAGGCAAA
TCAAGCTGCATATAATTATAGTGCCTGGTATCAGgtgggtgcagatcaccagtttccagg
atcctttgctggaaatgattgggaggtgttcattcagcacttattgtgtgcagagcactg
taccaggtgcgcgggagagtacagttcaacaacagacaggcacagtccctgcccgcgagc
tcatagtttagaggaggcgagacaggagtgtggctcactgggaaaagtacagacctggag
gtcagaggacctgggttctaatcacccctctgccagttgcctgctgcgggaccttgagcg
agtcgctctgcttgtttcctcaactgtaaaataaggattcagagccttgttcgtctccct
gcttggtctataagctccatgtggggcagggactgtctgacctaacttgcttctacccca
gcactctgataaatgttttgcaaatatatattaaaaaaacccaacgaactgagaacggga
aaggtccaatgtgaagcatggctgccttgtgcctgctttgttcttaacacaactggcctt
taaggtggtgtggggggttttctcatcacaagttgacacgctggcgtcaaggcaatttca
ggtaaaagtgtacattagtaaaagtttctggatctaactcctttttttattcttccagTA
CAACTACCAGAATCCCTGGAATTATGGACAGTATTACCCACCTCCCCCAACCTGATGGAA
AGAATTATTGCCTAGTGGAGCTTCTGGGAGTGAATTTGTTTTTTTTTTAAAGGAGGGATG
TAAACAGATCTTAACTTGACAGAATTTGCTAACTGGTCTTCCCTGTTCATGTGACAGTTT
GTTTAGTAAGAGGGAGTCATAATTTGTTAATAGCATACCACTTGTAAAATTTACTTTCTA
TCGGAGAACTATTTTTGGTTTTTGCATTGTGGTCAAATATTTCAACAGGTATTTAAAAGC
ATCTAAGTTCATTAGAGTATGGGAAGGAATGGACCGAAATTAATGTTTATGTAGCGAGGG
CATCGCTATCGTGCAGAGGTTGGGGTGTCACAGCCCGCCCCTCTCTGAAAAGCTGGGTGC
CTGGGCCCCTGTGTTTAAGTTGTCCTTGTGAATTTTGAATCTCCTTGCAAAATTTGAAAC
TTGAAGCCTGAGAGGCATATTTATGAGAATGCAGTTTGCATCCCTTTAAAAAAAATCATA
TTGAAGAAATGGTGTTTCAGGAGGACTTTTCTATTTAGAATGTTCATATGTGTGAGCAAA
CTTTCATTTTGATCAAACTGATCATCTTCATTTTCGTAATAAAACAAAGGAACTGTCCAG
TAACTTTATGACCTGACTTCTTTAAGCCACCCGAGGGCAGGGCCCACCTCTACCCCTTGC
AGATTAATCAGTCCCGGCACTATACTTCCACGGGTCTTACGGATCAAAGAGTCCATCAGT
TCGGCGACTAGTCTTGTAACTGCAGTTTATTGAATAACTTATTCCTAAAACAATCACAAA
AGATAATCAGTGTGTTAGCGAGGTTTCCCCAAAACAACATTGAAAAACCAAACTGATACA
CAGGCCCTAGTCTTGTGTAGGCCATTCCTCAAGTCTTCGGAGTGAAGTACTTTGAGCAGC
AGAGACCGTACGTTGTATTTCAATCAATATCCACTAATTCCACATCAAAAATAAGTTTTG
CGTTTGGTGGGATTCTGGGTGCGGAGTCAAGGTAGATCTTCAAAATTGTAAGCACTGAGA
GTCAACAGCATTATCTACCGGAAGTCATGGGGAAATGAGGCAGAGTGTCCGGTGAATGTC
ATCTCGTAAAACGTCACTGGGCCGAGAAACCTGAGCTAACGCTCCTGCGGACGGTATCTA
TCTATACGATTCTTTTGCAGAGAGAGAGAGAGATCCCCTCACCCCTCAAATTACAGCTAG
CAAGCCACCTCCAGTCTCCAACTACGCACCACCTGGAGCCTCCCAAAGGCCGAGCTTCCC
TTTACGTGAGGATCTCGATTTAGGTTCTCATCACTCTTCTCCTCACCAATCCCAGCAAGG
ATCAGGCTTTAACTAGGCTCGGAGGGGCTGCGCCCACACTCGAGGACCACTGCTTTCGGA
ACCCAATTCACTATTTTAAAACAAGCCCTAATAGTAACTCCCAAGAAACAACCTCAAGAC
CCAGTGCCATTCTTAAGCTTGAATCTTGGCTTTGGCTTCAACTGTCCTATTAAAATCAAA
CCCCCAGGAGCCTGAGGTGTACTACAGGTATGTGTGAAGATACGCCATTCCCCAAACTTC
AATCTCTCCCCCTTCCCCCCCTGGAGTAGTTTACTTTGCACATTTCTGAAGGAAAAAGGA
TACTTCGCATCAGGTTGCCCTTTCTTGCCATAAGCCCACTCCGGCTCAATTTCCAGGTGC
GCCTTTTCTCCTTTACTCATCGTCAAGAGAGCTTCATCCCACTGGAAAGTCAGAAAATAA
AGAAATCAATAAAGATGGCAGTCTGGGTTAATTATTGTTAACTTCTTAAGCTGAAGATGT
GATGGAAAAATGAGGATTTTGGGGGGGGAATGTTTGTTTAAAGGCTTCAGATCCTAgaat
tttaccacatgctatataactgcggagggatctctaagcatatttctgtaccaccccctt
tttttttcttttctttagttgtcattcttcacaaagactcacttcacagatctgtcagcc
gctaacgtctgtttggaccaagggatacggatgcggaggttgtgctcaatgttgcacttg
agatgtaaggagctgttagggctaacctctgcttgtctttctgccgacgaatgagtttat
ttttggatcgaaactggcagttacccaaaaagggctgtgctctcggtctttcaaaaacaa
cactaattctcttattacttttgactggaaacgataggatttgttaagccacgtatgaag
ggtaggactttttttaggtcccataaatataattcagagagagactcaggtaaaagtagg
attttcggttttcatcttgattcccgctatacggggcaagtagaacgttactccgtgcca
gtgctcgtggcttacgaaacgtggccgagaaaaaccagatcaccgccagctgtcggcaag
cgcggcaatgcggaggcgagtttaattcagggttggggttcccgtcaagaagacctgacg
gatccgaattgggcttctgagccgagagctccgcggatgccctcgtttttctccccagta
gagtgaaagccgcccagaggtgccagctacccaaggccacaccagattatttcccggagg
ggggaagacaaacaaaacaaacgcccacctaataaactagtcacaatgcctttacgagtg
gacaaacgcacatcataatctgccccaatacagtatatcagtttggaaatggcgatggac
gaaagtgaaaaatgttaagaatcacctaaatgcccacattttttttttttaaattaagca
gggtgattctcaacacccttcagctccctcagaaagcctgggccggtgttgcctactctt
agccgacgcctcaagcgcccggcagctcggccagtc
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1029, 1245..1257, 2314..2438, 4717..4882, 5587..5694, 7504..7668, 7979..8105, 8404..8672, 9688..9872, 14389..14463, 14613..14733, 15358..17275
1001..1029, 1245..1257, 2314..2438, 4717..4882, 5587..5694, 7504..7668, 7979..8105, 8404..8672, 9688..9872, 14389..14463, 14613..14733, 15358..15414
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved