Ornithorhynchus_anatinus Locus Mono:SNORA35
snOPY snoRNA Orthological Gene Database
Ornithorhynchus_anatinus Mono:SNORA35
Ornithorhynchus_anatinus
Mono:SNORA35
2
SNORA35
1001..1102
2102
ACAACAGAGTTAGCAGAAATGCTCCCTGTCCACAACGAGCTTTCAGTTTAGAGGGGGAG
ACGGACTTCTATATAATTTATAATATGTAAAGATCCATATATCCTTCATCACAGTGGCCT
TCTGAAAGGCAGAGAGCCTGTAGCAACTGCTAGTTAGAGATGACTCTCGGTCTGTCAGGA
GATCCACGTAAAAAGCAGCATTGTCTAGTGGGTGGAGCATAGGCCGGGGAGTTAGAAGGA
CCTGGGTTCTAATACCCGCTCTTCCATTTAGCTGCGTGACCTTGGGCAAGTCACTTCTCT
GTGCCTCGGTTACCTCATCTGTAAAATGGGGATCAAGACGGTGGGACAGTGACTGTGTCC
AATCTGATTAGCTTGTATCTACCCCAGGGCTTAGTAGAGTACCTGCCACATAAGTAATCA
CTTTTATACCATAAAAAAAAGGAAGGAAGCAAGCTTTCAGGGTGGCTGTTAGAACCTTAG
TCAAGGGAGGACTAATTATTATTATTATTATTACTAATAAGTGCCATCTAGTAATTTCCG
ATTCATAGCTATTCCATGGATATACTTTCTCCAGAACGTTCTGTCACGTACCATCGTCTG
TAGGCTTTCTAACGGTTCTTCCATTATCACTGTTATGATCTCTATCCATCTAGCTGCCGG
CCTGCCTCTTCCACGTTCTCCCCGGACTTTTCCTCGCATTCGTGTCTTCTCTAGAGAATC
AGTCCTCCTGGTGCCGTGTCCAAAATATGCTCATCTAAGTCGAGTCATTTGGCCTTCCGA
GGACCACCCTGGTTCAGTTTGTTCCCAGATCCATCTGTTTGTTTTTCGGGCCATCCATGA
TATTCACAAAAGCCTTCTCCAACATAGGGAGGGCTGCAGTAACAAACTGTCATGCATGCA
AGATTCCTCCGGAACACAAGCCCCCACGGTAAAGCAGAATGGATTGTACAGATGTTCATC
CTCGGAGATGATAGTACAGTCAGGGAAGGTCTAGCTCAGTGTTGCATTGTGAAGTGACCC
ACCGGTCTTCTGCTAGCCGGCTGGAGTTCCAATGCAGTAGGAGTTCCCTCCTTGCAGAAA
GGCCAGAGCTGCAGTGGACTGCCCCTCTAATTCATTCATTCAGTCATTTGATCGTATTTA
TTAAGCGTTTATTGTGGGCAGAGCACTGTACTTGGCACTTGGGAACGTACAATACAACAA
TAAACAGTGACATGTCCTGACCACAATGAGCTGACAGTCTGGCGGGGGGTGGGGACGGGG
CCGGGGGAGGTAGACATCAGTACAAATAAATAAAATTCAAGAAGTGCTGTGAGGCTGGGA
GTGGGGGCCGGTGGGGGACCGGCGGGGGCGGGAGAAGGGTAAAGGGAGCAAGTCGGAGTG
ATGCACAAGGGAGTGGGAGATGAGGAAGAGTGGGGCTTACTCTGGGAAGGCCTCTTGGAG
GAGATGTGCCCTCAATAGGGCTTTGAAGGGAGGAGAATAATTTTCTGTTGGATTTGAGGA
AGGAGGGCGTTCCAGGCCGGAGGCAGGGCATGGGCCAGGGGTCGGTGGCGAGGCAGGCGA
CACTGAGGCACAGTGAGAAGGTTAGCACTAGAGGAGTGAAGGGTGTGGGCAGAGTTGTCG
GAGAGAAGCGAGGTGAGGTAGGAGGGGGCAAGGTGATGGACTGCTTTAAAGCCAGTGGTG
AGGAGTTTTTGTTTGATGTGGAGGTGGATGGGCAACCACTGAAGATTTTTGAGAAGTAGG
GTGACATGTCATGAACATTTCGTAGAAAGATGATTTGGGCAGCGGAGCGGAGTATGGACT
GGAGTGGGAAGAGGCAGGAGGTTGGGAGGTCAGCAAGGAGGCTGATGCAGTAATCAAGGC
AGGAGAGGATGAGTGATTGTATTAATGTGGAAGCAGTTTGGATGGAGAGGAAAGGGCAGA
TTTTAGCCATGTTGTGAAGGTGGGACCGACGGGATTTGGTCACGGATTGAATACGCGTGT
TGAATGAGAGAGGAGTCGAGGATGACACCAAGGTTACGGACTTGTGAGATGGGAAGGATG
GTGGTGCCGTCTACGGTGGCGGGAAAGTTTGGGAGGGCAGATGAGGAGTTCTGTTCGGTC
ATG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved