Ornithorhynchus_anatinus Locus DCTN5
snOPY snoRNA Orthological Gene Database
Ornithorhynchus_anatinus DCTN5
Ornithorhynchus_anatinus
DCTN5
2
SNORA7
18459..18616
28291
TGTCTCCTCCTCTAGATGGGGAATGTGTTTATTGTTATAGGGTACTCTCCCAAGCGCTT
AGTACAGTACTCTGCAGACAGGAAGCACTCAGTAAATGCGACCGAATAATAATAATTATT
ATTATGGCGTTTGTTGAGCACTTACTATGTAGAACAGTGTTTGGCACATAGCACCTAACA
AAAACCATCATTATTATTATTTGTGCCAAGTACTGTCCTAAGCGCTGGGATAGATACAAG
GTAATCGGGTTGGACACAGTCCCCGTCCCATATGGGGTTCACAGTCTTCATCCCCATTTT
ACAGACGAGGGGACTGAGGCAGAGAGAAATGAAGTGACGCACCCAAGGTCACAAGTGGCA
GAGCCGGGGTTAGAACCCACGTCTTTGACTCCCAAGCCCTGCTCTTGCCACTAGGCCGTG
GTCCTTCTGACCCTGAACGAATGAATTCATTCAGTAGTATTTCTTGAGCGCTTACTATGT
GCAGAGCACCGGACTAAGCGTTTGGAGTGGACAATTGGGCAACAGAGACCATCCCTGCCC
AACGACGGGCTTCCGGTCTAATCGGGGAGACAGACGGACAAATACAAGACGACATCATCA
CGATAAATAGAATCAAGGGGATGAACACCTCATTAACAAAATAAATAGGGTAATAAAAAT
ATATGCAAATGAGCACAGTGCTGAGGGGAGGGGAATGAATGAACTTCAACCTCCCCTCAA
CGGCCAACAGAACCGTTAGAACAATAGAAACCTGCTCCGTGTCGGCTTCACCACACCCCT
GGGAACTCCCGCCCCTCGCAGTCGATCAATTTATTAGCTTTATCGAGTGCTTATTGTGCG
CAGAGCACTGTCCTAAGCGCTTGGGAGAGTCCAGTAGAGCTGGTGGACACCATTCCTGTC
CTCAAGGAGCTTACTAGCTAGCGGGGGGAGGCGGTCGTTTAATATTTCAGTGAGGAGAAC
CTGCCGAGTATAGGGATGTGGACGAGAGTGCTGTGGGTCTGGAGGAGGGGGGAGTATTAA
AGTACTTAAGGGCGATGTGGGTCTGGGGCGAGGAGAGAATCAAAGCGCCGAAGGGGTTCA
GACCCGAGGGCTACGGCGAATATAGTAGAGAAATGAAGGGTTAGGCAGGAAAGACCTTTC
GGAGGAAATGGGATTTTGAGTAAGACTTCGAAGATGGGGAGGACGGCGGCCCGTCGGCTG
TGAAGGGGCAGCGAGATACAGGCCAGAGGGAGGAAATGGGCGAGGAATCTTGGGCAAGAC
AGGTGACCTCGAGGAACGGCGAGCTGTCGGTGTGGGAGGAGCGAAGCGGGTGGGCCGGCT
TTTACCGGGCTCTTAGTGTGGTTAGAGGAGAAGGGATGGCAAGGAGTTTCTCTTTGGTGC
GGAAGTGGTTGGGCAAAGTCTGGATGTCTTGGAAGAGTGGGGAGACCTGGGCTAAATATC
TTTTTCTTGGAAAACTGACCCAGACCGCAGAGTGAAATGGGGACTGGAGTGGGGAGAGAC
AGGAGGCAGGAAGGACGGCAGAGAGGCAGATGCAGTAATCAAGGTGGCATATGATAAGTG
CTTGGTTCAGCACGGTCACGGTTTGGAGGGAGAGGGAGGGGATGGGTTCGAGAGATTTTG
ATGAAGGAAGAACCGACAGGATTTGGTGAAAGATTTAGTACGTGGGTTGCATGAGAGAGA
TGAGGTGAGGAGAATGCACAGTTAACCTCTCCAGCTAGCCAAAATTTGTCCCTTTTCTTA
GGTCGCATTCACCTATTCACCTCTGTGTCTTCCCCTTTCCTCACCCTTTTACGTGTGTCT
CTTAGCCCCTTCCCTCAGTTTCATTTTTCCTTACTCTCCTTCCCATCACCCTTTCACCCT
TCAATTCCTGGATCCCGGGCCACGTTGGGATCCGTGGCCTGACTCTCCCTCCCTCCAACC
CTCGACTCTCTTGATCAGGATTTTTGTCCCAAAAGATGGCACTTCCCTCTAATCGACAAT
CTCTGCTGCTTCTCCTCAGGCGTCTGGGAATAAAGTTAGTCGCCAGTCAGTGCTGTGTGG
AAGCCAGAATATAGTGCTTAATGGCAAGGTAAGGCTCCGTCCCACTTGGAATATTTCCGT
TCTCGACGACACCGCATTCAAAAGTTGCAATCACCGAGCAGGTGTTGCCGGTTGTTTAGA
TGCTTGGTTTTATTTCCGTGTTTTTCTGTCTTTTAATATTCCCATCCCGGTCCCTCACAT
TTCAGAGCTTTGGGGCTGCTTTCCTCCTAGCTCTGGTTCCCTGAGCCCTCCCACTCGGTA
ATACCTTAATTGCTGTGGGAGTAAAGGTCAGATAATTAATCCTCCTCTCAGACGGCAGTG
TTCCTTTCTGGCTTTTAGTATTCTCTGCTGCCTCTAAAATGTTTACGCATTAGCTCCGTT
TTGGTGGACGTTGTGGTGCCGTTGTTTCAGTGACCATGTATGCATCTGGCCCCCTTCGTT
TCGTGTCTTGCATACCAGGTTTCAAACTAAGAGCACACAATCTCTCACCTTGGAAGGGAG
ATCGTCTAGAGATGAATGGGGTTGGGAAATTAATGATGTTGGTATTTGTTAAGCACTTAC
TATGTGCAGAGCACTGTTCTAAGCGCTGGGGTAGATACAAGATGATCACGTTGTCCCACG
AAGGGGCTCACAGTTTTAATCCCCATTTTACAGATGAGGTAACTGAGGCACAGAGCAGTG
AAGTGACTTGCCCACAGTTACACAGCTAACAAGTGGCAGAGCCGGTGGAGATTCGAACCC
ATGACCTCTCACTCCCAAGCCCGGGCTCTTTCCACTGAGCCACATACTCGAGTCTTAATA
TGCAGTTATAGCTATGACTGGATGGTAGAAGATGGGTAATTCTTGAACCCCCATGCTTTG
TTTCTCCGTTTGTAAAGAGCTACTGTTTTTCTACCGAAGCCGCAATTGTTCTTTGAAATA
TCTCGGTGATCCTGGTTAAAAATCAGTGGTCCTTTCTAAAAAGTTATGCCCTCTGTCATG
TTTCCTTAGAGCCAACATTATGTGATTTATTATTATTAATAATAATAATGGCATGTGGTA
AGCTCTTACTGTGTGCCAGGTATTGTACTAAATGCTGGGGTGGATACAAGCAAATCAGGT
TGGTCACAGTCCCTGTCCCACGTGGGGCTCGTAGTCTCCGTCCCCATTTTACAAATGAGG
TAACTGAGGCACAGAGAAGTTAAGTGACTTGTCCAAGTTCACACAACAGACGAGAGGCGG
GGCCGGCATTAGAACCCATGGCCTTCCAACTTCCAGGCTCATGCTCTATCCACTATGCCG
TTAGGCAGCTTTGATTAGTTCATCACGTACTGAACACTTACTAGGTTCTCACCACTGGCT
ACACTCTGTGGTAGGAATAAGATAATCAGATCAAACGTGATCCCTGTTTTTAATTGCTTT
TATAATCCAAGGAAGAGCAGGAATCTTTTCCCCATTTTAGAGGTAACTAAAGCACAGTCA
CAAAATCAAAATCACAAAAAAGACCCGCGGCAGAGCTGGGATTTTGAATTATCAGAGAAA
ACTACCAGAGATGGAAAAAAAATTACAAAAAAGAAAAAGGGGGGGGGCTCATTTCAGACA
TTACCATTACAGTTTTTGAAGTAATTCATTACAGAGGAATTTGGAAAAGGCAACTTTTTT
TTTTTAAATATCTTACTGGAAATTAATGCTTTTCATAGAAAGGAAGCCTAAAACAGTTAT
CCTCTAGTCCCAATAGACCAGAAAACTCAGATCAAAGCTAGAACAGTTCTATCCTACAAA
TTTCATTTTCTTTAGAGAAGCAGCGTGGCTCAGTGAAAAGAGTCCGGGCTTGGGAATCAG
AGGTCATGGGTTCTAATCCCGGCTCCGCCGCTTTCCCGCTGTGTGACTTTGGGCAGGTCA
CTTCACTTCTCTGTGCCTCAGTTACCCCATATGTAAAATGGGGATTAAAACTGTGAGCCC
CACGTGGGACAACCTGATCACCTCGTATCCCCCCAGCGCTTAGAACAGTGCTTTGCACAT
AGTAAGTGCTTAACAAATACCATTATTATTATTAGTATTAAAATCCAGGTCTCCCGACTC
CCAGCCCCAGTCACTTTCCGCTAGACCAAATTGCCAAAGAAGCAGTGGATGAAAGCAGCT
TTTATGTAACTAAGCTTCGTGAATATGTGGGTGAATTAATTGCCCCCTTCTTGCCTTCCA
GACAATTGTAATGAATGACTGTATTATCCGAGGGGATTTGGCGAACGTCAGGGTTGGACG
CCACTGTGTTGTGAAAAGCCGCAGTGTAATAAGGCCACCGTTCAAAAAATTCAGCAAGGG
GTAAGTGTTGGTTGTTCTGTGTGTTAGAGAAGGTGGAAGACCATTGATATTTCTCCTGGA
CCGTAGAAGAAATTGCCACCGGTTGCCCACGGCTGAAGCTGTAGCTAAAAAAAATCTTTA
AGTGTCGTCAGCAGGGCCACCTGGACTGGTTCATGTATATTCTAGGTAGAAACTCCAGTC
ACACACTTTCTGGTTCCCTCCTGGAAACTCCTCACATCAGGCGGGGCTGTTTTGGCTCCA
CGTGAGCCTCCTTTCGCCGTTCGAGCCTGCCGTGTTAACGATCGTGGTATCCGTTGAGCT
ACGTGCCAAGCAGTGTACTAAGCACTGGGAGTAGATTGAAGATCCTCAGGTTCCACACGG
GGCTCACATTCTAAGCAGGAGGAGGTCAGATCCCCTTTTTGCAGATGAGAGAACTGAGGG
ACAGAGAAGTTAGGTGAATTGCTCAAGGTCACACAGCTGGAGAGTGGCAGAGATGGCAGC
GTGGCGCAGTGGAAAGAGCACGGGCTTTGGAGTCAGGGCTCATGAGTTCAAATCCCAGCT
CTGCCACTTGTCAGCTGTGTGACTCTGGGCAAGTCACTTAACTTCTCTGTGCCTCAATTC
CCTCATCTGTAAAATGGGGATTAAGACTGTGAGCCCCACGTGGGACAACCTGATTCCCCT
GTGTTTACCCCAGCGCTTAGAACAGTGCTCTGCACATAGTAAGCGCTTAACAAATACCAA
CATTATTATTATTATTATTAAAACCCAGGTCCTCTGACTCCCAGGCCCGTGATCTTTCTC
CTGGGCCACTCTGCTTCCACACTGCTATATTCTGCTAACGATCTCCTTTAACGATGTTCC
TTTCTTATGGTTGGAAAGCAGTCTTCTAAAGAAGAGGTCGCCCGCTCGCTCCTCCACCGG
AACAATAATATGGAGCAAAATATGTCATTCCTCCCAGCTGCTTCCAACTCTTTTTGCCCT
CCCATACTTTGAATTTACGGAGGGGAAGATAAACTAGAGACGGTGATGGGGAAAATTATG
TGAAGTGGCTTTATGTGGTAACGGTATTTGTTAGGTGCTTACTCTGTGCTAAGCCTGGAA
CAGATTCAAGGGAGTCAGGTCGAGCTCTTGCCCCAAAAGGGGCTCACAGTCTAAGAGGGA
GAGAGAACCGATAACAACTGTGGTATTCCTTAAGCGCTTACTATGTGCCAGGCACCGTAC
TACATGCTGGGGTGGAAATACAGTGGGTATTGAATCCCAGTTTTACAGACTGGGAAACTG
AGGTGCCAAGTGAAGTGACTTGGCTAAGGTCATGTAGCAGGCAAGTTGCAGAGCCAGGAT
TACAACCTGTATCAGTCAGTGCCTCCCCGCGGCCCCCACAGCGCTTGCGTACATATCTGT
CATTTATTTATTTGATTGTCTCCCCGCCTCTAGACTGTAAGCTTGTTGTGGGCAGGGAAT
GTGTCTTCAGGGAACGGGTCTGTGTACTGTTGTACTCTCGCAAGTGCTTAGTAAAGTGCT
CTGCACACAGTAAGTGCGCAATAAACTTGATTGAATGAATGAATGACTGAATCCTCCCTC
CTCCCAGAAGCAGGTTTAGGATTTGGAGACCTGCTCTCAGAATTGCTGTGTGACGGACTA
TTATTTGTCACAGTGCTTTGAGTGTCAGACCAGCTTTGACTTTGTGCTGTGAGCATCCAG
AAAATATCTATGGGACCGACACATTTTGGCTTAGTGGATAGAGCCAGGGCCTGGGAGTCA
GAAGGACCTGGGTTCTAGTTCCGGCTCTGCCATTTGTCTGCTGTGTGACTTGAGGCAAGT
CACTTCATTTCTCTGTGCCTCAGTTACCTCATCTGTAAAATGGGGATTATGACGGAGGGC
CCCAGGTGGGATATGGACCGTGTCCCACCCGATTACCTTGTATCTACCCCAGTGCTTAGA
AGAGTGTGTGTAAGCCCTTAACAGATACCATTAAAAAAAAATTCCTCGGTGTCATGACTT
AGCTAACGGTTAGGTTATTGTCATGAAATCTTCTCCTTGAAGTATTCTACCTAAATCTCA
CTGCTTTCCCTTTAGTATCGAATAAATGGCAGCAATATTTTTTCCTCAGCAAGGTGATAC
AGCTGTTCAGCGTGTGAAACAACCACCAACCAATAGACTAAAGTCCGGCTCATGTAACCC
ATCAAAGAGTCTGTGAAATACAGAGCAGCTCTTTACTCAAGTAACAACTTGTATCAATAA
TGTAAAAAAAAACCCCAAAACCCAGTATCCTCAGGCATAACCCCAGAGGATCTATTAATT
CATGAAGAAAAACAAACCTCCAGTAACGCCATTGGTTAATATTATTTTATTTTATTTTTT
TTACCAATTTCAAATGTAATCTTCCCATTCTCGGCACGTTTCAGTTTTGAAGTAAACTAA
ACATTGATTTAAAAAGGAGGCACATTCTGGGGGCGGGATAAATTAAAGCCCGATGGAAAT
GTCAGCTCCTTTGCCCCCTTCCTGCTGAACCGGTTCTCCAGAAGTTGGCCAGGAAAGCGT
CCACACATGCACATAAGCACTTAACTATGTGCCAAGCACTGTATTAAGCAGTGGGCTAGA
TCCAGTATAAGCATCCTCAGTGGTATTTGTGGAGCGGTACTATGTGCCAAGCACCGTGTT
AAGCCCTGGGGTAAAGCCAATGTAATCATCAACGTCAGCGGTATTTACTGAGCGCTTACT
ATGTACTGAGCATTTACGAGACTCCACTACGATGGAGTTGGCAGACACGTTCCCCTGCCC
ACGTTGAGCGGTATGATCATGTCTGCTACTTCTCTGTTAGCAAACAGTATGGTGCTTTAC
GGGGAGTAAGTGCTCAAAAAGTATGATTTAATGGATGGCGAAGGGCTCATCATGGCCCAG
GTAAACCTGGGATCGGAGAGAGATCGGCAATAGATTTGATCAGTAATAGATTTATTAAAA
ATAATAATGATAACGATGGTCCTTATTAAGCACTCTGTGTCAAGCACTGTTCGGAGCGCT
GGAGTAGCTGCAGCCTAGTCAGGCTGAACACAGTCCCCGTCTCCCACGGGGCTGCCGGTC
TTAATCCCCATTTTAAAGATGAGATGACTGAGGCCCAGAGAAGTGAAGCGGCTTGCCCGA
GGTCCCAGAGCCGACAGGTGGCAGAGCCCGAATGAGAGCCCGTGACCTTCTGACTCCGAG
GGCCCGGCTCTATTCACTCGGCGCTGCCTGATGGGCAATCGATTTGATCGGCGATTGGAT
TAAAGAAGTCCTCGGTCTCCACCAGGTGTCAGTGTCAGGCCTTCCCTCGCCTCGGTCCCG
AGCCGAGCGTTCCCTGTCTGCCCTATTCCTTGGGACCGTCAAGAGCCGCCTGGGCCTTAG
TGAGGGACCCGAGCCCTGCCCAGAGGGAAAGAAAATTCCAACTGAAAGGTCGGCACCACT
AATAATAATAATAATAATGATGGCATTTCTTAAGCACTTACTATGTGCCAAGCACTGTTC
TAAGCGCAGGGGAGGATACAGGATAAAAGGTTGTCCCCGGTGGGGCTCACGGTCTTAATG
CCCGTTTCACAGATGAGGTCGCTGAAGCCCAGAGAAGTCAACTGACTTGCCCAGAGTCAC
ACGGCTGACAAGCGGAGGAGCCGGGATCTGAACCCATGATCTCTGGCTCCCCGGCCCGTG
CCCTTTCCACTGAGCCACGCTGCTCCATTGGCGATTGGACTTTCCGAGGAGGCGGGATAT
CGACGGCTCCCGTGGCGAGCGGACGGACTCCCTGGGACGGGGGCGGCCAGGCAGCCCCGG
ATGAAGTCGCCGCCATCGGCCAGACGGCCGCTGGACGACGAGCGACGGGGCTCTCGGCTC
GGGCCCCGGGGGCGGAGCAGAATGGGGGAGGCTGAGGCCGTTGGCTTCCAGAGGCAGCGG
GGCGGGGAGGCCGGGCCAGGTGGGCCAGCCCGATCCTGCGTGGCCCAGGGCTCCGACCCC
GCTTCCCCGAAACCAGCCGTCCCGGGACTTTCTCTCGTACCCGAGCCAAGTTCCGGCCAG
GAAGTCGATCGATCGGTAGTATTTATCGAGCTGACTCGGTGCCGTGCCAGATACCTTCCT
TCCGGCACTGGGCCTGAGGTGTTAGGGTTCATTCATTCAATCGTATCTATTGAGCGCTTA
CCTTGTGCGGAGCACTGTGCTGAGCGCTAGGGAAGTACAGTTCGGCAACAGAGGCTTGGA
GCAAGTTCAGCAATTCTGCTAGAAGATTCAGCTCTCTAACAGACTCATTTAGGGTAAAGC
TTGTGGGGCCTGGGCTTCCGGCTTTTCCAGCTCAGAAATGATATACTAATAATGCTGGTA
TTTGTTAAGCGCTTACTATGTGCCAGGCACTCTTCTAAGCACTGGGGTAGATACAAGGTG
GTCAGATTGTCCCATGTGGGGCTCACAGTCTTAACCCCCATTTTACAGATGAGGGAACTG
AGGCCCAGAGAAGTTAAGTGACTTGCCCAAGGTCACACAGCAGACAAGTGGCAGAGCCAG
AATTAGAACCCATGACTTCTGACTCCCAAGCCCGTGCTCTTTCTACTAAGCCACACTGCT
CCTTTATACGTGTATATATACACACACACACACACACATATATATACATATATATACACA
TATATATACATATACACACACACATCCTATGGGAATGGTATTTAGCATTTTGCCCCTTCT
CTAGGAACTTTCATAGCCAGTTCTGACCCCTAGAAGCAGCATGCTGTCGTGGAAGGAGCC
CGTGCCGGGAGTCAGAGAACCTGGGTTCTAATCCAGGCTCTGCCCATTGTCTGCTGTGTG
ACCTTGGGCAAGTCACTTCTCAGGGCCTCAGGTGCCCCATCTGTAAAATGAATATCTGTC
CTCCTGCTTGGACTGTGAGCCCGATGTGGGACCGGGACCGTGTCCCACCTGATTTGACTT
GTATCTATCCCAGCACTTAGAACAGTGCTTGACACGGAGCCATTATTTTATGGCGCCTCA
CAAATGCCATTAAAAAAAAAATGCCTTTTGTATTTGCGATAAAGACAATTCACGTAAAAG
AAGTTGGGAAAACCGGTCCTGGGAGTCTGGTTATTTTAAAAAGGTTCTTTGCGGAGGCAT
TTTAATCATTAAGAAGAGCAGCTGTATCTTCATGTCACTGAAATTTTTATTGTTGTTTCT
CATGACTTGTCCCTGGCCCTTCCTGAAGGAAGTCATTTCATTTATGAGGGAAGTAGCTGC
TTGGAATTTTTATCAGTTGGATCCAGTTAGTGGGGTCCATTCCCCAGGTGGTGTTCATTA
GCCGCAAAACAGATAGCAAGTGTGCGCGCCAGCCCTCGTGTGGCTCTGGTGAGATCTGTG
GGATTGAAGTCGTTTTTGCTATCAGTCAAACAGTGGAGTCTGTTGAGTGCTTACTACGTG
CAGAGCACTGTCCTGAGCACTTGGGAGTGTAGGAGCGTGGCTTAGTGGAAAGAGCCCGGG
CTTGGGATTCAGAGGACATGGGTTCTAATCCCCACTCCGCCCCTTGTCTGCTGTGTGAGC
TTGGGCAAGCCACTTAACTTCTCCGTGCCTCAGTTACCTCATCTGGAAAAGGGGGATTAA
AACTGTGAGCCCCACATGGGACAACCCGATTACCCTGTATTTTCCCCAGCGCTTAGAACA
GTGCTTGGCACATAGTAAGCGCTTAATACCGTAATAATAATAATAGCAACCAAGATAGTA
GACCCATTCCTTGCCCAGATCGAGCTTCCAGTCTAGAAGGGGAGACAGACATTATCGGAT
GAGCCTAAGGGTCTCCTGGACTCGGTCGGATCCCCAGGGTCCATCGACGGCAGGAGCAGC
CTAGACCGGGCTGAATCCGAACCCAGGGCCCGTCTGTCAGAGCCTGCAGGAAGGGAAACA
AGCCACTGCATTGGGACGACCTGTTGCCAGCACGACCTGGTGGATAGAACAAGGGCCCGG
GAGTCAGAAGGATCTGGGTTCTCATCCCCACTCCTCCACGTCTGCCGCGTGACCTTCGGG
AAGTCACTGCTCTGTGCCTCAGTTACCTCATCCATAAAATGGGGATTAAGATTGTGAGCC
CCATGTGAGACAGGGACCGTGGCCAACGCAATTACTTTGTACCTATCCCGGCGCCTAGTA
CGTTTCCCGGCACGTAGTAAGTGCTTAGCAAATACCACAGTGATGACGATTATTATCCGT
AGCCGTGGAATTACCCAGTCTGGAGCCTGCAGGTCACCGAGGGCGCTGCCCCGTGGCGGA
CGCTGCAGTCAATCAAAGGGATTTATTGAGTGCTTACTGTGTGCAGGTGCACTGTACTGA
GCGCTTGGGAGAGAACATTATAACAGACACCGTCTCTGGAGTACCGGGGCAGTTGTGGCT
GTTTCCTAAGAAGGACTGTTTGGCCTGGAGCAGCGAGGATTGAACCCTTCAAGTGCAGGC
ATTGTTGAATTTTAACCTGTCTTCACTGATTGAATTCTACAGTTGTGTCTGCCCTCTCCC
ACTTGGACCGTGAGCCCCTCCTGGGCCAAGGGCCCTGCCTTAATTGATTTCCACGTATTC
TCGTGCATCGTAAGCACTTAATGAATCTTAGCAATAGTAATATTTGTGAGACATTTAAAG
ACCTCCTTCAAAGGTTGACCTTTCCTTCAGAGTGCCCTTTTGAAAATTGGGGGTTCAAGT
GGATCTGTGTCGCCTGTTTGCTGTGCGGACCTTGAGCAAGTCACTTCACCTCTCTGTGCC
TCAGTTACCTCATCTATCAAATGGGGATTAAGACTGTGAGCCCCAAGTGGGAAAGGGACT
GTGTCCAACCTGATTTGCTTGTATCCATCCCAGAGCTTATCATGGTGCCTTCCACGTAGT
AGGAGCTTAACAGATACTGCAATCATTATTTTTCTTTCTACTACTAATATTAATAATGTG
TAGATCAGGCCCAGAAAAGCTATCCTAGAGTAGATCTCTAATTTCCCTGGCCCTGTCCCC
AATCCTGGAAGGCCAGTGAGGATCAAGAAACCCATCTGCCTTATACAGAACTTGGCTTTG
AGATTGCTTTTAAGCAAAGTTGTTGGAAACCCATACATATTCATTCTTTCATTCAGTACT
ATTTATTGTGCGCTTACTATGTGCAGAGCACTGTACTAAGCGCTTGGAATGTACAGTTCA
CTACTATATTCTATTTGAAACACCTTCTTCCCACACAAACTCATATGCTTCAATTTCTAT
GCCCTTCAAAGTTGAGAAAAATCAAACTCATCATGTCTGGGAGCTGTAAGAATGAAATGT
AGGAAATTTAGAACTAAGGCAAGCCATAAGTCTAAGAGCTCTGCCGATCTCGTCTGCCAA
GTTCCAGAAAGAACTTGGAACTTGTCTGCTGTGTGACACTGGGTGAGTCGCTTAACTTCT
CTGTGCCTCAGTGACCTCATCTGTAAGATGAGGATTAAAAGTGTGAGCCCCGTGTGAGAC
GTGGTCTGTGTCCAACCCTGCATCTACCCCAGTGCTTAAAACAGTGCCTGGCACATAGTA
AATGCTAAAAGATACTATTAAAAATGGAATAAAGATTCAAAGATGGTGCTTCACCCTTAT
TGCCGGAGGCACGTGTATACCAGGGAAAAATATTCAAACTGCTAATAGTTCGTTCAGTTG
TATTTATTGAGCGCTTACCATGTGCAGAGCAGTGTACTAAGTGCTTGGAAAGTACAGTTC
AGCAGCAAGTAGAGTCAATCCCTGCCCACAATGGGCTCAAAGTCTAGAAGGGAGGAGACA
GGCATCAAAACAAGTAAACAGGCATCAGTAGCATCAATATAAATAAATAGAATTATAGAT
ATCGACACATCATTAATATAAATAGAATTATAAATATGTCCATATAGACACAAGTGCTGT
GGGGGTGGGGGAAGGAGGTAGACCAAAGGGAGCAAGTTGGGGCCAGGGGAAGGGGAGAAG
GAGCAGAGGAAAAGGGTGAGGGGTGATGAGTTGCAACAGACCATCCGCATTCCTCGGGCT
TCTGTTTCTCTGACCGGATAATCCATTATTTGTGTTTGCGCCGTGGCAGGTGACAGATTC
TTCTCACCCCTGTGGCCCAGTTGAATAGCCCAGTTGAACCACAGCAAGAAAGTTGGCAGA
GGTCTAAGCGTGCTCTTGGCCCTGCACTAAACCATTGTTTTACAGGCTGTTGCTCTCTGG
TCTGTTTTTAGAACTTAGAAAAGGAGTTCTTGGTAAAGGGCGGGATAAAATTTTACTCAG
GAGTTCCAGTTTTGCCCTTTTGAAGATATCTGGACATCACATACGAATGTATTTTTTTAA
AATGTTTTTTGTTAAGCGCTTACTATGTGCCAGGGACTGTTTTAAACTGGGGTAGATACA
AGGTAATCAGATTGGACACAGTCCACGTCCCTCAGAGGGCTCTCGGTCTTACTCCCTATT
GTACAGTGAGGAAACTGAGGCACAGAGAAGGGAAGTGACTTGCCCAAGATCACAAAACAA
TCAATTGGCAGAGCCGGGAGTATTACCCAGGGCCTTCTGAGTCCCACTCCCGGGCTGTAT
TCACTAGGCCACGCTGCTTCTCGGAGGTTCTTGGTTTTGAACCTTTCTCTTTCTGTTCTT
CACATCTGTTTTCTATCACCTGGTTGTGGGTTTGCACTTGCCTTTGTTTTCACCGTTAGA
TCGTGAATTCCTTGAAAGCTAAGATTGTGCCTTCTTGTTCTCCCCTGTTGTTGCTTTGTG
CCCCCGTCCTCATCCCCGACACCCAAAGCAGGTCTTTGCCCAAGTCCTGGTAAAGAGCAC
AGAGTGGGTACTAAACAAGTCTCGACTCTGCCCCTTGTTAGCTGTGTGACTGTGGGCAAG
TCACTTCACTTCTCTGTGCCTCAGTTCCCTCATCTGTAAAATGGCGATGAAGACTGTGAG
CCTTACGTGGGACAACCTCATTCCCCTGTATCCACCCCAGCACTTAGAACAGTGCTCTAC
ACGTAGTAAGCGCTTAACAAATACCAACATCATTATTATTATTATTATTATTAAGTACTG
CTATCGGGCAGACGGACCACAGGATAAGGCTGAGAAGGGCTTTCGGATTCACAGGCAACA
ATTTTGGAGTTTTCGAAAGAAATTTCAAAGGTGGTTAAAATGTCTCCGAGATTGGGAGCC
CCGAATGGAACAGGGGATGTGTCCAGTCAGATTACCCCAGGGCTGAACACAATGCTTGGC
ACAGAATGCTTAATGATCACGGTAGCTCACTGGTACACTAGGGAGGATAGTGTATGAAGT
TATGTAGCACTATGGAAATGAATAAATCAGGCAATAATGTAGGAGATCGGCTAAAGGGCA
CAGAGAGAAACGCTCTTGTTGGTCTAGAATGCCCTGCTGGGAATAATAATAATGATGGCA
TTTGTTAAGCGCTTATTATGTGCAAAGCACTGTTCTAAGCACTGTAAAGTGGGCAAGCCA
GACCGACTCCCAACAGGTGACCAAATGGTGGAGGAGAGTGGACTGGGTCAAAAGGATTTA
GCCTCTTCTACTTGTAAGTACTGGGAAAGAAGAAATCCGCTCACAGAACTCTCTCCTGGT
GCCGATATTGTTGCGAGAGTCCTTTAATACTTGTTTTTTGGGCTTCTCCCAGCCCTTCTT
CTCCCTCCTCCGCTACTACTTTCTCTGTTCCGGAAAACCCTTCTGCTTCGCTCTACCTCC
CACCCCCCTCATCTCTCCTCCCCCATCATCCCCCTCATGCTGCTATTGTCTAAAACTGAT
GGCTTGGAGCTGGTTGTTTTTGGAAATCTGCTTGACCATTACAAGGAGCTCACAATAAAA
GATCTTTAAGGCTCTGTTTACAGTGTTCTTTGCTTGCCAGAAATAACCTTAAGACAGGTT
GAAGAGAGGAAAGTGACTATGGCTCAATGAACTCATCTAGGCGGACATTAACCACTGGAT
TGCCAGAATCTCAAGGTCTTTTCCGTTCCTCTCCCCAGGGTCGCTTTCTTTCCTCTCCAT
ATCGGCGATCACGTCTTCATAGAAGAAGACTGCGTGGTCAACGCAGCCCAGATTGGTTCC
TACGTCCACATAGGCAAAAATTGTGTGATTGTAAGTATGGTGCCATCATTCATTCATTCA
TTCGTATCTACTGAGCGCTTACTGTGTGTGGAGCCTGTACTGAGCACTTGGGAGAGTACA
GTATAGCAATAAACATCAGGGCTGACGATTGCTTGGGCCCCGGGATCAGTCGGTTGATTC
AGATCAGCTAAGATCGCCGCTGACGGCTCTTTCCAACATCTGCCCAGACTCTACCGGCAG
TATTTTCAGCATTTTCATCTAACGTCGTGTGGATGCCATGATTTATAGGCTTCTCGCAGG
GAGGGTTGAGGGGTCTGATGTGACCAGGGGAGGCAGCGTGGTGAAGTGGGCGAGTGTCGG
TTTAGGAGCCGGAGGATCTGCATTCAAATCCAACCTCTGCCGTCGGCCTGCTGCTGCCGC
CGTGTGAGCATGGGCAGGTCGCTTAACTTCTCTGAATCTCAGTTTCCTCCTCTGCCAGTT
GGGGATCATAGCCTCTGTGCCTACCTCGCGGGGTTGGTGTGAGGGGAAAAATTAAATAAA
ATTAATTAAAATTAATTTAAAAAAATTAAAAATTAAATAATCAGTGGGAGAGTGATTTCA
AACACAACTGAGAACCAAAGTGGTATTATTCTTATTCTTGGGGTCAGTGCCTTTTGAATT
ACAAGTGTGCACCTCATTCTGGAGTAGGATAGACTCAGTCGTCATTACTGTCCTCTTCTG
GGAATAAGTTGCTCTGTGATTGCTACCCGAAGAGATGGGTCTGGATGAGACTCATGACTT
GGAAGAATTAAGCATGGCAGATCGCCGTTAGCTCATATCCCGAAATGGCGGACGTGCTGC
AGGAAGAAGCGATACCCGGATAGCCCTATAAAATGTGGCTCACCGAACCACACTTCCCTA
GAAGAGCTACAGGTCCGACTTATTCCCCCCGCCAATTATTTTTAATGGTATTTGCTCATT
CAGTTGTATTTATTAAGCACTTACTGTGTGCAGAGCACTGGACTAAGCGCTTGTTCAGTG
CTTACTATGGGCCAAACGTTGTTTGGAACACTGCACTTTCTCTTGTTAACATTTTTGCCT
TCCGAGTGGACGAATCATTTTCATCCATGGGATTTATTAAGCACTTACTGTGAGCAGAGC
CTGTTCACGTATTTATTAAGCACTTACAGTGTGCAGAGCACTGAACACAGCGCTTGAGAG
CATGCACTAGAGCAATATAACGGACAAATTCCCGGTCCACAGCGAGCTTACCGTACCAAG
TGTTTGAGAGAGTGCAAAACATTCATTCCCTGCCCACAAGCCTAGAGGGATCTGCTTCTC
TCTAGCCCCAAGGCTCTCCAGCTCGCGTGATAGCAGCGATTCAGAAGCCTGATCAACCTC
AGAGGACTTTAACCTGCCCCTCGAAACATCCAAGTTAAAGTGGGGATTGAGACCGTGAGC
CCCACATGGGACAGGGACCGTGTCCAACGGGATTTACCTGTATCCACCCCAGCGCTTAGT
AAAGTGCTTGGCACGTAGTAAGCGCTTAACAGATACCAGAGTAGTTATTATTATGGGCTT
TCACTGCGTTTGTAGGCTAAGAGTGAAGTAGCCTGTTATAGAGATTTAAATGGAGAATTA
AGGTGGCAATCACTTTGGGGGCTTTTTTTATTTCAATTACCGGTCTGGGGCTTAATTTTT
AAAAGTATGAAGGCCTGTTTCAGTTTACTCTCTTCACCCTTCCATTAGTTGAGAAAATAT
TTTTATCACTGCATCTACACGACACTAGATAATGCTACACTGTTGCTATTAGTTTCTGGG
CATATGTTTGGAATTGCTGATGTCAGGATATCCAGAGGGAAATGAGTAGTTACAGATGGG
GCTCAATAAAGTGAGAGATAATGCAGCTCAGTCTAGGTTATTACCTATGGAAATAGAGGC
TATTTGGCAGTTAATAAGGAAATAATGCTTCTCCGTCGAGAGCATTAAGCTACCAAAGAC
GTGTCCAACTAGAATATAGCATTCACTCTATTCTGGAGTAAAAATGGAATTCTGGGCAGC
TTAGGTCGTCTAAGAGTAACCTAGTGATTGTCGGGTCTTAACTGAGAACGTCGTATTTTA
CTGCAGATTCTAACCAGGGAACAGGTGGATTTATATAGCTCACCAGTCATGTAGAAAACG
GTCCCGGGCTTTAGGTTATTTCCTTTGTAAACAGGCCCGACACATTTTCAGTCCATTAAC
ACGAGCATCTCCTCCTATACCCGTGAAACAGATGAGTCCTAACAACCTCCCGCCCGGTCC
ACAAGATACTTCGGGTCAGGAAGAGTGGGTAAAGTGATTGCTCCCGAGGCAAAACCTTGT
GAAGGTTTTTATCGACTACTAGAAAAATAGTTGGGGCCTTGAAAACTACTCCTCCCTACT
GCCCCCCGAACCTTCAAATAGCTATATGTCCCCAGGGGCACGCTAAAATTAACGAGTTGA
GCCTGAGCTAAGAAGAGTCCCCGTTGTGCAAAACGGGGCTCTGAGAAGAGGGAAATTCGA
GCAGTCCATCGGGCCCAAGATGTTATCCAGAATCGACCTTTCCCTTCATCCCCCCTCCCC
GTTCCAGGTGAAAGCCCTTCCAGGTAGCTCTGACTTAAGCCAGGCATCTTATGACTTTTC
CTGCCTATTGTTAGATGTAATTAATGGAAAGAGACTGCAGATAACAACCTCCCAGAATAG
AAAGCACCGACTCCCACCCCCCGGCCCATTTTCCAATAACAACCACGTTTTGGTTCCAGG
GTCGACGGTGTGTGTTGAAAGACTGTTGCAAAATTCTCGATAACACGGTATTACCCCCCG
AGACGGTGGTCCCGCCGTTCACTGTCTTCTCGGGCTGCCCAGGTAACGTTGCATCTTTAT
TTTCTTCCTTTCCTTTCAGAAACCAAATATCTTCATTTGTTTCTATTTGTGCATTCGAAT
GGGGCAGCTGCAGCAGCAGCCTTGTAGGATTGTTCTGGGGGGCGAAAAGACTCTTTAATC
CCTGATCTTGTAGTTAAAATGAAGACACTTTACTTTGGGTTTGGTTTTTTCACAAACAAG
GCAAAATAATTAGGACTGCTGTGAAGAAAGCATATTGGGCGATTTCATCTTATCCCATAC
TGCAATGCCAAGGTATGGATTTCTTGGCAGAATGGAGAAGCAACCCATTTCAAGCATTTA
AACTGAAAAGCCATTTTTGGTATTCAATATATGACCAGTCCTCCCAAGCCCTTCCAACTC
AACTGTGATAAAAGGCGCAAACCCTCTAGAAACAATCCGATTCAGTCCGGTATCTTTAGC
AGAAAATACTCTGACTGTTTTGCTCACTTCACCTTCCTTTACAAAATTCCCGTTTCCAAA
ACTTGTTCTAGTTGCCGTCGGTCCCAAAAGTAAGTTGAGTGGATTCCGTCAGCTTCCTCG
GAGGGCTCTGAGAGTGAGGAGCGGGAAGCAGCGTGGCCTGGCGGAAGGAGGACGGACCTA
GGAGTCGGAGGACCTGGCTCCTGGTCCCGGCTCCGTCCCTCGTCTGCTGTGTTAACCGTG
GGCAAGTCACCTAACTTCTCTGCACCTCAGTTCCCTCATCCACAAAATGGAGAGTCAGTG
CCCGTTCTCCCTCAGTCAGTCAGTCGTATTTGTCGGGTGCTTATTACGTGCAGAGCCCCG
CACTAAGCACTTGGGAGAATAAAATGTAACAATAAGCAGACACATTTCCTGCCCGCAACC
TACTTGGACTGTGAGCCCCATGTGTGGCCTGATTATCTTATATCTTCCCCAGTGCTTATT
ACAATGCTTGACACTAAGTGCTTAACAAGTACCGCAATTATTACGTTCTTATTTTCAATA
AGGAAACAGTGATTCAAAATGTGTTCATGATTTCACTAAGTGGAGCAGTTATTCCGTATG
TTGAAGGACAAGGATGCGCCTTTAAAGGCTAAAAGTTTCTCATAATTCAAGTCGGTTTCC
GTGCATCACCGACACGGTTGGCGTAAACTGGCACCCTGAAGCATTAGGTACTGAACAGGT
TTTCTTCTCCCCTCTGCTGCCGGGGGTTTGTGCTGCATTTGAGGGCCCTGGCCAGCTCGT
GAAATACAGTTCTGTCCAGAAGCACCGTTTCCTCACTACTCCCTGCTCTAATCATAGTCA
CGTTGGTCTTCTAATGGGCTAGGTCCTAAGGGGAGTTTCCTGTCTTGACTACGGGAGGGA
GAGTCCAGCAGAAGCCTATCCATTCCATTCCTAGCTTGGCCATTGGCTAGCGAGTTGGAA
GGCAATCCGCTACAAGTCAAAGCTCACCAGAGCTGGGCAGTGGCAACACAGGAGAGAGTC
GAGGGATGAGACTCAGGTTTACTGCCGGAAGGAGGCAACGGTAAACCGCTTTTGGATTTT
TTACCAAGAAAACTCTGTGGAGCCACTACCAGAGCGATTGCAGGTGGAGGTGGGGAGTTC
TGAGAGATTGTGGGTCAGAGATGACTCGACAGCATAAGACAAGACGTGCCAGGCACGATA
CTAGGCCCTGGGGTAGACACGAGCTAATCAGATTGGACACAGTCCACGTCACAAATGGGG
CTCACGGTCTTTATCCCCATTTTACAGATGAGGTAACTGAGTCACAGACACATTAAGTGA
CTTTCTTACGGTCCCACAGGAGACAAGTGTTGTACCTTCCTTTATTCATCCCTCCTTCAA
CCCCACAGCACTTACGTACATGTCCGTAATTTATTTATATTAATGTCCGTCTCCCCCTCT
AGGCTGTGAGCTCATTTTGGGCAAGGAATGTGTTTACCAACTCTGTTATGTCATACTCTC
CCAAGCGTACTCTGCACACAAGTAACGCTCAGAAAAATACAACTGATTGATTGGAGCTGG
GATTAGAAGCCACGTTCTCTGACTCCCAGACCTGTGCTCTTTTCACTAGGCCAGGATGCT
TCTCTCTGGGACCAGTCTATGATACCTGAGGAATTGTGGCCTTCTCATATTGCATTTTCT
GCAAATGCATGGGTTCATTCCCAAAGAGGCTCAGCATACACCTAGCAAACCAGAGAAAAT
TCATTTAGTTCATTCGTATTTATTGAGCGCTTACCGTGTGCAGAACACTGTACTAAGCGC
TCGGGAGTGTACAGTACAGCAATGAACAGACACATTCCCTGCCCATAACGAACTTACAGT
CTAATGTCAGTGGGGGAGAAAATGTTTAGTTGTTCTGAGGGACACCAAACCTATCCTCTC
ACTTGCTGGTCATCTTGGGGAAAGCAGCATGGCTCAGTGGAAAGAGCATGGCCTTGGGAG
TCAGAGGTCATGGGTTCGAATCCCAGCTCTGCCACTTGTCAGCTCTGTGACTGTAGGCAA
GTCACTTCACTTCTCTGGGCCTCAGTTACCTCATCTGTAAAATGGGGATTAAGACTGTGA
GCCTCAGGTGGGACAACCTGATTACCCTGTATACCCCAGCGCTTAGAACAGTGCTTGGCA
CATAGTAAGCACTTAACAAATATCAACATTATTAACTTCTTTCCCCAAGATGACCGGCAA
GTGAGAGGATAGGTTTGGTGTGGACTAAGTACAACTGAGCACAACAGAGGTACCGACCTA
GAACATTCCCAGTTCTTCAGTGACCTTAAAGTGGTAATATACATTGGAAATTATTTCATT
GAACTCCACTCCATTTGCCTAGAAAATGTAAAACAGCTGAGTTGGCGATGCAGATTTAAA
CCCATAAACATTCCAAAAATCGCCGGAATGATGAATTAAAAAAAGAACACACCTCAAACC
ATAAGCCTTTCATCCCTTCGAAACTCATGTTCATAAGTTCTTTCTTTTTTTAGGGCTCTT
CTCCGGAGAACTCCCAGAGTGTACTCAGGAGCTGATGATCGACGTCACTAAGAGCTACTA
CCAGAAGTTTTTGCCTCTCACTCAGGTCTAGTACCTATTTCCCCACGCCTCAGACTAGTT
TGAGCCCTAGAAAGGACTCGGGGGCCAGTGTGTAGCGAGCCAAGGCCAGGATCTTGGACT
TTGGGACTCGGATCTGAAAACCTTCCCGTTGTAGAATTTCTCAGCCGTCTCTCTCCTCAG
CTCTGTCAATTTAGGAAGCAGAACCCTGGAAGAATTGTGCATTTGTTATATTTATTCATG
ATTCCTTCATTTCAAGTGTCTTTGCCCGACAGAATTTTTTTTTTAAATCTATATACCGTA
ACTCCTCTGTCCCTGAGGGGAAGCACGGCAAGGAGGAAAAGCTTTCTGTGAGAGAGTTTC
CATGGAACAATGTTACACTATATATATCTGGGACACCCTAACTAGTGGTCGCTGCATAAA
TAGCGAAGTACTTCTCTGTTACTAATAAATAGTCTGCTGCTCTGTTTGCCTGGCAGCCCT
GAAAAGTACAAAGATGTTCAAAGAGTCTGGGACCTCACCCTTCACTTCTCAAGCTGATTG
TAACACAGCTGTAGCCAACATGGGTACAGAGGAGCTTCAGGGCCCTTGCACTTCCTTGTT
AGGAAATAGTAAAGTTTAGGGGCAATGAATATTTGCTGGTCATTGCCTTGGTTTTCTCAT
TCTATATCTATAAATCTAGTCAACGTCCCTGCCTCTCCCCCCATGTCCCGTCCCTCCTCC
CTTCACCCCCCCAACACACAGAACTTCAATATGCCCTCTCCCCCAAATATTGATCAGGTA
GGTTAGGATTAGTTTGGTTGTGAGCGCTTGTTCCCCCAAATCACCCTGACGACTTGAGGC
CTGCACCCGACAACATCGTAGCATTATAGTGACCCAGTGTCATGGTGGGGTAGGAGCTGG
AAGCTTATAACTTGCCTCCTGCTCTATCAGGCACCAGTGTGATACAGACAAAAGTCAGCA
TTTTTGCCCCTATAATATTCGCACTAAAGGCTCACCCCGTTGAGGAAATCCACGGAAAGA
GTTTTCACGAGGGCCAGAGATTCCCATTCCCACTGGACTGCGGACCAAATGCATTTATTG
TCGCCCCGCACTTCACGATCAAAATGGTAGTGCCTCTGCCTTTGGCCATCTCCTCCTGGC
CCAGCAGGGTATGTGCACAGGTAGAGTGGTGGGGATGGCCTAGTTTTATTACCCTACTTA
GGAAGCTAAGGCGCTGTCCCCGCTTCGATTCTTCAGCCTTGAGATTGGCAGCAAAAGAGA
ACCGTTGGCTTACAGGCAGGGCTTCGACACTCATTAACTAGGCCTGTGCGCCACAAATAT
TGCAGTGTGTAGTCATGATTGGTCCATCCTATGTAAAGCTGCTGTCTGGTTTGTATTCTT
TCTGTACATAAATTAAAAGCCTCTTGAAAGGGTCAAATGACTTGAAGGTGGTAACTTTCC
ACATCTAATTTTGAGGAACCCTGGGAAATGCCTTGCTCCTGGAACAAGGGTGTCGTTCAT
CTCCCCTGGCCCCAGTGACTCGCGATTCCCTGTCCTCCTGCCTAATAATCTCTCCCCGGG
TCTAGAAGTGGTTTTCCTTAGGACACATGGAAGAGCCACCCCCACTTAGGCAAATAGTTT
TAGTCATTCCTGTCACAGTTGCATCTGGGAGGAGGGGAAGCTGAATTAATGGAAGCGGCA
TAGGTGGAGAGCCGGAAGATCAAAAACTAGGCAAGAAATCTCTTTCTGGGAGAGGAATCC
ACTTGATTCCAAAACGCTTAAGAAAGGAGGCTCAGGAGAGTTGAGGTTTTCAAATCCAGT
GGAGTTACAGATTTCATTGATCCGTTGTCCTGGGAGAGAGCTGGCCTCAGGCAGACTGTT
ATCCATGCTCCTCCCAGGTGGTAGAGATAAGACAGTTATGATACAGTTCCTGTGGAGAAT
GAATATTGGGAATCATTGTGCTTCCCAAGAAATCCGCAAATCAAATAGAGGTGATTGATT
GCAGCCTTCCCCCGAATTACTCTCCTGATTACTCTCAGGTTGTTAAGCAATTTGGAAGGA
TGGGCCATTTGTTGTTGTTTGACATTTTGATATCACATGTAGTCTGTTTTCCCAAATGTA
CATCTGAACTATTCCTTGTTCCCCACTTTGCTGGCGGCTTAGAACATCTCAGGACCACCA
GAGGGTAAGCTCCTCGGGGTCAGGGATCGGGTCTACCAACTGTCGGCTGTTATACTGTAT
TCTCCCAACCAATCAGTACAGTGCTTTTGCATCCCAAGAGACCAAAGTCCTTTATGTTGG
AAAGCAGTTTCCGAAGCAAGTGGCTTGGGGTGAGATTTTTCCATTTTTCAAAGAGGAGAT
GCCAAATGGCGTCTTATTGTCGCTTTCTGTTGCTGAATTGTACTTTCCAAGCGCTTAGTA
CAGTGCTCTGCACACAGTAAGCGCTCAGTAAATACCATCGAATGAATGAATGAAATGGGG
AACGTCCCTTTTGATCCCTGCGGAACTGGCTCTTGGGGTGAGCACTCTCTGTGAAAGTTG
TACTTTCCCAAGCCGCTTAGTACAGTTTTCTGCACACAGTAAATTAATAATAAATCGATA
ACTTCGATTGAATGAATGAATGAAACATCCCTTAGGTACCTGTCTACTTAAATTTCATTT
CCATATTAATAAGAATTCATTAAGCACATACTAAGCAAGAGTAGATACAAGATAGGTTGG
ACACAGTCCCTGTCCCTTAAGGGGCTCACAGTCTAAGCGGGAGGGAGAATAGGTTTTGAC
TCCCCATTTGACAGCTGAGGAAGCCGAGGCCCAGAGAAGTTAAGTGACTTACCCAGGTTC
AGGGAGCTGGGATCAGAACCCAAGTCCTCTGACTCCTAGTCCTTTGCTCTTTCCACTAGG
CCAGGCTGCTCCTCTAGTGTTTTGCATCAGCGTACCTAAATGACACTTCAGTCAGTGGTA
TTTATTGAACGCTTACTATGTACACTGTACTAAGCACCTGCACTGCACTTCAATCTTCAG
TCTTAGTCACTTAGACTTAAAAAATAATTTCGTATGTTCTAGAAATCATGTTTATTGATT
TATCTTCCCTTCCTCAAGCTTTTTTTAAGCTTGTGTCCTGTCCCTCCTCCTTCGTAGGAA
CCCTGGGCCAAAGTCATTCAAGACAGTGGGGATTCTGTGCAACAGAAGAAAGATCCCTGT
CTGAAAGGGCGGAAAATTTTGGCCGGAGTATCCGCTCACATGCTCAGCAGATTAGCCCAC
TTGTCCCTAACAGCCTTACAAATAGCTGATGCCAGGCAAATGGCAAAAAAATGCTGATTT
AATTGAAATCTCTACCTTTGTGCCTTCTGGCAGGAGGCCGGCCTGGCAAGAGTAGACAGT
TGCTTTTTGGTACTGGTTTGCAAGACCAGTCTCATTTAGCTCATTGACCTGATGCCTGAG
CTTTCAGGGTAGTAGGGAAAAGACCCTTAAAAATTCATCTGGCTGGTTGTCCCTATTCCT
TGTCCCTATTACTTTTCTCACATCTCCAGAAAGGTTACTGAGGAAATGTCTCATGTTTGG
TTGCCATGAGTCCTAAGGCTTGATTCAGCACAGTTAGGTAGATGTGTCCATGTGTGTGTA
GCGGGGGGCTGGGGGGAAAGGGACTCACTGTCTTGCTTCATGTTTTCACGTACTTCTGAA
CTTGATCATCCAATCCCAGTCTTGCTCAACACCAAAACCAAAGCGATTTTCCCTCTCTGG
TGGCTGATGAGGAAAATAATTACTTCCACCAGTTTTTGGTTGGTTTTTTTTAAATAGTAT
TGGTATTTGTTAAGCACTTACTACGTGTCAAGCACTGTTCTAAGTGCTGGAGTAGATACA
ATTCCATCAGATGGAGCACAGTCCCTGTCCTCTACTGGGGCTTACAGTCAAGTAGGAGGG
AGACGAGGTATTGAATCCCCATTTTACAGTTGAGGAAACTGAGGTACAGAGAAGCAAAGT
GACTTGCCCAAGGTTACACAGCAGGAAGGTGGCCGAGCTGGGATTATTACCAAGGTCCTG
TAGTTCCCAGGTCCGGGCTCTATCCATTAGATCATGCAGCTTCCCAATTCTGTTTAGGAA
GTGGGTCGTTCCCTAATCGTACTCCCAGACCCCTGGGATTGACAAAGAGACTGTCTCTTC
CCTTCCCAAAATGAACCTGCCTCTGCCTTGAGATGGCATGGGAAAGAGCCAGTAGGGATT
CTAAAGTTGGGAAAGAGAGAAAGTAACAGTTGTATTTTGAGGTTGTCAACATTGTAGGTG
AGATATTTTTGAACCCCAAACTTTTCATTGCATTTTCATAACCAGCACGCAGCCCACGGC
CATAAGAAATAGTCACCTGAAGAACTACAGTTCTTTGTAGTACAGTTAAGGTTCATATTT
TCCATGTTACTTCATCCTTTCTTGCCCACCATCTGATTTTCCCTTAATCCCAAACTAATT
TTTTTCAGTCCCACGTGGACCCATGTGGATTTCCATGGCTGTGTTTATTGCTACACTTTT
CTTATGGGGACGTCTGTGAAGCTTTCACTTTAAAAGAGATGAAAACGTAGCACTTGGCTA
GACCCTAGATCTTCTTCTCCGGCAGAATGAAAATAGAATGAAAATAAAATTAGTTGGGGA
CAGTGGGTGCCGGTTGCGAAGAGCATACAATTGACTGTGTCGAAGAGGTATTGTTTCATG
GAAGGGTCTGACTCTGAGGTTTCTGTTTCCCTGGACATTCAAGAATCGGTCACAGGTTTT
CGTTGAGCGCTTACCGTGTGCCGACCACTGCACTAAGCACTTGGGAAAGGACAGTACGCT
AGTATTGGTAGACATGATCCTTATCCACAAGGTGCTTACAGTCTAGTCGGGGAGGCAGAC
TTTTAGGTAACATACAGACAGGGGCTCATAGCTCTTCTGCCAGAGAATGTAAAATATAAA
AGCAAAATACTTCAGAGTTCCTTTTCTGCGAGGGAACGGATTGGAAAATTCCCACAGGTG
CCTCTGACTCACCCCACGGTCACAGTTAATCTCAGCTCTCCTTTGCTCTAGGGAAGAGGG
TAGACTGTAAGTCCCCTGTGGGCAGGGAAGGCGCCCCCCAACTCCGTTATATGGTAGTCT
CCCAAGTGCTTAGTCCAGTGCTCTGCACACAGTAAGCACTAGATAATACCACCGATAGAT
CGATAGAGTGGAGCAAGGTCATTTTGGCTGAGTGGATTGTATTTTGGTGCCTTTGGTGGC
CCTCCCTAACTAGCCCATTCTGATGCACTAATTGAAACAACGTATTCATGATCATAAACG
TGAGACTGGAATACTAAATGCTAAGGGGGTGATCAGAGGCTGAGGAAGTTGCTTACAAAG
CATGGTAGGCATTTTAGGGATATGGTGAAGGAAGATCTGAGGACAAGTTGTAGAGTCGAA
GGGACCCAGAGAGCTGGAACGTTAAGGGAATAAATAGCATTTGCACAGGGATTTAGTACA
CCGCGATTATGTCCTGTGCGCTCTCCCTTCACTTTCTGAAGTTCGGACAACTGGGCCCAC
TCCCCCGCAGCCTGAATTANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTTTTATCAAGGTGGCCCC
AGCGAGGGCATAAAAAGCAAGTCACCAGAGACGACCTCTCAAAAGCAGCCCGCTTATAAC
CCCCCCTAAATTAGCCATTTTAACCTCAATCCACCAGCCCACCGTCGGGTCCTGCGCTCC
TGACTCCGCACCTCTTGCCACCCGCCCTGGTCGAGAGGACGAGAAACCGCCACCGGGCCC
TGCCTTCTGCCTGCATTGCTCTTGGGGAGCGGTAGTTCCCTGGAGAGGACGCACATTTTG
CCCGATGACCCTGGTCCCTTGGAGATTTGACTGCAAATAACCGAACCCCAAGGTCAGCAG
GCAGGAACTGGGGGAAGCGTCAATTGGGCGGAGGGCAAAAATCAGGGTCGTCTGTGGAGA
AAACCCAGTTTCCATTTGTCTGAAAATAATAAACCATCCCTGCACTGGGCTCCCCTCACT
CTGTTGTTGCTGTGACTGCTGGGGCCGGGACAGGGGCCACGTGGAGGCCAGATTGTCCCC
CAGTTTGGGTCGATGAGTGGGAAATGGCTCCCGGAACCTTCACGGCGGTCACCAACCCAG
CTGCGCTCAATACTGCAGGAAAGTGAAGGGAAGCAAAGGAGAAGTAAGCCCCAGAGTGGA
TGTGGTTCATCGAATGAGCGTGCAGTAGCTTCTGGCTGATAGGCACTCTCCTTGGACCTA
TCTCAGAGACAGGTACAGGGCCTAGTGGGAGGAGTGAAATGTCTTTTTAAGGCCCAGCCA
AAGGAAAACCTGGTCAGTCACTATTTCTGAAGAAAGCACTCTCAGCGGAGATGAGTTTGA
ACTCTTTGGGTCGTGGCGATACCCCCTCTTCCCCAGTTTTGCTGGAAGCCGGTGGTGTCT
GGGAGATTTGTCGGAATGAAGATATCTTTCTCATTCACAGTCATCCTCATGGACTTTGGA
AAGGACCCAGCATACACAGGTTGTCGGGTCCATCCTGGGCACTGAGTCCAGGGGGACACG
GGGCACCCCAGAGACACACACCCCATCCTCAAAGAATTAGCCAGCCAAATAGAGAACAAT
CAAGAACATTCATCACGACGGTACAAAAATAAAGGATTTACACTTCGAGTCAGATGGATC
TGGGTTCTGGTTCCGCCACTTGTCTGCTCTATGACCTTGGACAAAACACTTCACTTCTCT
GGGCCTCAGTTACCTCATCTGTAAAATGGGGATTAAGACAGTGAGCTCCCTGTGGGACAG
GGACTGTGTCCGACCTGATTTGCTGAATCCACCTCAGTGCTTTCACAGTGCCTGAAACAT
AGTAAGCACTTAACAACCACAATTATTATTATCTCCCCTCCTAAGTCTACCCTTCATGTA
TTTCCAACTTTCCCCTCAGTTGGTAACACCACCATCCCTCCTTGAAGCCTGGAGCCTCCA
GCATCATCCTTGACTCTTCGCTGTTCTTCAGCTCTTAGATTCAGTCCATTGTGAAATCTG
GCCAAGTTTTCTTTTACAACATCTCCCGGATCTGCCCCTTCTTCCCCACCCAAACAGTTC
CCACCCAAGTTCCAGCTCTTTGTATTGGGATTAATAATAATGGTAATGATTTTTATTAAG
CGCTTACTATGTGTCAAGCACTGTTCTAAGCACTGGGGTAGATACAAGATAATCAGGTTG
GACATCGTCCCTGTCCCACATGGGGCTCACAGTCTTATTCATTCATTCATTCAATAGTAT
TTATTGAGCGCTTACTATGTGCAGAGCACTGTACTAAGCGCTTGGAATGAACAAGTCAGC
AACAGATAGAGACAGTCCCTGCCGTTTGACGGGCTTACGGTCTAATCAGGGGAGACGGAC
AGACGAGAACGATGGCGATAAATAGAGTCGAGGGGAAGAACATCTCGTAAAAACAATGGC
AACTAAATAGAATCAAGGCGATGTACATTTCATTAACAAAATAAATAGGGTAATGAAAAT
ATATACAGTTGAGCGGACGAGTACAGTGCTGACGGGATGGGAAGGGAGACGGGGGAGGAG
CAGAGGGAAATGGGGGGAAAAGATGGGTTTAGCTGCAGAGAGTGACGGGCGNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1051, 1999..2067, 4201..4319, 14258..14369, 17099..17201, 20153..20244, 26092..27291
1001..1051, 1999..2067, 4201..4319, 14258..14369, 17099..17201, 20153..20244
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved