Ornithorhynchus_anatinus Locus XRN2
snOPY snoRNA Orthological Gene Database
Ornithorhynchus_anatinus XRN2
Ornithorhynchus_anatinus
XRN2
1
SCARNA6
24585..24852
76616
TCAGTAGTATTTATGGACCGCTTACTCCGTGCACAGCATTCATTCTCTCAGTACTATGG
ACTGACCACTTACTCCGTGCAGAGCATTCATTCCCTCAGTAGTATTTCTGGAGCACTTAG
TCCGCGCACAGCATTCATTCCCTCAGTAGTATCTATCAACCGCTTACTACACGCAGAGCA
CTCATTCTCTCAATAGTATTTCTTGCGCGCTTACTCGGTGCACAACATTCATTCCCTCAA
AAGTATTTCTTCGTGGCTCACTGGAAGGAGCACGGGCTTTGGAGTCAGAGGTCATGGGTT
CGAACCCCGGCTCTGCCACTTGCCAGCTGTGTGGCTTTGGGCAAGTCACTTAACTTCTCG
GTGCCTCAGTTCCCTCATCTGTAAAATGGGGATGAAGACTGTGAGCCCCACGTGGGACGA
CCTGATTTCCCTGTGTCTACCCCAGCGCTTAGAACGGTGCTCGGCACATAGTAAGCGCTT
AACAAATACCAACATTATTATTACTATATGCAGAGCATTCATTCCCTCAATAGTATTTCT
TGATCGCTTACCCCATACACAGCATTCTTTCACTCAATAATACTCAGCGACTGCTTGCTT
ACTACAGGCACAGCATCCATTCCCTCAGTAGTACTTACTGACCGCTTACTCCACGCAGAG
CATTCATTCCCTCAGTCGTATTTATCGACTGCTTACGCCATGCAGAGCATTCATTCCCTG
AGTAGTATTTATGGACCGCTTACTCCGTGCACACCACTCACTCCTTCAGTAGTGTTTATG
GACCGCTTACGCCTTGCAATAGCATTCATTCATTCAGTGCTATTTACTGATCGCTTACTC
CGTGCACAGCATTCATTCACTCAGTAGTATNNNNNNNNNNCGCCCGTCCGTCCGACCGAC
CGACCGACCGACCGACCGACCGACCGACCGACCGTCCATCCATCCATCCGTGTGTCCGGC
GGTGGTTGGTTGGGCGGTTGGGAGGGTCCCGGGCGGGCGCCATGGGAGTGCCGGCCTTTT
TCCGCTGGCTCAGCCGCAAGTACCCGTCCATCGTCGTCAACTGCGTGGAGGAGANNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNTCAGTATTATGGAACCGTTTACTCCGTGCAGAGCATTTATCCCTCTAATA
GCGTTTTGGGACCGGTTACTCCATGCACAGCATTCCTTTCACGCAATAAATATTTATGGC
CCACTTACTCCATGCACAGCATTCATTCCCTCAATAGGATCTCTCGACCACTTACTACGT
GCACAGCATTCATTCTCTCGATAGCATTGACTGACCGCCTACTACATGCAGAGCGCTCAT
TCCCTCAGTAGTATTTCTTGACCGCTCACTAGGTGCAGGGCACTAGCCTCAGCGCTTGAA
AGTGACAGCTCGGCAACAGAGAGAAACAGTCCCTGCCCAACGACGGGCTCACGGTCTAGA
GCGGGGGAGACGGCAAAGCAGAACAAAACGAAACACAAAACAGAACGGAACAAGTGGTCT
GGCGCAAACGTCAAGGTTGATAGAATCATAGATCTAGACAGCTCATCGGCAAAATGAATA
GAGTAATAAATAATATTTACAGACGAGCACAGTGCCGAAGGGAGGAGAGGAGGAGCAGAG
AGAAAGGCGGGGGGGGGGGGGGGCTCAGTCTGGGAAGACCTCCCGGAGGAGGTGAGCTGT
CGGTAGGGCCTGGACTAAACGCTGAAAATGTACACTTTGGCAACACGCAGAGGCCATCCC
TCCTCAACCACGGGCTCACAGGCTAAACACGATGATGGCATTTGCTAGGCGCTTACTATG
TGCAGAGCCCTGTTCTAAGCGCTGGAGAGCATCCTTTCATTCAGTCGTATTTATTGAGCG
CTTACTATGTGCAGAGCCCTGGAGTAAGCGCTTGCAATGTACACTTGGGCAACAGATAGA
GACAATCTCCGCCCAATAACAAGCTCACAGTCTAAACGGGGGAGACAGAAAGCTAAACAG
CATCATCAAGGTATTCATTCATTCATTCAATAGTATTNNNNNNNNNNAGCGCTTACTATG
TGCCAACCACTGTTCTAAGCACTGGGAGGTTACAAGATAATCAGGTTGTCCCACATGAGA
CTCACGGTCTTAACCCCCGTTTTACAGATGAAATAACTGAGGCACAGAGAAGTTAAGTAA
CTTGCCCAAAGTCACACAGGGGACAAGCGGCGGAACCGGGCTTTGAACTCACAACCTCTC
ACTGCCAAGCCCGGGCTCTTTCCACTGAGCCACGCTGCTTCTCGGAAAGAAAAGACTTTG
CGTGTTCCGTTCGAAGAGAAGCTGAAATTTCTGAGGGAGATGGCAGCCTTTGTTTACCTG
AAGTGGTGAAGACCTCCAAGTTCTCGTTTGTCAGTCTGATGGAGAATCTCTTCTTAACTC
TCGTTGATAGGAACACTTCCAGCACATTTTCACATGATCTCTTCATAGGCCATTCAGTGA
CTTCTGTAACCAGAAATGAATGAATGGCAACCCAGGCTGAAGGAACTGAGAAATCCGTTG
AAAGTTGGAAACAAAATATGCACGTTCGGCCAATCGGTGGTAATCACTGAGCCCTTACTG
ATTACCGAGCACCGTACTAAGCTCTTGGAAGAGTACATTGTAGCAGAGTTGGGAGGCATG
TTCCCTTCCTACAAGGGACGGGGAGGGGGAGACATCCACTGAAAGAAATTACAAATTACA
GTGCTGTGGGGCTGAGGGTGGGGTGAATTAAATTCTCAAATTTAGGAGACCTTGCGCAGA
GTGTTCCATGTCAGAGGCTACTTTCATCTGCCATGTGGTAGCATTAATTTTCAGTAAAGC
TGAAGGAAGAAAAGTACAGCGAGTGAGCAACCCAGTCTTAGGATAAAGTAAGTTCAGAAC
AGGATTCAAAAAACATAAACTACTGCCTCATAAAAATCATTCTTTCGCATTTATTGAGTC
CTTACTGGGTGCAGAGCACTGGACTACGCACTTGGGAGAGGACAATATAACAGGCATATT
CCCTGCCCACAGCAAGCTCCCAGTATAGAGGGGCAGGCGGACATTGATATACATAAATAA
ATTACAGATAAATGCATAGGTGCCGTGGGGATGGGAAGGAGGATAAAGGGAGCAAGTCAG
AGTGACGCAGAAGGGAGTGGGAGAAGAGGAGAGGGGAGCTTAGGTTTCTTAAATTTGGGG
TGTCTTAATATTTGGTAGGTTAGTTGTTAGAATTGGTGACAAGTTTAAATTTAGAGGGGT
GCTGACGGTTTAAAATGCGTATTTTAGAATATATATTTTAATTGCCGTTTAAAGCCAATT
CCCACTGATGTAGTACAGTTAACTCTCTGGTGTTCTTTTGAAGATGATCCATCCCTAAAG
ATGTTATAAATGGTATATTGAAATTTTTTTAGAGTAAATTCTCATATTCTTTAAAAAACT
TAAAGTGCTCTAAATGTAGATTTGGGGAGAATCGACGAGTACCTTTACCGTAGGTACTTT
TAGAACTCAAGCTCCGGTATCGAAGTCAGATATAGCTTTTGTGCGTGCACGCAGCTCATA
ACCGGTTAGCGAGCTGGGTCCGGGGGTGATTTCTGGCCTGGGGTTTGAGGATCTCCTGAG
GTCCCCGTGTGATCCATGTGGTGTCACATGGTGGTACAGTCACGCTGCAATATGCCCCTC
TTCTTTCCAATTCCCCAGACCAAAGCTCTCCCCAGCTTCAAAACCTTTCAGAGAAAACCA
CACACACACACATACATTCATTCAGTCAGTCGTATTTATTGAGCGCTTACTCTGTGCAGA
GCACCGGACCAAGCGCTTGGAAAGTACAGCTCGGCAACAGAGACAATCCCTACCCAGCAA
CAGGTTCACAGTCTAGAAGAGGGGAGACAGGCAATAAACCAAAACAAGTAGACAGGCATC
AATACCATCAAAATAGATAAAGAGAATCATAGATCCCCGCACGCTCCGCTCCTCCGCCGC
CCACCTCCTCACCGTCCCTCGGTCTCGCCTATCCCACCGTCGACCCCTGGGCCACGTCCT
CCCGCGGTCCTGGAATGCCCTCCCTCCTCACCTGATTCTCTTCCCCTCTTCAAAACCCTA
CTTAAAACTCACCTCCTCCAAGAGGCCTTCCCAGACTGAGCGCCTCTTCTCCCTCTACTC
CCTCTACCACCCCGCCTTCACCTCTCCGCAGCTAAACCCTCTTTTCCCCCCTTTCCCTCT
GCTCCTCCCCCTCTCCCTTCCCATCCCCTCAGCACTGTACTCGTCCGCTCGACTGTATAT
ATTTTCATTACCCTATTTATTTTGTTAATGAAATGTACAGCGCCTCGATTCTGTTTAGTT
GCCATCGGTTTTTACGAGATGTTCTTCCCCTCGACTCAATGGATCGCCATCGTTCTCGTC
TGTCCGTCTCCCCCGATTAGACCGTGAGCCCGTCAAACGGCAGGGACCGTCTCTATCTGT
TGCCGACTTGTTCATTCCAAGCGCTCAGTACAGTGCTCTGCACATAGTAAGCGCTCAATA
AATACTATTGAATGAATGAATGAATAGATATAGGCTCATCATGAATAAAATAAGTAGAGG
AATAAATATGTACAAATATACACAAGTGCTGGGGGGAGAGGAAGGGGATAGAGGAGAGGG
AAGGAGTAGGGGCGATGGGGAGGAGAGGAGGAGCAGAGGGAAAGGGAGGGTTCAGTCTGG
GGAGGCCAGCTACCTACATACATACATACATACCTACATACATACCTACATACATACATA
CATACATATCCCTCTCCCTGCTCCATGCCTCCAGGTTCTTTTTATCAAAGGCATGAGAAG
CTTGGAGGTGACGAGGCTTTTGGGACACAACAAACCCCCTTCTCCTCCTCTCAGCACTGT
GCTGGTTTGTATATATTATTTATTACCCTATTTATTTTGTTAATGAGGTGTCTGTCTCCT
TCATTCTATTTATATTGATGATGTCTTGTTTTTTGTTTTGTTCAGTTTTGCTCTGCCATC
TGTCTCCCCCGTTTAGACTGTGAGCCCGTCACTGGGCGGGGATGGTGTCTGTCTCTTGCC
GAATTGCCCATTCCAAGCGCTTAGTCCAGTGTTGTGCACACAGTAAGCGCTCAGTAAATC
GTGGTTCGGTGGAAAGAGCCCAGGGTTGGGAGTCAGAGGTCACGGGTTCGAATCCTGACT
CTGCCACTTGTCAGCTGTGTGACTGTGGGCAAGCCACTTCACTTCTCTGTGCCTGTTACC
TCATCTGTAAAATGGGGATGAAGACTGTGAGCCCCACGTGGGACAACCTGATGACCCTGT
ATCTACCCCAGCGCTTAGAACAGTGCTCTGCACATAGTAAGCGCTTAACAAAGACCAACA
TCATTATTATTATTATTAAATACTATTGAATGAACAAGCCGTGGCAGGCAGGGAGGTTGC
CCGGCTGGTGGCTTCGTGGTGGCAGCCCAGGCACTTGTCACAGACGAAACTGGGAGCAAT
GCCTGTGGAGCCCTGTGGGGTGTGAGTGTTGGAGCAGCAATAGTCCCCTGCCTGAGGAAG
ATGGAAGCTTGTTCTTCTAGANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNGAGAAGCAGCACGGTGTAGTGGATAGCGCATGGGCCTGGGAGTCCGAAGCTCCTG
GGTTGTAATCCCAGATCTGCTGCTTGTCTGCTGGGTGACCTTGGGGAAGTCACTTCCCTT
CTCTGAGCCTCAGTTACCTCATCTGTAAAGTGGGGATTGAGACTGTGAGCCCCACGTGGG
GCGGGGACCGTGTCCAAGCCGATTTGCTTGTAGCCACCCCAGCGCTTAGTACAGGCCTGG
CACATAGCAAGCACTTACCAAATTCCATCGTCATTATTATTTTTACTCTCCCAGACACTC
ATTACCGTGCTCTGTGCACGGTAAGCACTCAGTAAATCCCATTGAGGAGGAAGGTAATGG
TAGAAACACGCAGGGTAGGGGTTCGGCTCATGGCAGTTCTTTCACAGGACCTCATTATTG
GCATATAACATATCAGCGAGGGGCACATGAGCCCCCACAGGCCCTCTTGAGCCTGAGGCC
TGGGGTGTAAATCCCGTGAACCCCTGCCATAATCTAGCCGTGCCTGGTTGGTGTGCATTG
GAAAAGCATTTTTATTTTCAAGGCGCACCTTAAAAGGAATCTCTTCATTCATTGTGGAGT
GAATTCACAGGCGACGTCTACAATTATAAAAAGAAACTTAAGGGGTACTACCCGTGGGTT
TTTACTAGACCGGTAAACTAAAGTTCTCAGGGCAGCGCTTAGCACTCAGGCGCTCATTAA
ATACCTCTGATTGATTGGATTGTATGAGTGGTCATGCTAATTGTATACCGAGATACGATT
ATAAATCCCATGTGATTAGACAAGATACTCAATTCCTGGCATAACTAAGACACTGTAGTA
TTTTAAGTGAGGCGCGTGGCGATTTTGAAATGGGGAAAATGAGCTACATCTATGCTGCAC
TTAATAGGTAGCCCCCACTAATTAGGATTAAGGTTAGATCTACAACTGAGCTGGACTCCT
AACCTTGCTCATCTCAATCTGTCAGTCATATTTGATTGTTTTCTGTGTGCTGAGCACTGT
ACTAAACGCTTGGAAGAGTATGATAAATATGTTCCCTGCCCAAAAGGAGCTTACGGTCTA
GAGGGGGGAGAAAGACATTAAAAAATACAAATGTGTGCATAAGTGCTGCGGGGCTGAGGG
TGGGTTGGGGAAGTGCAAGGGCAACACAGAAGGGAGAGGGAGTAGCAGAAGTCAGGGAAG
CCCTCTTGGAGATATGATTTTAATAACGTTTTGAAGGTGGGAAGAGCGATGATCTGTCTT
ATATGAATGGGGAAGGGAGTTCCAGGTCATAGACAGGATATGGGCCTGAGCTTGGATTGC
TGAACCCAGTATGACATTCCTGAGCTCGTTAACTTGGGAGAAAGGGAAAAATGAAATTGC
AGTTTTTGTGAATTTTTCATTTCAAAACTTTGGTCCAGACCGTTCATTCACACTCACCTC
CCTCTCTCTCCCCGCAGTTGTTGAGTACAAGGGAGGTGGGAAGTATAAAGGTGCTGGGGC
CGGAGAGCAGATCAGGGAGTCATTAGGGTTGAGGGAAGGAAAGGACAGTAATAGGGTGGA
AGGATCAGGAATTGTCTGGAAAGGGTAGTTTGGCTGGAGACGGGAAGTGGAAAAGCACGT
GCCTAGTTTCCTGAGTCCCTTTCTGGTAGTTTTTTGGGGAAGTTTCTGTAGAAGCTATTT
CCGAGTATCCTCCTGATGGCCTTTGTCTCCTTTTCCTGCTGTTCTGCTGGGGGAAAGGGA
GAGTGTACAATCCAGCAGTGCCGTTAGCTCAGTGTTTAACAGTGATTTCAAGTGAATAAA
GTACTGAATCGAGTCGGGAAAATTGCCTCAAAAAATTCCATTATTGACTTGAAAAACAAG
ATGGGAAAATGGAAATCTTTCTCACCTCTGAAAGTTGTAAAGATTTTGATTAAGAAGTAC
TTTTTGAGGGCTTCACTTTACAAATTGTGCAGATTTAGAGTGTGATTCATTTTAAAAAAC
AGTCGATACAATATTCTGCATAAAGTCGGTGCCGAAATACCATTATCAATCAGTAGTTTT
TAGTATTTCTTGAGCACCTATTGTGTACGAAGCACTTTATTAAGCATTTGGGAGGGTACA
GTAGAATTAGAGATGATCCTGCCCTCGAGGTTACACGCTAGAAAAAGAATAAAGAGATTT
ACATATGTGCTACAGGGAGTTGTGTGGACCGAAATATTTAGGTAGCATGAAAATGTGAAA
TGACAGGTGAGGGCTATAAAGTAGAGAGATTAGCAGCCAGTCTGGGAAAGCTAGTGGAGG
AGATGTGAGTTCAGAAGAGCCTTGAAGATAGGGAGAGCAGTGGTCTGTTGGATTTAAAAG
GGGAAAAGAGTTCAAGACAGAAGGGAGACAGTGACAAGAAGGGGCGATGGGACACCAGAT
TGAGTGCCCTAAAGCCAATGATGTGGAACTTCTGCTTGATGCAGAGAGGAATGACCTCTA
TTTTGGAGGTGTTCTTGAGGAGTAGGGAGACAAGCGCACAACAGAGTTTTTGAAAGTGAA
GTTTGGACTGGAGAGGCGAGAGACCGAAGGCTGGGAGAGCTGCAAAAAGACCGATGCGGT
AATCAAGCCAGGATATAATAATCATTATTTTTGTTGTATTAAACACTTACTATGTGCAAA
AGCACTTTACTAAACACATGGGGCTTAGAGTCTAAAGGGGAAGAATAACAACATTTTGGA
GCTCTTCACCTATGGAAAATCAGGAAATGAATCAAACTGAGGTCTTCCGAGACCCAGATC
AGTGCTTTATCCATCAGACCATTTTGGCCAACTTCATAGGTGCTAGTGCAGCTTAATGCG
TTTTCTAGCTAGCTGTGCCGCTTGTCTGCTCTGTGACCTTGGGCAAGTGACTTCACTTCT
CTGGGCCTCAGTTACCTCATCTGTAAAATGGGGATTGAGAATGTGAGTCCCACGTGGGAC
AGGGACTGTGTCCATCTTGATTTACTTGTATCCACTCCAGCGCTTAGTACAGTGTCTGGC
ATATAGTATGTACTTAACACATGCCATAATTATTAGTATTATTGGCCAGAATATGACTAG
TGCCTGGGCCAGAGTGGTGGCCATTTGGCTATAAAGAGGAAGGGGTGGATCTTTTTCAAG
TTCTCGGCTCTTTGGTGACTCCTGCGAAAGAGAAATGGATGATTTTTCTAGAGAATTATA
AGCAGCTTTTAAGCCTTGACCGTTATATAATGTGACTAGAAAAGCAATTACACTTTATAT
GCTTATTATAAAATGTGACTAGAAAAGCAATTACACTTTATATGCTTATTATGTAACGAT
AAGATAGGTGGACCCACCCATTTTAAGGGCTTGGAAGAGTACAATATAATACAATATAGT
ACAATACAGAGTTGGTAGATGTTAAAAAAATTTTTCTGTGTCTTCAGTCGTATTTGAGGG
CTTACTATGTGCAGAGCACTGTACTAAGCACTTAGAAGAGTATAATACAATAGAATTAGC
AGAAACATTCCCTGCCCATTTTCAGAAGAAAGGAAATAATTTGTGGAGCTGAGTGGGATG
TACAGATTATATATTTTTTACTTTTTAAATTTTATTTTACTTCTTCCAGTTTCATAGCTT
GCTGGCCTGGTGGACAGAGTTTTTGGATGGAATGTTGGTCTTTCCCAGGCAGTCCTCTCC
TGTGTTTTTTCCTTCGATTGCTCTTTCTATTTTGGGTTAATTGTGTTGGCCGGACTCCTT
TTTGGATCTGTATCCCTGTCCCTCCATTCATTCAGTTGCATTTTCTGGGTGCTTACTGTG
GGCAGAGCACTATAATTAATCCTACAGCGCCAACTGCAGCCTTGGATATCTAATTTATTT
ATTATCTGTAATTACTTATATCTGTAATGATCTCTCTTTTCCCACCTAGACCTTAAGCTC
GTTTTGGGCAGGGAATGTGTCTGTTTATTAATAAATACGATTGATGATAACTGATTGATA
CCCAATATGCTTCCTCCATAAATGGGTTCATGCAGTAGTGTGCTGTTGGCAAAAATCCAG
GCACCAGACTGAGCTTGGCCAANNNNNNNNNNGGGGGCTTGTCCAGTTTACCTTAAGAAA
TCACCAGCAGACATACCTATTTGATGCCTAGGTTGGTGAATTTCTTCTCATTCTCTATCC
CTTTGTTTTTACCATCCCCTCTCCTGTGTTTTTCTTAGTGTTCTCACATCCTGTCCTCTG
GTCCTGCACTCCCCTGTCACTCTTTCTGCAGGTTTCTTCTGCTTGTGTGTATCCAGTATA
GATGGAGGGGCTGCCATTGTGCAGATAATTGAAATTGAACATCCAAAGAGTCTATCTCTC
AGAGACCCAGGGGGGAGTGGGGGGCTGAAAGCACCCTGACGGTGTCCTATGATTTTTAGA
ATAATTTGAATACCTGCAAAAAGCGGCATGGATTTCCTTCACATAAACGGATCCACTTTG
GTTGCTAAGAGAAACCATGTCACTTTTTTGCAGGTGTCTTAAGTGATAATAAATTCAGCA
AGCTCCTTTTTGCTCTAGGAGAGGTAAGTGTGAGTTTGAATATATCAGCACGTGTACGCT
TGAGACTGAAAATTTGGGTGTTTGGTGTTTGTTTTGTGGGTGGGTGACTTAATGGGCATG
GACGTCTCTAGGGGACCGTGAGGTAAAATAATGGAGTTGAAAGAGTTGAAGAAAGTTGAG
TAGGGTCCAGTAGTAGTGAAGGTGAAGTTCTCTTGTCAAGTGATTGAGGAAAATGTTTAT
CACGTTTGAAAATCAAGACTCTAGAGTACCTTTTCCAGGTTGACATGTGAGATCTTGATC
GGGTGGGTCATCTTAAATGGTTCAATTTGGGATATTTTGTCTGAAAAAGGAGCTAACTTG
CTTTCAGAACAATTTGCGGAGTAGTTGTGATTGCAAGGCCTTTTTATATGTACTACATCA
AGGAGATCCCGGGACTTGGCCTGTCCATTTCTCAGCTCAGCCTTTCCTGGCCCAAAAAAC
CCTCCAAAAAACTATTGGCATCTCCCTGCTGTGATCTCCACACACACAGCTAAAGGGAGA
TAAGTGAGTATATGGAGTTCCCACAGGGTCAGGGTGACCAACTCCAGCCCAGCAGAAGAG
TGCGGACCCATTAAACGCGAACTTCCGAACAGACGATAATTCCAATTGCCAATTTTGTAG
TGTAATGGAAATTAAAATTCTATCCATTCCTCAAGTAGAAAAAGGGAATTTAGGACTGCC
ACAGTTGTTTTGTTCTCATACTACCTTGAGTTACCATTAGTGGGCCAGTTTCTGGAACTG
CCAAACCCTGATATGCCTCCATATACTCACAGGAAGTTGGGCCAGCTCAAAACTTCAGTA
GATTCAAGAAGGGTAAAGAAGCAGTCAGGCCCAGTGGAAAGACAGACCCGGGTTTTATTC
CAGGTTCTGTGACTTGGGGCAAGTTACTACTCTATACCTCAGTTACCTCACAGATAAAGG
CTTATGAGCCCTATGTGGGATAGGGACTGTGCCCGACCCGATTATTTTATATCTACTCCA
GTGCTTAGTAAAGTCCCTGGCACACAGAAGGTGCTTAACAAATAGCTTTAAAAAAGGGGG
GGAGGTAGGGATAAATTAATGGATAAATAGGTGACAGTGGGGAATTTGGGAATATAAAGA
GTTCATCCCCATAACCACCACTCACTCCTTTAAGTGTCCCAGGAATGTCTTTAGAGACAG
AGTCCTGGGCTGGTTGGATCTTTCATCTGGTACAGTAATGGCATTGCCCATGATTCATGT
TCTTCTACTCAGACGTACGCACTCCCACTCTACTGATGAAACCGCAGATTGATGAGTCCC
AACCAATCAGCAATTTAGGCAGTGAAGACTGCCAGAATCCCTTTAAAATCGTAAAACTAT
TCCATTGGCACTTGCCGATTTCTTGGTTCACGGTTTTTCCTTTTTGCAGTTGGGTGTCCC
TGTAGCATCCTCAGCATTGAGCCCCAACCGTCTGCTGTTCCTTTGGTTTCCCTGGCTAGC
TGGTCGCCTCCCTCTTCCCCCACAGAGCCTGGGCAGTCTTGAAACTCTCCAGGGTTTTAA
ATCCATTCGTGAATTCAGTCGTATTTATTGAGCACCTACTTTGTGCAGAGCACTGTATTA
AGCGCTTGGAAAGTGCAGTTGCAGCCGCCTCATCTGTGTGTGGGGGGGGCGGTTCTGGCC
AGTCTCTTGCAGATCCCGAGGGACTAGCGTACTTTGTTTCCTAGCTTCTTTCCCATTCCG
GAAACAAACAGATATCCCTACCTAGGCTTCGATTGTAATTGTTGGAAAGAGACGGCCGGT
GCGGTAGACGATTGAAAATGTTGCTCTCTTCTCAGCCAAAAGAATGCAACGGTGTCAAGA
TCCCAGTTGACACAAGTAAACCTAATCCAAATGAAGTGGAGTTTGATAATCTCTATTTGG
ATATGAATGGTATCATCCACCCATGCACACATCCTGAAGACAAGTGAGTAATCTGCAATA
TTATTGCCACGGTCCCCGGTTATGTTATTGGCACGATCTGCAGATTCATCAGCTTGCTTT
GCTCCACAGACCAGCCCCCAAAAATGAAGATGAAATGATGGTGGCAATTTTTGAGTATAT
CGACAGACTCTTCAACATAGTAAGACCTAGAAGACTTCTTTATATGGCTATAGATGGAGT
GGTAAGTGTTTACTACATTCACATTTAGTATACTCTGTTCCTCCTTGATTCATTTTGTTG
TATTTCTAACCTCCAGATTAAGCAGTTAATTTGATAATGTGATACTGACGTTGATGCATA
TAACAGTGAGAGAATCAAAGGGGAATATCTTGTTAGGATTTGAGTCTTTGATTTTGTTTT
TCTTTCCGGGGGAGATGGGGGTGTGTTTGGGTATATTCAGCACAAGACCAAGTAACTTGC
TCTCTGGGTTTAGTATCGATTAATTACGGTATTTATTTAGCTATTACTGTGTCCAGAGCA
CTGGACTGAGTGCTTGGGAAAGCACAGTTCCATGGAATTGGTAGATGTGATCCCTGCGTA
CCAGGAGCTTACAGTTGATAGTGGGAAGCAGGCGTTAGTATAAATCATAGATATGGGAAA
TAGTCGCCTATAAGGCCCAAGTACATAAGTGCTGGGGTAAGTTTCAAAGTATTCGAGGGG
TACAAAGCCAGCTGTATAGCTGGAATATTTGTTTTTATCCCCCACTTGAATGTTAGTCAC
CCTAAGAAAAGCACCTCAAAATCCCGTGACGTTGTAATCATGAGTGCTGCAAGTAGAATA
ATGTCATGCAATCTGTTGGTTTAGGCTCCGCGTGCTAAAATGAATCAGCAGCGTTCCAGA
AGGTTCAGAGCCTCAAAGGAAGGAGCCGAAGCTACAGTGGAAAAGCAGCGAGTAAGAGAA
GAGATCTTGGCCAAAGGTAGACTTCCCCGAAAGCTGGTCTGAATTGTTGGTGTTCATAGA
CAATTTGCCTCACTGCAGAATGGTTAAACAGTTTGGTTTTTAATGCAAGGACTGAGTAAG
TGTTGGTAGTGGCAATAATACTATAATATGATGATATGATGATGATGATGATGATAAAGA
AGCATAGTGGCCTAGTGGAAAGAGTGTGGGCCTGGGAGCCAGAGGACCTGGGTTTTAATC
CAGCCCTGCCATTTGTCTGCTGTGTGACCTTGGGCAAGATGTTTTTCTGTGTCATAGTTA
CCTCATCTGTAAAAGGGAATTTAAAACTGGGAGCCCCGTGTGGGACATGGATTGTATCCC
ACCTGATTATCTTTTATCTACCTCAGTGCTTCGTTTAGTGCCTGGCACATAGTAAGTGCA
ATACCATCATTATTATTAAAAAAATACAATTTTACATAAAAGTCCAAGTAATAAATGTGT
TCTGGGGGTAGAAGGTGACATCTCTGCATCACAAAGCAGAAGGCACAGCTAGCTGCTTGA
GAGTTTCATGAGTCTATACACGTCAATCTGTGACCTTGATATTCCTCTCACGGCATTTAT
ATAGATAGCTTTGAATTAGATATTGTAAATTACTTATTTGTTGACGTTAATGTCTGTCTC
CCCCTCTAGATTGTAAGGTTATTATGGGCAGGGAACGTGTCTGCTAATTCTGTGTATTGT
ACTCTCCCAAGTGCTTAGTACAGTGCTCGGCACATAGTAAGTGCTCAATAAATGCAGTTG
ATCACAAAGCCAGTTTTGAGCTAATGAATAGATTAGGCTTTGTTTGCCTGGGGAGTAGTA
GGATGGTAAGAGTATGGAGACTTCAGTGAACACATTTGTTTTTACCCACATGGCTTGGTG
TCATTTATTCTTTCGTTAGGAAACTGAGGCACAGGTAGGTTAGGTGTTTAGGTGAGAAAT
AGCTTGGTTTAGTGGAAAGAGCCCGGGCTTGGGAGTCAGAGGTCGTGGGTTCTAGTCCCA
GCTCCACCACTTGTCTGCTGCGTGACCTTGGGCAAGTCACTTCACTTCTCTGGGCCTCAG
TTACCTCATCTGTAAAAGTGGGGATTAAAAAATGTGAGCCCACATGGGACAGTCTGATTA
CCTTGTATCTACCCCAGCGCTTAGAACAGAGCTCAGCACATAGCAAGCGCTTAACAAATA
CCATAATTATTAGTATTATTAAGTGACGGGCCCTGAAGTCTAACAGCAGGTTAATGCAGT
GTCAAGATGCCTGGTTTCCAGCCCACTACTCCTTCCAACTAAACCATGCTCTCTCTAGAA
GTGAAATCTAGTAAGAATAAAAGGGTTTGAAGGACATATTTTAATTCTTTACTGCCTTTA
GCACATATGCTGAAACAGCATGAACTAAACATCTTACCGCTAAGCTTCTTTGGGAAGTAG
GAGAGAGGATGCACTTATGCACAGAATTCATGCTTCAGCTTTTGTGTTTTTCTGGCTTCT
GCCGCTCCACTCTTGCAAAGCTAGCTGCCAGAAGATGAGAGCTGCTTGTACCAGGAGTGC
AGGCCCTTAGTGTTTTGTTTTATTTTTTTTTTTAAAAGATATTGGTTAAGCACTTCGTAT
GTGTCAAACACTGACCTAAGCGCTGCGGTAGGTGATAGATATCCACACGCACTCATCCAT
TTTCGATTTATAGGACTTGTAGTGTCCCAAGTGGCTTGTTTCTCAGGCTTAACTCCAATT
TTTGTATAGCAGTTTGCCCTTCTCACTGCAACTTGGCCATTGAGGTTGTAAGGGTCAAGG
TCCAGGAAACAGCAGGTATTATCTGGCCCATGCCAGGGTCAGAACACTGTTTGCGTGTGA
AAAGCTACCTACATGCACTGTGGTAGTGAACTGTTGGAAAAATACTTTAAAGGACCAGCA
GTGTGAAAATCTTGCTCCTCTAGGCTGCCTCTTTGGCCAGACGTGTTATTTCTAACATTT
CAGGTAGTCATCCCTGTGCACCCCCTACCCTCAGGTAGTCCCGATGCCTGGTGCTCAACT
TCCAGAAATCATCTAAATGGGGGCTTTTTGGTTGTTTTCTTTTTAATGGCATTTGTTAAG
TGCTTGTTATGTGCCGGGTGCTGTACTAAGCGCTGGGATAGATACAAGCTAATCAGGTTG
GGCACAGTCCCTAGCTCCATTTTACAGATGAGGTAACTGAGGCAGAGAGACGTTAAGTGA
CTTGACCAGGGTCACCCCGCAGACAAGTGTTGGAGCTGGGATTAGAACCCAGGTTCCAAG
GACAAGTAAGCAGAGTGTCATGAAGACCATGCTGATGTTCACAAAACACCTAAGAGGCAG
TATAGTCAAATCGTGTTACACTCTCGTTAATGTATAGTAGCCCTGCCATGTTTTTGAAAA
GGTAAGATATATATCCTAGGATGAACTGCTTTTGCTTTCCTGGAAGTTAGTTCGATCAAT
TTGATCTTCAGCGGGGAATTTCTGTCATCATTCTAATGTCCTACCGTATTTTTATGGGGG
AAAATTATTGGCTGTCCTTGCAGGTGGATATCTTCCTCCAGAAGAAGTGAAAGAAAGATT
TGACAGCAACTGTATTACACCAGTAAGTAGTTTTGTACTCTGCTGGCTATTGGTAACACT
TAAATGGCAGGTTAATTTATTTTTCTTCTATCATTTTAGGGAACAGAGTTCATGGACAAT
CTTGCTAAATGCCTTCGCTATTACATTGCTGATCGTTTAAATAATGAACCAGGTTGGAAA
AATTTGACGGTAAGTTTCACATTTGGGTGCTTCAAGAAGATTAGGGTCTCCTGTGCTGTG
ACTGGGCAGTGTACGTATTTTTTCCATAATAATAGATTAGTGTCAGACAAAAAGAAAAGA
TCATGGCGTTATTGAAAATGGGGTGCATTGCGTGGCTTAAATCTCTGTTTTACTTTGAAG
AGGTAGATTTTCTTCTATCACCCAAAAGGAGCTGCGTTTTTTAAACATCTGGGTGTTAAG
TGAATGATTTTAAGGAAGTAGCCAAAGGTGAAATTGGGAGTGCTTTCAAAAATGCTTAAA
ATTCTGATTAATTTTAATTAACATTCAGAATTACTCAGAAATTATTTGGGGTCTTTAATA
CTGGCTTATAAATAAGTAGGCTTTCTCCACCCAGAAGCCTAAAAACTTGGCCGGGTGGTG
GTAACCTAGTGAAGTTTTACATTAATTAGTTGTCCGCATATAAATACTGTGGACTTACAC
TGGCTCTACACTTTGGTAGGTCTGTCTTGCAGAGTATCATTATTGAATAAATACACGGTG
TTGAAGAGCATGAAGTGATGTGTCCCCAGCCTGGAACTCTTCTCCCTCTTTCCTGCCTCT
CTCCTATTCCCCAAGGAAAAAAACCCCCCACCAAACAGCTTACTTCAAAGCCCCTGTAAA
AGCCCACTTCCCCTAGGAGATCTTCCCTGATTAATTCACAACACGCCGGTCATGTCAACC
CACCAACCCCATCCATAGCACTTAGTCATTCCTAGTCTCAGGGCTTATGAATGTAGGCAT
ATGTTCCATATATACACAGTTTTTCCAGCAACTGCATTCTGATACATTTATTCTTCTTGC
TCTCACTATTTGTAAATAATACTTATCTGCCCACTGCACCTAGAGGGAACGGATTGCAAG
CTTCTAGAGGGCAAGGCTGGTGTCTGCCTATTCTGTTGTACTCAGTTCACAGTAAGCACT
CAATAACTAATCAAATAAATAAGCAAATAAATAAAAAGCGATTTATTGACTGATTAAAAG
TGATCATCTTCCTTCTGTTCCACAATTTTTATTACAGTACTTCACAATCAGTAGGCCCTC
AATACCATTGTTGATATCAGTGATGCAATTGACAATATTATTTATAAGATGGACAAATTA
ATTTTGTGTGATTGGAACAGTAATCAGGTGTCATCTTAGGTTAAGCACACTGGAGCAGCC
TGAATATGGAAGGCAGTGATCCTTTTCACGCGCTGAGAATAAGTGTTTCGGTTGACGGCA
GCAGTTTCTGTTCTTACCTCTCCTGCTGCCTTGTTTCTTGCTGGACTCTTGGAGAGGCAA
GAGCTCTGAGAGCCCGACAAGAAACAAAGCAGCCGAAGGAAAGAATCTAAAAACCGCAGC
CACCAATGCTGTGGCTGCTGTAGCTTCCTGGAATTCTTCTCTCTGCAAAGGAGCCCAGCC
AAAAAAGAGAAAGATACGTAACTGCTTTAGGAAGAGCAGAGAAGGATATAATCAATGGAG
TTCACTCTCCTTGGCGGCCATATGCTGCCTCTGGCTTTTGGCTTTGGCAGTTGTGGTCTT
ATTAGCTGAAGTGTCTTCTTACCTGCGCTTGGCAGCTTCTGCTGCTGCTCATGCCAAGGT
CGTGAATATCTGTCTCCGTCTCTCCAGCCCCTCATGTAACGAGGACACAACTCCGCTAGG
TTACCTCGTTTCTGACAGTTTCAAAGAATGGTCAAGGTCGTCTCTGTTAACAGGAAGAGA
AAACAGGCGTTACTTTACATTATAAATATACTGTTTTATTTGACAGGTTATTCTATCTGA
TGCTAGTGCTCCTGGTGAAGGAGAACACAAAATCATGGATTATATCAGACGGCAAAGAGG
TAAATTCAACCATTTGATTAATATTAACACTTCCCATCAAAAGAGAATCTGAATGCCTGA
ATGCATATGGTTTATTTGTTTTTTTTTCCATTTTGTTTAGCTCAACCTAATCACGATCCA
AACACTCATCACTGTTTATGTGGAGCAGATGGTGAGTCTTTTTATTAAGAATATATTTAT
TTCTGATGTTTTAGGTAATTTTTTTTTTCAAGTAGGCATGAAATTTTAATTGTCTTTGTC
TTTAACAGTGAATAACATTTTAAGTAGTACTCTGTTTTCTGAAGAGAGTACAGAACAGAG
ATTTTATTTCGAGTTTACCATTTATCTGTCCTTCTAAATGTTTTTCGATAGATGCACCTT
CAGGCCATGTTACTAAAACTAATGCTCTTTCCTCTTGAAAAACTCTCAGTTCAGATTTAA
GCCTGGCAGACTTCTTTCACCCTATTACACTGCCCCTTTTCAAGAACTCCTTGTAAAAAT
CTATGGTTCCTTGTTTACTGACAGTGGTGCACATATAGATTCTGCAAAATATCTTCACTG
TCTACTAAATTAAAATTTTCATTACTCAAGAGTCACTGATAGTATAAAAGTATTAACACC
CTATAATTTGCCGTTCATGCCATTGAAATGTAGACACAACCTTTAATCCTCCCATTATGA
CTTTTTCTAATTCATAGCTGATCTCATTATGCTGGGACTTGCCACACACGAACCAAACTT
TACTATCATTAGAGAAGAATTCAAACCCAACAAGCCAAAACCTTGTGGTCTGTGCAACCA
GCTGGGACATGAGGTCAAGGACTGTCAAGGATTGGCAAGAGAAAAACAAGGAGAGGTAAT
TTCATTGTGAATCGCGGTTTTATTATTTTGTACTTGCGAGCAGGAGGGTTTTATTGGACT
GTTTTGAAGAAGAAGCACGTTTCTCATGCAGGCAAAATCAGTTCTAGTCCAGTGGTATAT
ATTGAAAGCTTCCTATGTGCAGAGCACCTTACTAAGCACTTGGGACAGTGCTTCAATCCA
ACAGAGTTGGCCGACACATTCCCTGCCCACGGGTGATCATTGACTTACCCCGTAACGAGT
TTAAGGATCCCATCTCATAACCAGTAGCTGTGGCAGAGTGGTAGAATTGGCCACAGAGAC
AGCGTAGAAGAAGGAGAGACACTGAGAGATGGGAGCCGAGAGTGATCAGCAACTCTTGAC
AACCAACCAAACAACATCCCGGCTCTATTAAAAATCCCCTTGATCCCCTAGGGTTCTTCC
GAAACCCATGTTGAATTGCTACAGCCAACTTTCATGCTCATCACGTTAAACTCAGATAAA
GCCTGATCCTCAAATTATCCGTCGATTTGTAGGAGCTGTTAGTCTAGGTTTAAGATGGCC
CTGAAGTGAGTCCATTTTCTTGCCCAATTCCTTTGCAGTTTGATGAACTTGCTGATAGCC
TTCCTTGCTCTGAAGGGGAATTTATCTACCTTCGGCTAAATGTCCTCCGTGAGGTATGTA
AGAGGAAAATGAACCAATTTAAATAATGTGCTTTTTAATAGGATTTACTAACTTATAGTA
TGTTTTGCTGACCCTGGATTTTTGTTGCAGTATTTGGAAAAAGAATTAACTATGGCTAGC
CTACCATTTCCTTTTGATATTGAGAGAAGCATTGACGATTGGGTCTTCATGTGTTTCTTT
GTGGGGAATGATTTCCTTCCTCATTTACCATCCTTAGAGATCAGGTACGTATAGCTCCTT
TGTGTTACACAGGTAACTTTTCAGCATCGAAAAAAATCATATTGAGTACCTACCATGTCT
CCCTTGCTCTTAGGGAAGGAGCAATTGACCGTCTCGTTAACATCTACAAAAGTGTGGTGC
ATAAAACGGGGGTAAGTTCAAATTTAAATGGTTTTAGCATAGTGTTTTTGGTGTGATTCT
GAGAAGAGAATTCACATGTGTGTTTATCGTTTACAGGGTTACCTCACAGAGAGTGGTTAT
GTCAATCTACAGAGAGTACAGATGATCATGCTGGCTGTTGGCGAAGTAGAGGATAGCATT
TTTAAAAAGAGGAAGGATGATGAGGTAAATTGTTTCTATTGCGGTAGCTAAAATGGCTCA
TGTATTTAATAGAATGTAATTATCCCATGATCATACTTTTAACCTCTGAGTGCATTATTG
TGCTGCCTTAATTCATCAGACACTAGTGTAATAGAGAGAGCAATCGGTGCAGTGACACTT
TATAAAGGTCATGATATTCCTATTTGTGCATATGGCCAACTATGCTTAAGAGATGCCCCT
TTATTTTCCCCTTTCTTTTGTTTTGTTAACTGAAGGGGCGAGGAGGAGAGGGGAGAGCCA
GTTGAAGCACCTAGCTCTTTCAAGGGTGTGGGAGAAAGGCCGTCGGGGCCAGGGAGCTGC
TGAGAGAAAGGCCGAGGACTGTGGCTCAACTCTTAGGGGAAGCCCAGAATACATAGGGCA
TTGGGCAGGATTGACAGACTGGGGGCCATGGTGGTGATTTGGATGGAGATGAGATAGAGA
ATGGGCAATGAAGCCACTAAATTCCCCCCTACCCCATTGCCCCGATCCACTCCCTTTGCT
CTACCCCCCTGCCCCACAGCGCTTGTATATATATGTACATATTGATAATTATAATTTTAT
TTTTATTACTGATGTGTATATGTCTATAATTCTATTTGTAATGATGCTGTTGATGCCTGT
TCACTCGTTTTGATGTTTGTCTGCCCCATTCTATACTGTGAGCCCATTGTGGGCAGGGAT
TATCTCTATTTGTTGCTGAATCGTACTTCCCAAGCGTGTAGTACAGCGCTCTGCACGCGG
TAAGCGCTCAATAAATACAATTGAATGAATGAATGAGAGATCCCAGGAGGGAGTCGAATG
CAGGCCTGGATCAGGGGACTAAAAATTACAGTCCTTTAGCCCCTGAGGCTCATGCTGGGC
AGGGAAGGTAATACCAACTCTTGTTGTGCTGTACTTTCCCAAGCACTTAGTTACAGCGCT
CTGCACACAGTAAGCACTCAGTAAATACCATCGGTTGATTGGTTGAAAAGGTGGCAGTGC
CAGGGGTCAGCAGAAGCAGCAGCAGTTGGTACAGGGACGGCAAGTTAAGTCCTGAGGTGT
AGCCATTGCAAAAAGACGGGACTCTATTGCTGGTTTTAGGATTGTAGAGAACCCTACCAC
TGGCTCCATTTCAAACATTTTGCTCCCTGTAAATATCATCATCATCATACTGTTTACTAT
GTTTCAGGCGATGTTCTAAGCACTGGAGTAGATAAAGCGTTTCCTACAGAAACACTCTGA
GCGTGTCACTCCCCTCCTCAAAAACCTCCAGTGGTTGCCTAACAACCTTCGCATGAAACA
AAACTCCTCACTCTTGGGCTTCAAAGCTTCTCCATCACCTTGCCCCTTTCTACTCAACAT
CCCATCTCTCCATTCTACTGGCCCNNNNNNNNNNTTTCCCTAACAGAAAACACTCTGAAG
TCGTGTCACTCCCCTCCATCAAAAACCTCCAGTGGTGCCTAACACCTTCGCATGAAACAA
AACTCCTCACTCTAGGCTTCAAAGCTCTCCATCACCTTGCCCCTTCCTACCTCACCTCCC
TTCTCTCCTTCTACTGCCCACCCCGTACACTCCGCTCCTCTGCCGCTCACCTTCTCACTG
GGCCTCGTTCTCGCCTGTCCCCCCGTTGACCCCTGGCCCACGTCCTCCCGCTGTCCTGGA
ACGCCCTCCCTCCTCATGTCCGCCAAACTAACTCTCTTCCCCTCTCAAAGTCCTACTGAG
AGCTCATCTCCTCCGGGAGGCCTTCCCAGACTGAGTCCCCCCTTTCCCTCTGCTCCCCCT
CTTCTGCCCTCCCCCCCGCCCTCTGCTCTTCCCCCTTCCCCTCAGCACTGTGCTCATTTG
TATATATTAATTACCCTATTTATTTTGTTAATGAGGTGTACATCTCCTTGATTCTCTTCA
TCCTGATGATGTTGTCTGGTTTTGTTTTGTTCTGTTTTGTTCTGCTGTCTGTCTCCCCCG
TTTAGGCTGTGAGCCTATCATTGGGCAGGGATTGTCTCTACCTGTTGCCGAATTGTACAT
TCCACGTGCTTAGTACAGTGCTCTGCACATAGTAAGCACTCAATAAATGCTATTGAATGA
ATGAATGAATACAAGTTAATCAGGATGGACACCGTCACCGTCTAAGTTGAGCTCAGTCTA
TATTGGAGGAAGGAGGATTTAATCCCCATTTTACAGATTAAATAACTGAGACACAAAGAA
GTTAAGTGACTTGCCCAGGATCTCGCAGCAAGCAATTGGCAGGCGCAGAGTTAGAACCCA
AGTCCTCAGACTCTGTCCCGGGCTCTTCTAACTAGATCATGTATTACAGTACATAATAAT
AGCACAAATTTTACTACTCCTCTGAACATGGGGGTTTCAATCTTGGAGAAGCAGTGTGAC
CTTGTGAAGAGATCAAAAATCTATCTGGTGGTGTTTTTTCACTTCTGTTAAAATCCTGGC
TGCTGAAGTCTTGCTGAATTCCAGCAGGTAGCAACTTGTTCATAAAGCCTCTAGAAAACT
CAGGTAGTGATGGACAAGATTCAGTGCATATATTTTGAAGAGGTCATCGATGATTAGTAA
AAGGTCTGACTGCACTAAAAGCCCGTCATTGAGCAGGGATTGTCTCTATCTTTTGCCGAA
TTGTACATTCCAAGCCCTTAGTATGGTGCTTTGCACATAGTAAGCGCTCAGTAAATACTA
TTGAATGAAATCACAGTCCCTTTATTGCTCTTATAACTCCCAGCAGCTCCTCCGTTGCCC
ATTAGGCTCAGGTTGTTTGGTAATTGGGTGCTGGGGCTGCTCATAGCTTGTGATGCACTC
AGGCTGGGATATCCAAAGAGGAATGGAGAGACAACCGCCCCTTGAGCATCCAACAAAATT
AATCACAAAGGAGGTATTAATGGGGCCGTGAGGACTGTGGTCGTACATGATTCTAAGTTT
TCAAGCTGAGATCTCTTGGGGACTTAAGACAGTAATCATGGAGTGAAAAAGCATATTGAA
CAACTACTCTGAATGACCACATTCCTTAGAAGTAGAAAATATGCCACGCTCATCAACCCG
CTTCCCTAAGAAAACAGTTTTGCCATATAGTGGTTATGAAATGGATTTTCTTTTTGCTCT
GGTATTGTAGTGTCCTATGTGTATACTTACATATATATCCTTAATTTATGTATATTAATG
TGTCTCCCCCTGTAAACTCGTTGTGGGCTGGGAACATATCTGCCAACTCTGTTATATTGT
TATAGCGTACTCTCCCAAGCACTTAATACAGTGCTCTGCACACATTAAGTGCTCAATAAA
TATGACTGACTGGTTAGAATTTAATAGGCACTGGAAATATATTTGGCATTTAAAAGAGGT
GGGTTTTCAACCAAAGACTGCATCGTAAAATCTCAAAAGCTTCATCAGAAATGCCTCCTC
TCAATCAGTGGTATTTATTGAGTGCTTACTATGTGCAAAGCTCGGAACTAAGCGCTTGGG
AGAGTATCATACAAAAAAATTAGCAGACACTTTTCCTGCCTGTAATGTCTGTCCCCTGAA
CTTTCCAATCACTCCTCCCATTTTCTCTTCCTTTCCCATCCTTCTCAAACCCATGCACAT
ATGAGTAGCTACAAACAAAACTTGGCCAAAGCAATCACTTTTTTGTGACTTAAAACGGAA
TTCTTATTTCTACCATAGTGGCTATCCCCCATTACAGTGTTTTGAAGTACCCTTTGGAGT
TTGCGATCAGTTTGGAGAAAATGGTTAAATCAATAATTAGATTTGATAATAATTGTGGTA
TTCCTTAAGTGCTTGCTACGTGCTAAGCATTATACTAGATACGGAGGTAGATAGAAGATC
ACCAGGGTACACACATTCCTTCGTGAGGTCCACAGACTAAGTAGAAGTTAAGACAAGTAT
GAATCCCCTTTTTTCGGATGAGGAAACTGATGCCCCGATTTTGCTGAGCTGTTCTCCTTG
TATGCAGATGATTTTAGTGACATGGATTTTTTTGTTTCTTTTAATTTTAAATTAATAGAG
GCAAGAGGGGGTGGGAGAGACTTTTTTTTAAGAAAAAATGCAAATGCTTTCCATTATGTG
ATAGTTCTGGGCAGGTAATACAGAAAAGAGATCGGGATATTGCCCAAAGGTAATCATCAT
AAATAATATTTGTTCTTTTGCTTATATTCATTTGCTTGTGTTCTGTGGATTTTTTTTTTT
TGTTTATATATCTAGATTTGGTCTTCCTTAGTAGTTTTGTAAGCCTCGAGGAGAGGGTCT
GTCTCGTACTTTGATTCACTCCGGATTTGCATACAGTGGGTGCTCAAATTATGTTGCCTG
ACAGACTGTGAACCTGTTGTTGGATAGGGATTATCTCTATTTGTTGCTGAATTGTGCTTT
CCAAGCACTCTGTACAGTGCTCTGCCCACAGTAAGTGCTCAGTAAATATGATTGAATGAA
GGGATTGCTTACCGTCATTAGCGTAGGAGCAGCGTGGCTCAGTGGAAAGAGCACGGGCTT
GGGAGTCAGACATCACGGGTTCGAATCCTGGCTCTGCCACTTGTCAGCTGTGTGACTGTG
GGCAAGTCACTTAACTTCTCTGTGCCTCAGTTACCTTATCTGTAAAATGGGAATTAAGAC
TGTGAGCCCCACGTGGGACAACCTGATTCCCCTGTGTCTACCTCAGCACTTAGAACAGTG
CTCTGCACATAGTAAGTGCTTAACAAATACCAACATTATTATTATTATTATCGCTTGGAA
GCATAGAGCAAAAGCAGAAGACACAATCCCTTCCCTTGAGGAAGACCAAGCAGGGGAAAG
GCGAGAACACAGATGCGATTTACAAGCAGACGCTTGGTTTGTATCCACTCTAAGGGGACT
ACTAAAGTATGAATTGCCTGAGCAATTATTGGAAGCCTTATTTTATTACCTATTTTCCCT
TTTTCCCCAGGAAAACTTCAAAAGACGACAGAAAGAAAAAAGAAAAAGAATGAAAGTAAG
TTTTAATGGATTCCTCGGTCATTCCACGCTTTTGTCTTGGGGATCAGCAGAAGACCAAAT
GTGAGAGTCAAAGATGACAGAGCCGGGACGGGGATAATGGTGGTATTATGGAAAGAGATA
GGAAAGTGCAAGGGAGGAGTGGGTTTAGGGAGAAAAAATGAGGAAACTCATTTTTTTGTG
ATACCCAAGAACAGTTTTAATGCTGTGTGATGCCTTTTCTTAGTCTAGTTGTTGGTACTT
GAAAATATATCAGCGACTTCCCAAGAATATGCAGTTCACATCAGGTCCAGCATTTTAATT
GACATGCCACTGGATTAGCTTGCCATTTTCTGAGGGGAATGATGGAAGACCTTGGTGGTG
GCAGAAGCTGCATATTCAGGGAGGAAGGGGCACAATCCCACGGAAGATGAGTTGCAACAG
GGATCCTATTATATGTTCATCTAGGCCAGATCCAGGGGAAGTAAATGATGCTAAAGTTAA
TCGAAGTGGAATTACTCCCCTTCACTCTCCCAGACAAGTCTGGGTTAGTTTAGCTCCTTT
TGTAAATCGTTCATTAGCATTTATAGTAGCAGTGCTTATGAATAAAGTTGGGCTCTTCAG
CCAGTAGAGCCAAGTAAGTCATTTTGGGTTACCAGAGATTGGCTCAGGAGAGATCTATTG
TCATAAAGACGGTTCCTGGCGTACGGCCGCTTTCTTTTTGCATTACTGCTGCACGTGGAT
TTTTTTTCAGCGTGCGCATGTTCCTCTAGCCTTGAAAGCAAACACGAAATCGCAGAATAC
TTTCTGACTTTCAGTTTTCTCTTACAGATGTCCTTAACTAGCAAATCCAGGCATAAATTG
TAATCTAAAGTTGTAATTTGTTTTTGACAAAAAATAAGAATTTCCTCACCTTCCACCCTG
GCTTTGATATTTGTTTTTTTCTGATTAAGAGTTGGTGTTTTGGTTATCCAGAAATGGTCC
TTCATTTATTTTGAAATTGAAGATAAATCTGGGGAATTTATTTAAATAAGCCAAGACAGT
ATTATTTCAATTTCAGCATGTTTTAGAGTTGGTCTTTTTTTCCTCTAGCCGTGTTTGCTT
GCCCATCTCGATTTCTCTAACTCTGTATTTTCAATGATGCTAGAGGGATCATCCAGCTTT
TACTCCTGGAGGAATATTAACCCCTCAACCCCTGGGTGCAAAAAATTCGTCTGGTTCTCA
AGTAGCCAGTAATCCGAGGCAAGCGGCCTACGAAATGAGAATGCAAAATAATTCCGTAAG
TGGCATATTATTTTCCGTATTGGTCTGTCGTTAATGTGTGTCTAATTGGTAATGTTCAAG
TAAAATACAACTGGTCACACCATCGTGTGTAGAAACACTATGTACTTATTCATTTTTATT
TATTGACTGCTTTCTGTGTGCAGAGCCCTGTACTAAGCGCTTGGGAGAGTACAAAACAGC
ATGGCCTAGTGGAAGGAGCACAGGCCTGGGAGTCAGAGATACCTGGGTTCTGATACTGGC
TCTGCCATTTATATGCTGTGTGAGCTTGGGCAGGTCACTTAACGTCTGTGCCACAGTTAC
CTCATCTGTAAAATGGGACTTAAGACTGTGAGCCCTGTGTGGGAAAGGGACTGAGTCCAG
CCTGAATTTCTCATATCTACCCCAGCGCTTAGTATAGTTCTTGGCACATAGTAAGCATTT
AAGAAATACCATATCGTGGGGAAAAAAGGATCTGACAGTCTAGGGGGGAGACATGAAAAT
AAGTTACAGTTATGTACATAAGTGCCATGGGGCTGGGAGCATGATTATCACATGCTTAAA
AGGTACAGCTGTAAGTGAATAAGTAGAACAGAAGGGAGAGAGAGAAGCAGAAATGAGGCC
TTGATCGGGGAAGGCCTCTTGGAGGAGATGTGCTTTTAATAAGGCCTTGAAGGTGAGGTG
GTTTCTATAAAGGAGGAGAGAGTTCCAGACAGGATGTGGACAGGGGGTCGGCAGTGAGAA
AGACAAGATCCACGTAAAATGAGTAGGTTGGTGTTGGAGGGGGCGAAGTGTTGTGGCTGG
GTGTGTAGGAGATCGGCGAGGAAAGGTAGGAAGGGGCGAGCTGACTGAGGGCTTTAAAAC
TGAGGGCAAAGAGTTGGTTTGACATGGAGGTGGATGGACAACCACTAGAGGTTCTTGAAT
GGAGCGATGTGGACCGAATGCTTTTTTTAGAAAAATGATTCAGGCAGCAAAGCGAAGTAA
GGACTAGATGGGGAGAGACAGAGATAGAGAGATGGGTCAGAGGGCTGATGGAGGCAGAGT
GCTATGGGTGACTGATGAGATGTCATGACCCTCTGGAGAGGTGGGGATTTGTTGAAGAAA
TCCAACTAATGGAGGAGGAGGGAGGTGTTCATGGTATAAACCTGACTGAAAACTTCCCTG
ACCGCCATAATTGACTCATTGACTACCCCATCTAGACTGCTTGTTCTTGGGTCCAGTGTC
CTTGGGGGAGTTGGAAGGAAGAGAGGAATATGGTTTGGCATTTTTGGTGGGGAGGAATTT
TCATTTGCAATGGGGTNNNNNNNNNNGGGGGGTGGACAGAGAATAATAATAATAATGTTG
GTATTTGTTAAGCGCTTACTATGTGCAGAGCACTGTTCTAAGCGCTGGGGTAGACACAGG
GGAATCAGGTTGTCCTACGTGGGGCTCACAGTCTTCATCCCCATTTTACAGATGAGGTAA
CTGAGGCACAGAGAAGTTAAGTGACTTGCCCAGAGTCACACAGCTGACAGAGCTGGGATT
CGAACCCATGACCTCTGACTCCAAAGCCCATGCTCTTTCCACTGAGCCACGCTGCTTCTC
AAGAACAAACACACACATATGATAGTCTTACGCTCAGTTAACTTTTTCAAATTGTAGGAA
CTGGGTAGATGTAAAAGTAGGAACTAGATTGTAGGGGAGAGTGCTAATAGAGTTGCATTT
GTTTTTAGAAAATCAACCTGACCTTCCAAAGAGTCAAAATGTTTCATTTAAATAACTGAA
GTTAATTGCATCTCCTTGCACATGTCTCCTGTTTCTCTTTCCTAAAAGCCCTTTTGAATC
CTCTGTCATTCTTTAACACTGTCATCTACCCCAAATAACCTCTCCCTTTCCTCCTTTCCG
TTGCAAGTTTTAGTTCTTAGCATGGCTGGTCTACATAGCTTTTGAAGTTTGTTTTGAGCT
TCCAGCAGTTTGTTTTAGCAATGTCCTAGTCCTTCTTACCTTTCAGGAATGAAAAGCCGT
AAGTGGAGGGCCAGCCTCCAAAGTGAGGCCCTCCAAACCACCAACAGTTTGGACCTGCCT
GTCTTTTAATAACTGTGCTTATTTACATCACTTGTGAGTGGAAAATGTAATTAAAAAAAA
ATTAGGATCCAGATTTCCCTAATGTTTATCATAACCTGTGAATGTTGACAGCATAATTAG
AAATTTCCCACAAGGTCCCATCAGGGAAATCCAATTCAAAAAACATGCAATTCAGTATCA
CCCTAATATTGATTATTAAATATATTGTTTTCTTTCACTTCTCTCTGAGATCTCTGATTT
TCAAGGTTCTCTATCAATTCAGTGGTATTAAGAGCTTTGTGCAGAGAGAACACTGTGTAA
GGTCTTGGGGGAGTACAGAACAGTTGATAGATAAGATTCCTGCTCTCAAGACCCTTATAG
TCTAATAGTTCGCTGTCTGGTTCATTTATAGATTATCACACACTCACCAAGCTTTTCTTA
TATAGTCCTAGTTCATTTTGGGCTTTGAGATATCACTGTGCCGGGGAGGGAAGGGGTGGT
TATTATTTGTTTTTGTGGGTTTGTTTTTTGTTGATTTTTTTTTTCATTTGGAAGACTTGG
GGTTGTTTATTTTTTTGCCACCTTAGTATTTTGAATTTATAGTTTGGATTTCTTTTTTGC
CCTCTCAGAGGTTGTTCTACAAGATTCTGTTGTTTGGTTCTTACATGGATTTTTCTAGTT
TTTTTCAGTGTTGAAAAATAAGTGTGTACTTTTAAAAATTATCAGATGCCACTTCTGATC
CATTTTCTTAGAAACAAATGAAGCTGTATTTTTTTCCTGGGTGTAGTGTAAGAAAGAATC
GTATAGTAGATTGAGTTTGTCATTGGAGACATCTTGGATTTCAGGTTACATATCGACCTA
ACTTTATATTAAACTTCAGCCTATCTAATTTTATTCTAATAGAGAAATTTCATTCAAATG
ATCCTATTGTGTTTTTGTAAAAAGCTCTTGCAACTGTAAAGACTAGAAGAAAATAATTTT
AACCTTCACAAATTCAACACAGACAATATTGGTTAATAGGGGAAACTCCCTGAAAACAAG
TAAACTATTCAAAGCATTTTGGTGTCTCAGGTTTGTTCCAAAACATGTTATTCTCTTACT
TCAGGAACTCTTTAGGTTTAGCATTTAAAGGGAAAGAAGTTCAGTCAGGGTAACATTTGT
GGTTTGTGTTCTTCGTGCAAGTGAATCATATTAACTTTTGAAATGGTTCTTTAAGAGAAA
ATACTGTTTTGTTTGCTTGTTGGACAACCTGAGCTTCCTCTGTAATGAGAGCTGTAATAT
TGCAAGTGATGTAAACCATATTGAAAATCAGTAATCAAACCCTTTTCTTCTGTTGTGCCA
TAATTTTGTCCCCAGAGTCCTTCAGCATCTCCCAATACTAGTTTCACTTCTGATGGGTCC
CCGTCTCCAGCCGGAGGAATTAAGCGGAAAGTAGAAGATAGTGACAGTGAACCCGAGCCA
GAGGATAATGTCAGGTGAAGCCATTTTTTGTAGCACTTTGTTAGCAAATTGCTGAAATAG
ATGCAGTCTAATTAATGCCATTTAGCTTAGAGCATCAGTGCCTTCAGATGCGTTTCTGTG
ATCTTTTTATCCACCAGTAATTAATGTGGAGGGTTAGAATATTCAGTAAATTCCAGTGAG
ATGTGTAAGCTATAGCTGTTAAATCTAAGTATCTAGATTAGTATGCGTGCTGGTTTCTGT
CCTCCAAGCCACTTCTCCCTTTGAGACCAGGCACTAGATTGGCTAGACATTCAGTGTTTA
GCTTTGATTATGTGATCTGAATGTTACTGTTTTGAGATGGAATTTTTAAGCTGTTTAACC
CATAAAGTTCAGTTATGCTGGGACACACGGTATAGTTTATTTTGATTTCATAAATAGCAA
AGCTTCTCTGCCCAGGGCAAGGAAAAAGTACATTACTTTAAGGAAGAAGACTTTTCCCTC
TAGGTATGGTCATATTAGGATGAACTAGCCGAGAGCCACACGTTCATCAAAATAATTTTT
CCTATGTTGGGCCTGCTGCCATGCCTTGGCTGGCTTCCTTCTGGCCCCTTCAGCTCCCCG
GACGTGGTCTATTCCACTCTACGCCCCAGACTCTCATCACTTCGGACCTCCCTGAACTGG
CCATGCTCCCCAAATCGGCCCTATAGCAACTGACTTGGCACCCGTTTTAATCCTTTTTTT
TCCCCCCTTCCGTGCTTTGTGGCTCATATTTCACCGGTACGCACAGTTCCCTGGAGAGAG
ATGATGTGGCAGGGAGAGCACAGGGTACTAGTGTACCTAATTTCTGTCCATCCACGACTA
CTCCATCCTTTATTTTGATTGTTCGATAAACTCGATTCGAGTTTGGAGGTAGGTTAATGA
TTCGGTGAGATTACCACTCCCTCTTCCACGTGTGGTCCAAACAAGACTTGAATCTTGCGC
TCCAAATGAGAACAGTTAGTGAGTTTTCTTAGGAAATCTAGAAAATGACAAATTTTCATT
TCATACTTCAATCAGTGTTATTTTTTAAATGGAGAAACTGACCACAGTGGGTGTTTTTGT
TTTGTTTTTAGCATGCAAATTGTTGACCCTGCCTTTGCTTTGTAAATATAGCCAGGGTCA
GTTGTTAGCTTTTTTTGTTGTTTAAGATTTGGAGGCCTCCCCATGAATTTTAGCCCCTGT
TTATTAAAATTGAAATTGGCTTCAAGCTTTTTGGTAAGTTAAGAGTTTCCCATGATGCTC
TCTGGGGCATTTCCCTCATAATATTTGGTGCTTGGGGGAGGCTTAAATTCAGTTCAGAAG
AATGGATGGTACAGAGGCAGTAGTAAATAATAACTTGTGTGATTACCAGGACAGATGGAT
TCTAAATAGAAGTTAGGCAGTTTAAGTAGTGATGAATTGCAAGACATCAGAGATTTTTAG
TGAAAAGTATTAGAATATCCCTAAAAGTACCGCAAAAGAACCTTTGACTTCAGCTATTTT
TGGTGAAACTAAGTCTTGCAGAGGGCTTTGTGTTACTATTTTACATTACACTCTGCCTGT
TACTCTAATTTTCATTTTCAAAAGATTTTTCAAATCAAAGGTTAACCCTTGTCAAAAGGT
TTAAGATGCCGGAATGTGTTAATTGTTTGCATGTTTAGCAGTAGTAATAGCTCTGCCACC
TTCTACTGTGTGACCTTGGGCAAGGCACTTTACTTCTCTGTGGCTCAGTTCTCTCATATG
TAAAATGGGGATTAAGACTCTGATCATCCTGTATTTACCCCAGCGCTTAGTACAGTGCCT
GGCATATAGTAAGCACTTAGATGCCATCATTCACTTACAGTGGCAGAGCCCCGTATTAAG
TGGAGGGAGAGACTACAAAGGTGAGAATTAGACAGGGTCCCTGTTCCTCAGGGTCTCCAT
AACTGTCTGGAAGGAATGGACCAGATTTATTGAAATAAAGGCAAAGATTTCTGGGTTTCA
TTATTTCTTTTAGGTCAGTTTAGCCAATATGAGAGCCAACTTGAGTTTTTTAAAATAAGT
CATTGAGCATAGTATCACATAGCTCCATGAATGTAAAAATAATGGTCTTTGTTTTCTTAA
TCTGTGCATTCAGCATTAATTGTTTAGCTTAGTTGCAGAATACTTTAATAAGAGCATTTT
CCATTAACGCAGATACGTGAATTAAGCATAAACTGACTGTGCTTGATAAATAGGTTATGG
GAAGCTGGCTGGAAGCAGAGATACTATAAGAATAAATTTGATGTTGATGCAGCTGATGAG
AAGTTCCGCCGTAAAGTGGTGCAGTCTTATGTTGAAGGCCTGTGCTGGGTTCTCCGATAT
TATTACCAGGTATCAAAAGAACATGTCCTTCCAAACTTCTGACAAATCTTTCTGTAAAGT
CATCAAAGCATTTTTGTGTTTCTCTTAACTGAATTGCATTATCCTGAGGCAGAATTTTGT
GTCTTTAACATTCATTATCCTTGACGATGATGCTTTGGGCTCCTTGGAGAAAGACACTCT
GTTATTGGGCTTTTGCATTGTGTCACTAGCTCAAATTATTAAAGTTCATTATTTATATTA
GAATAGAGTGCAGTGATGAATAGCTAGTAGAATTAATTATCAAAGTCCAAATGCCAGAAC
AAAGGGCAAAAAGCATGCGAAAGACTAGTAAGAATTTGAAAAGGAACAGAATTATGCCAA
TGTTCTCCATATAATGTAGTGATATTACATGAAGTGCATTGTAATTGAAGTAATCTGTAT
CTGATTTAAATCTTTTGATAATTGAGATGTCAGATTGGCAAGAGATTAGTTAGACATATT
GGGGATTGTAGGACTGATAGTTAATAACTAGTTTCGTGCTCTGAGAGCAAAGCAAGTTAA
ATTTTGTGTGACCTGGGAATAGATTAAGTTTACCTATTAAGCAACAAAGATAGCGAGGGG
TAGCAGTGTCGGTAATGTTTTGTTTGCTGGGTTTCTTCCTTTTAAAATTAAAATTTGTTG
TGCTCAGTGTTGAAATACTTTTTCAAATTATAGTAGAAGCAGATGATTTCTTCTCTCATG
AAGGTGGGGGTCGTGGAGGTTTTCACTATTTTAAAAACATTTAAATGATGCTTCGGGGGG
TGGAATTTAGGTCTTGCATAAAGCAAAGATAATTGAGAGGGGGCAAATCCATTTCTCTGT
GCTTAGGAACTATTGAGAGTATGCTTGCTGATCCTTTGTCTAGCAAATAATTTGTCCGTA
TTAAAGCCAGGCCAATGAGAATTACTTAGTGATTCAATTTAAGAGCATGTTTTATATATT
TAGTACTAGTCTTTCTCCAAATTTTCTAAACTTATCATTGGAAATGGACAAAAGAGTAGG
ACAATTTTATTTTTAAGAAAACTAATTTTCTCAAACATGCCATGGTCTGCCCATTATATG
TATTAGTATGTTAAGTTGTCCAATATGAATATAGGGGTGGGTTTTTTTGTTTTTTTGGAT
ATTTACCCAAAATCAAATGTGCACCCCCCTCCTCCCCCACCCCCTTTTTTAAATTAAATT
CAGATAGCTCAAATCTTGAATGTATGTATTGGTAATTGGCATTGTGATTATTATAGTCAC
TCTGCTTGTGCGTCTTTGAAAAAAATCTGTGCACCATTATGATTTGCACTTCCCAGAATG
ATCTTTTTTTTTTTCAGTGAAATCCTCCTTTTCTGTAAAAAGTATAAATATAATAGACAT
AGGAGTATATCTTTAAAAATATTGAGAGGGAAATCAGCATATCAATAGTCTTTGTATCCA
ATTTGATATGACGGGATGATTACACTAAGGACAAGCTTCATTTCCACAATACTCATTGTA
CCCACAGACTAATGTAATCTCATTTTTACGATGTTAGGGTTGTGCTTCCTGGAAGTGGTA
TTATCCGTTCCATTATGCACCTTTTGCTTCAGACTTTGAAGGCATTGCAGACATGCCCTC
TGATTTTGAGAAGGGCACCAAACCGGTAAGTTGAATTATGATGTTCATACCAACTTAGAG
GAGATAAAAAATTTGTGTTACACGTTGAGCATATTATTTCTTGCAGTTTAGACCCCTGGA
ACAGCTTATGGGAGTATTTCCAGCTGCAAGTGGCAACTTTCTCCCTCCATCCTGGCGGAA
GCTAATGAGTGATCCCGTAAGAATCATTTTCACCATTTGAACCCTCTCATAAACCTTGGG
CTGAAATGTATTTTTCTTAAATTTTACCACTGTTGCCTTGGGAACTTTTAGAAACAGTGA
AAGGCATTTTCTCAGCTTCTTTCATGGCTTGTTTTCCAGGAAAAAAACAACATTTTATTT
GTTTTCCTTACCCATGAATACCTTTTCCACCCAGTATACAACTACTTTAGGTTCACTGGA
AATGTTTCTCAAATTGTTCTACCATCCCTGGTCTTCCAGCTGTTGGTTAAATGTCTTCAT
GGCTTCTCGAAGAGCTAAAGCAATGGTTGTCATTTACCTGGTGCAGTAGAAAATGAAAAC
TGACGGTGGTCAAAATATAGGAGTAGAGTTCTTTTAAAAGCTGTTAACTTTGAAATTGTT
TCCTAATATTTAAAATGGAGACAATGTTAAGATTGGTTAATGTTTGATGTAGGCTATTGA
AGTGTATGAGCCACACTAGTTTCTGTCAGAAATTGCAGAAATTTCCATAATAAATTATAC
TAGAGTTACATATGTTTGTGATGGAGATGTAAGCCATTCGTAATTGATTTTAATTCTTTT
TATTTTGTTCGTGTGCAGGAATCCAGTATAATCGACTTCTATCCTGAAGATTTTGCTATT
GATTTGAATGGGAAGAAATATGCATGGCAAGGTAAAATTTAGGATTTTCTTTTGTGTCTA
AAATCTTTTTCTTGGTTTCAAGAGAGAATTAATGAGCCAAACAGTACTAACTTGCTAACT
AGAAACTAATGAGATTTATTAACTTGCACATGAATCTTCATGAGAAGGTATATTTTTTGT
GAAAAATGAATTGATTTAGTTCTGACCCAGGATTAGCAGTGATTAGTAGTAATTGTAGCA
GTCATTCTAAAACAGAAAATTGGGCTGAAATAGATTAATCATTTTTCCATTCTTTTTTGC
TATCAGCTTTAGTATATAATTATGTCTTTTGTCTCTTTTGCATTTAATTAATGGATCTCA
GTCTGTTCAATCAGAAGATCATTAGCACCTGTGAGTTACAGTGTAAAGAATAGAGATGCC
TACTGGTTCAGACTTGAGGATTTCCTTAAACCATTAAGAATTGGGGCTAGTCATGAACTA
GATGCTTTATTTTAGTTGTTCCCAGAGGTTCATTGGATTTATTAATTTCCTTCCCTTATC
TGCCTGACTTTCTACCCTTTCTCCACACTAATTGCTACAGTTTCTCTGGAAGGTTATCAT
CAAATTTAAAATTGCCTTGCACTCAGTGTAAGCTAATGGTAGCTAAATGAATATTAGATA
CAGTAACACATGTGAGACTAATAATAATTGTGGTATTTAAGCCAAGCACTGTACTGAGTA
CTGGGGTAAATACAAGATAATCAGGTTGGGCACAGTTCTAGGCCCAGATGGGGCTCACAG
TCTAAGTAAGCTAGTATGCATAGTTCCCTAATTTCAGACTGAATAATGGGAAACTCCCAG
TTTATATAAACACTTTTTATCCAGTAGCTTCAGCCTTCCTTTCTCAAAAACTCTGTGTTT
ATCAGCATTACTAACAAGTAGAAAAACTGACCTGAGGGGAGATAGACAATGCAGGCAAAG
TGAAATGGGGAAAATCTACCACCAAGTATCTAAGTGATGATAGGACCCAAACACTGCCTG
CTCCTCCTCAGAAAGATGCAGTTTGAGGTAGGTCTTAGGGTGCAATTTTTTACCAATCCA
TTTGAGCTGAGCTCTTTGGGCCAGGGGTCTGTAAATTATGGGCCGCAGCAGCCTGAGGAT
TCTACTCAAAAAATGGAACAACAGCGTAATGAAGGCAGACAAGAAAGGGGCCCCTTTAGA
CTGTAAACTCACTGTGGGCAGGGAATATCACTGTTGTTGTGTTGTATTTTCCCAAGCGCT
TAGAACAGTGATTTGCACACAGTAGGCACTCGTAAATACAACTGAGTGAATGAAAGTGAG
GAGACAGCTGTAGTGCTGCTCTTGTGGCCACAACAGTGGCTTTCCTGAGATTTATCCTAC
CACTGCCCTAGGGTTATGGGTGTTGCTGCTGCCCATATCCCACTTGCCCTAGTTCACTGA
GGTCAGTGGGGGTGGCCAGGTTCATTTGCCTCCTTCCCTGTCTGTGCTGTCTTCTGGTGG
TCCCTTTCACCCTCAGTTCCCGGCCGCCACCTCCATACCCTCTTCAGAGATCGGTGGGGC
AGGGGCTGGGGGTAGAGCAGCGGTGCCTTCCCCGGAAGGGCTGGAGTGATGGCGGGCAAC
AGCAATCCAGCGCACTGAAAATGGAAGCCCATTGCCCAGGGTACCTAGCTTTTTACTGCA
AGCTGCACAGCTAGGAAAGAAGAGTGACTTGGGTTTTCAAGCTTCCCGTCACTGTAGACA
AAACCACTATCCTCCCTGTCTCACAAATCAATCGATAGTATTTACCGAGTGGTGATTATG
TGCAGAGTTGGTAGAACATTCGCTGCCCATAGTGAGAGTGCATTGGAATTATCCTTGACT
CATCTCTCTCATTCGCCCCACGTATTCACTCGGTAACCAAATCCTGTCAGTTCCACCTTT
AAAACCTTGTTGAAATCTGCCCTCTCCTCTCCATGCAAACTGCTCCTGTGCTGATCCAAG
CACTTATAACCCACATTGACGTCCTCACTGACCTTTCTGTCTCTCCCCACTCCAGTCCTT
CGCTGCCCAGATTGTATTTTTAAAAATACATTCAGTCCACATCTTCCCCACTCAGGATCC
TCCAGTGCTTGTCCATCTACCCCCGCATCAAACATAAACTCCTTGCTATCTATCTCACCT
CGCTGACCTCCTACTACAAGTCAGCCCAAACACTTGGGTTGTCTCGTCAACCTGCTCAGT
GAACTTCAGTTATCTCTATGTCACCATGGACACCTTACCAATATAAACTCTCCTCCTTTA
TATCTGACATATCTCCACTCTCTCCACCCTCAAAGCCTTACTAAAATCACGTCTCCCTCA
AGAATCCTTCCCTGTCTGAGTCCTCATTTCTCCTACTACCTCTCTCTTCTTCATCACCCA
CGCAGTTGCTATTCATCCGACCCTCAGGCCCACAGCACTTATGTACACATCTGTAAATTA
TGTATTATAAATTGTTTACAGCTCCCTCTAGGCTGTGGACAAGGAATGTAACTACCAACT
CTGTTGTACTATACTCTCCTAAGCACTACATAAGTGCTTTGCACATAGTAAGTGCTCAAT
AAATATCATTGATAAACTTTCAGCCATCCCTTCCATATAATATGATTATAAAATCTCATT
AGCTAGTCTTCTGTAATTCAGACAGGAATAATTGGAGTACAGAAGAAAAAAGGGCCTGTT
TTAAAATGACAGCACTAGTCAGAAGGTTGCATTCACAAGTGAGTCACTGAGACAATCAAA
ATTGATTAGATGAAATTGGAAGTATTGCAGTGGAAGCCCATCATAGTTGGAGCGGTACAA
ACAATAAGAACTAAATAATAGAATTGTTAGGATTCGTTTTGTTAACTTTGTTTTGATGGC
TTTGATTTGAATTGGCATGATGAGCTGGTTATTAGAATATGATGAAACCCCAGCTAAAAC
ATCTCTACTAGCTAAATAAGAAATTCACTGGAAACAGACAGGTATATTCAAATGTTCTAG
AAAAATGTAATTAGTAAAGTACCAGAATAACAGGCGTTTATCAGTACTTTGAAAATCTGA
TCCTCATATTTGCATTTCTAGGTTGCACTACATTTTTGCTTTGGTTGGGAAGAATTCCCA
GTGTACCTCTTCTAGAGTAATATTGCACTTAGATAAATCCTTGTTTGGGTAATTCCCACA
ATTCTGAACACTCTAAGATGATGTCCAAGTGTTTACACATTCCAGCACAGTGTCTGAAAG
GCCTGAGTATATGGCCTGTATTGTAGGATTTGGTTGTGCTGGTAGTATTGCCGATTGCAT
GTGTGATTGGGATGTACATATTAGAATTGTTTCAAGATTTATGGGGCATTTTTTTTAGGA
AAAGTTTTTAGCTAAGATTCAGATTGGCCATTACTGCTTGCCTTTAATATCGTTAGTTTC
TTAGGTATGATTTCCTAGTGTTTTAAAGTGTAACTTTTCAATAAGTGTCACTAAATTCTA
AGTCAGAAGACTGCTATTGGTACTTAAGGTCAAATCCATGAATCAGTGGTATTTATTCAG
CACTTACTGGGTGCAGAGCACTGTACTAAGCACTTGGGAGACACATTCCCTGCCCATAAC
AAGCTTACAATCTAGAGTCAAACAGGATCCGGGTTAAGAGGTGTTGCAATTCTATACCCA
CTTTGGGAAATGTCATGCTCCCCTGTCAGTGCGGGGATCCAGGCAGTGAGAAAGCATCGA
GCTTATCTGCTGCCTCCTTGGCCCTGAATCTGAGTAGCGGTGTTGCCAGCTCAGCAATAA
TCTGGAATAGCTCTGCTGGCACTCCAAAATCAGTGCTAGACTGCCCACCAGGTACCCCTA
AAGCAGGAATGCAGGACTGCAGAATTACTGCTCTGCTGCAACCTGGATGTCACCAGGTGG
ATTCCAAGGTCTGGGTGTGCTTTTCATTTCATTATTATGAGGGTTATGTTGTGGAGCAGA
GAGAGAACACGGGGTGGCCCGCCCGCAAAGCCCACAATATAACTGGAGTAGATTATATTA
AAAACTGAGCACCCAGAAAAAAACAAAGCTCATTCTGAGTAGGGATTGCTTTAGAACCGA
TTATCGTTTTAGCCAAAATTTGCAAATGGTTAAGTGAATTTTTCTAGACCAACTTTTTTA
TGTCATTTAATGCCTTTATTAGCCATGTGGAGCAGCAAGAACACCTGCACATTTAGCACC
GACATGATCCAGATCAGAATATGTATTATTCCCATTGCCATAGTAAATTGACTGACACAT
ATTCGACAGTCACATTTGCCCATACAGATGAATGCTGTTTATTGAAATCTGTCTACAATC
CCAGTGTTTAAATTCGTACTTCATAATTTGCATTCAGAACTGAATGAAATCATACAAGAA
CAAGGCAATTTCTCAGACAGAATATTACATCGTTTGATTGAATTAAGTGCTTCATCAGAT
TTTTTTTTGGTTTAACAGTAGAGACCGTTCTGAAATGTAGACACTGTAGTTTCTATTTCT
CTCAAAGGAAAATCATTTTGAGACAATTGGGAGAGATTGTCATAACTTTTAGAAAAATAA
TACTATAGTTTAAGCAATTTCTTCTTTATAGCACTGCAGAAGAAAAATAGGGCTAAAGCG
TAATCTGAGATGTACATTATATATACAATACATATAGTTATGCACAGAGTATATATATTG
CATGTACAAACACACACTTATTAATTGTGACCGTCTCATTTTCCTAAGAAACTAACTCTG
AGTAGGGGGAAAAGTCTCCTACTTCAATCTTTAGACTCGATTAGCCAGGTAGATTTATCA
GAAAGCTTGATTAGAATCGGTGATAGTTTAAAGTTTTAAGCAACTCTAATTGATAGCTTG
TTTTCATTAGGTGTTGCTCTGCTGCCGTTCGTTGATGAACGTCGTCTGAGAGCTGCTCTG
GAAGAGGTTTATCCTGACCTCACTCCTGATGAAAGTAAGAATATTTCCCCATGTTATTAA
CCGTTTGGTCAGTGAGGCTTTCCATAGAGGTGTGTTGTCTTTATGGAGTCGAAAACCTTA
GTTGAAAAAGTTATGAAGGATGCCAACCACTAATTTCCCTATGAAATTAATAACAGCTCT
GCTTTGTTATGTAATGTGAATAAAATAATTATCGTATTTGTTAGGCGCTTACTATGTGCC
AAGCACTGTTCTAAGCACTGACACTCTGTCCAAAAGCATCCTGGTAGAAGAGCAGTTTTT
TGTCTTTATTGGTGTTCCAGAAATGGCACTTTTGTCTGACTTCCAGGGACTTCAGAAATG
TTTCCTTTGTCCACCAAGAAAGATTTCTTAATGCCCATTGAGATTCGAATGTTATGTGTA
TGTAGTCTATATGTTCATTTTTATTCATATGATTATGTTTGTGCTCTTATAATAGTGCAC
TGTACTGACTTCTGGTTTAGACAGAAAGGCCGCATTTCTTTCATTACCAAGAAACATCTT
CTGTTTTGTGTGTTTTTGATTTGGTGTGTTTTTTTTTAAACTATGGGATTTTCCACAGAG
TTGCAGTACAGATTTTGTCTGGCATATTTTAAAATGCAAGTTTAGTCACTTTTTCAATTC
AGTAAGATTCCGAAAGTAATGAAATTCAGCAGCTCAGATCCTTGTGGCGTCCCAAGATGA
CTGGCACTGGATTGAACTGGGTGCTAAGAAGCGTCTGCATTTAGCGCTCCTGGGAGCCGC
AGGTTTGCCAAGGATGGGCCGGGTGACCACTGGGCTCAGGGAAATGCTTTTCTTCCTGTG
GTTGTTGGGATTATTTGTACCCAGAGTAGGACTGCGTTTTTGCGGTCCTACTGGGCTGGT
ACAGTTACCTTCCTCCCTCTCTAGCCCAGTTTGAGCTGGACGGGGATAATCGGATTGGAC
CGAGCAGGGCATTTGCAGCTTATGCAGAATGTTAATAGGACTACTGCTTTGATCTTAGTT
GTAGCATCTTGCTGCTAATGCAGAAGTCACGCATGTAACATTGAGGGGATCTGTTTGCGC
CGAATTGCTAGGGACACTCTATCCCAAGTGTACTTTCCATTGCCTACTTTTAATATTGCC
AGCGACACAGTCTGATCTTTTGTTACTCCAAGCCTGAGTGGAATGCATTGCTGCCGCTGG
TACTTCACCTTCTATTCCTTCCCGCTTAAGAGCAGATCTTATTTTATTGAACAATGCCTA
TTGCTGCTGCTGTAGCTGCCGGGAGCCCCTGTTTCTCCTGTTAAGGGATGCGTGTTTCCT
AGAGTCAGGCTGGGTTGTGACAGCTGCCCTGCAGCTGCCCTCTCTTCAACAGCTGGCTTT
TCAAGGACGTGAACGGTGGGGACAAGTCCTCCATAAACACCTTTCTCCTAAGGACTCTCA
CTCAAGGGCGATGGTCACAGCTCCAGCACAACTCCTAGGGAGAGGCAGCTGGAGAAGGAA
GAGAACCAGGGGCCCGTAGACTTGTGGGAAGGGCCAAGATGAAGAGGATCGATGGGAAGG
AAACTGACCACAGCCCGAAGGATTAAGTGCTGCTCCCTCTCCACCCCATGGCCAAGCAAG
AGGCATCAGCTTGGAGGAGTAAATTGCGGTCCCGGCCGCTTGACGGCCACTTCAAGTCTA
GAGCAACTCTAGGAGGGGTGCCTAGCAGCAGTAAGACCGTAACAGCTGTGGCCCTGACCA
GACCTCATTGCTTCTCTCCATCCTCACCCCATGACTGCTCTGAGTCCACCCTGGGGTTTT
ACGTTCCCACTGAGCTCCAGAACACACAGAGAAGCAGTGTGGCTCAGTGGAAAGAGCCCG
GGAGTCAGAGGTCAAGGGTTCGAATCCTGCCTCTGCCACTTGTGAGCTGTGTGACTGTGG
GCAAGTCACTTCACTGGGCCTCAGTTACCTCATCTGTAAAATGGGGATAATGACTGTGAG
CCTCACGTGGGACAACTTGATTACCCTGTATCTACCCCAGTGCTTAGAACAGTGCTCTGC
ACATAGCGCTTAACAAATACCAACATTATTATTACCTGTGCCAGGGCGATGGCAGCAGAT
GTGGCGTAGGCCCACTCAACGACCGAATGAGAGGGCAGGTCTAGACCACGTAGGCAGCAG
CAGCTGCAAATCCTAAGAGGATCATTCTGTACACTACAAGCAAGAAAAGATCATATGAAC
AGGACTTGAGAATGTGCTCCTATCCCTTTGCACATTTTTCTTCTACTGCCATTTCTTCTT
CTGCCCTGAGTCTGACAGAACACCGCCCCTACCCCCATGCTTTTCATCCCAACCGGCTAG
AGCTTTGCTAAAGTTCAGTCTGGTGAGGTGATGCTGTATATGCGGCCATTCAGTTGGTTG
GGTCGTAATGCTACTTTTTTGGGTTGTTTTCCAGACAGAAGAAACAGTCTTGGAGGCGAT
GTCCTGTTTGTAGGAAAGCATCACCCTCTGTGTGACTTCCTTTCCGAATTGTACAAAACG
AGTTCTGCAGAGGTATTCCGTAGTCTTTCAGTTTTACAGTAGTTTCAATTGTGCGACTCC
ACCTCTCTTCTAAACTGGAATATTTCTCCACAGCCTGTGGACATACCGCCTGAACTCTGC
CATGGGATCCAGGGACAACTTACCTTAGATGAAGAAGCAGTTCTTCCAGATCAGTAAGCA
TTCTTTTCAGTAGGATTGAGTTACTTGCCTCTAAAACATACACCTTTCTTATCAGGATGG
GGCTTACCTGCCCTCCTTCCAACTCCCTCTTTCCTCTTCGTATCTCAGAGACAGTTACTC
TCCTTTACCCTCTTCCTTCTCCCCAAAAGCCTTACTGAAGGCACATCTTCTCCAAGAGAC
CTTCCCCGATTAAGTCCTCTTTTCCTTTTCTTCCACTCCCTTCTGCATCACCCTGACTTG
TTCCCTTTATTCATCCCCCAACCCAGCCGCGCAGCATTTGTGTACCTATCTGTAATTTTA
TTTATTTATATTAATGTCTGTGCCTCCCTCTAGACCCTAAGCTAGTCTTGGGCAGAGAAT
GTGTCTGTTATGTTATACTTTCCCAAGTACTTAGTACATTGCTCTGCACACAATAAGTAC
TCAATAAATATGATAACTTACTTTAAATGAAAAAGTAAAAAACCTTTTTGAGAGCCAAAT
CCATTTTAACCTAGTAAGAATCTGGAAATTAAAAAAAAAAATCCCTCTCTCCTTTTTGAG
TTTAGGGGGCAGTTTCTGTTTCCTTGACACTAGACAAGTTGATAGTAAGGGTTTATTATA
GGTTTATTTCCCAAAACTCATGGTATGAGATTTCATTAACATGTTTCCATTTGCTCACAA
CACTGTACTTCATAATAAGCTTGATTAATTAATGGTTCTGAGCTCTCCAAAAAGGTTTGT
TTTTTTTCATTGGAAATCTACCTCATACTGCCTTTAAAGAAACTGTCGAAATTGCTGCCT
GACGTGTTTCTTAAAAGCTCCTAAATTCCAACTCTGTCTTCACCTGAATATTTCAGAAAG
TATGCAGAAAACTATCCAATTTTCTAGAGGGTGGGATTTTTTTCCCCTTAATACTTTAGT
GTAGTATACCCATCTTACCAACTTTTTATCCTAGAATGGGATTGTATTAATCATTTTAAA
AATAATTCTAATAGAGTTTAGGAGTACTATTTAAGCCATTGGCTTTCCAGATTTTATTTG
GAAAATACTTATTATCTTTCCAAGGAGTTTGGAAAAAAAAAGTTTCTAGTTTGTTTCTAA
GTGAAACGAAGTATAACAAGTATACAGATTTTCCTTTGCAACTTTTTGTGCTCTTTCTGA
CACACAGTACAGTGCTCTACACAAAGTAAGCACTCAGTAAATACTGTTGATTGACAATAA
GTGAAAGTTCTGACTCCCAATCTCTTTCTTCTTTAGAACAGTGTGTTCTCCTGTTCCGGT
GTTACGGGATCTGACTCAGAATACTGCAATCAGGTAAGGGAGCTGGACTTTATGGTTTTG
CAGTTGTTGAAATTAGTTGTGTTCCTCTAATTTAGATATAATCCGAGAAATTTGAAGATA
AAGCATGAAGTATTTTGTCCGCTCATACCCAAAAAAAATCCACAAGCTTGTTTGGGATTT
TAAAACTGGAAAGGACTCTGTAAACCTTGTACTGTGATTTACTCCACCTTTAGGCAAGAT
CCCAAACAAACCATAAGTAACTTGAGTATATGAAAATATTTTTGTCAGTCTGAGTAGCAC
TGTTCTGACCCAAAAGGGGCCCCCATCTCATTAAATAGTGAATTGGAGAAGTATACACAT
TGTTTCTAGGCTGCTGAGACTAGAACCACCGAGGCAGTCACTCATTCATTCAGTCGTATT
TATTGAGCGCTTACTGGGTGCAGAGCACTGTACTAAGCACTTGGGAGAGTACAGTACACA
ATCAGTAGAGAAATTTCTGCCCACCAAGAACTTACCCAAAAGCACATATCCTAAAAATGC
AGCAGAGACATAACTATTGCTGTGTAGTCACCTCATTCCTTTTGGATCTTTTAACAGTAC
AGTTAATTGTCTTCTCCCCTCCAACCTAAAATGGAATGCAGAAAGTAGAGAGGCAGAGCC
CGAACCCATGCGAGGCTTAACGAGGAAGCTAACCAACCTGTCATGTCTTAAAAGGAGGAA
ATTCCTGTGTTTTAAAGCCTCCCACAGCCAGGAAAATCAAAGCCCTCATTGTACAGTTCC
AATCACATTCTTCAGTGGAGGTAGAGAAGAGCTGGTTACCGTCCCTTCGAAGAAGGCTTG
AAGGGTCCTCCCTCTGCTAAAAGGTTTACTCATTCATTTGAAACCTGTGGTCTGAGATAC
TGTCTATCTCCACAGATCTTTAAAAGGGAAGAAAGCCAGATTAAGAGCTATAGTTCCCCT
CTTAAAATTTCCTTCCCCTTCAAGACTAACGCTTAATCTATTTTGATACCTGTGTCCCCC
TGTGGACTGTAAGCTCCTTGTGGGTAGGGATTCACATCTGTCACCCTGTTATATTCCACT
TTCCCAAGCACTTATTACAGTGATCTACACATAGTAAGTGTCAGTATACACCAATAAATA
TCCCCCCTGCCCTCCCGCCCCTCAAGTCTCTTCCAGTTATTCAGGTCTTAAATTTTCTTA
TAGGCAGAACACTGTACTAATCAATGAAGGAATAGAAAAAAATCAGTTGAGACACAGTGC
CTGGCCCTCCAAGGACTCACAGTCTAGGAGGGTGAAGGCAGACACACAGAGCAAAAGAGA
ATTATGCAAAGTTCAAGATAGTCAAGCGGCTGAAGTTCTGAATGAAAGTTGAAAATGATG
AAATATAATCGAATACAAAATACTACTACTACTACTACTAATAATAATAATGTTGGTATT
TGTTAAGCGCTTACTATGTGCCAAGTACTGTTCTAAGCACTGGGGTAGACACAGGGGAAT
CAGGTTGTCCCACGTGGGGCTCACAGTCTTAATCCCCATTTTACAGATGAGGTAACTGAG
GCACCGAGAAGTTAAGTGACTTGCCCAAAGTCACACAGCTGACAAGTGGCGGAGCCGGGA
TTTGAACCCATGACCTCTGACTCCAAAGCCCAGGTTCTTTCCACTGAGCCACGCTGCTTA
GATATGTCATCTTCTTATATGGCTTTGGGGGGCCCTTTTCCCTCTGGTGCTTGTGATAAG
CTGAAGATGTTAATTCAGCTAGTGACAATTCAGAAATATGTCCTGAAAGGGCCTTTCAGA
GAACTGGAGTTTATTTTCCTTCAATGGGCTGTTTTTCTTCAACTTTTCACAAACATTTTC
CTCTGGGCCTAGATAAAGCATTGAAAGTTTTTTCAAGAGGGTGTGAGAGTGAGCGAGTGA
AGCTCGGCCCATAATGGAAGGTCATAGGTAACTTTCACTGCAGTGTTCATGATGGTATTG
GTTGGCAAGTGGATAACTTGAAATCAACTTGGAGTATAACACTGAAGGAAGTGTATGAGA
AACACTTAAACTGAAGTAGATATAATCAGAAACATAAAGACTTGATGGTTCAAAACACCT
TCTGTTACGGTTTTACTTTTAGCTGCCTCAAATGCTCTGTAAGGCATTAAACTGGTGCCT
TGACAGCAGAATAGAAGAAAAATTCAAGTTTCTTAAACTTTCAAAATTTTAAAATGTCAA
GTTCAATGACCATAAAATCTTTGCCGAGTAATGGTAAGATTTGAGTTTCAATGATTATCA
ACTCTGTAGATGTAAAGGTAGCATAAAAGTGTAATTTTTTCCTTGCGTTCTTTCTCTTCA
TTGTGAAGAACACTAGTACAGACTTCCAAAGAATAATGCATTGAAGTGGTATATGTAGAG
ATTAATCTTAGATTGCAGCAGAAAAAATTGTGTGTGATGAGAATTCCACCTTTATTTTGT
CATGGCACTTACGTAACTTAGCAACATTTCGGTCTTTGTGGCCTGTTACAGTCCGGAGCT
CTGGGTTCTTGGCCCGGCTCTGCCACTGGCTTGCTGGGCGACCTTGAGCAAGTCTATAAA
ATGAGGATCAGATTGTGAGCCCCATGGGAGATTTGGGGTTTGATTTGATAATCTTGTATC
TCCTCCTATAGAGTTTAACACAAAGAAACTTCTCAATAAATGTTGTAATATAGTTATACG
ATATTAACTATATACTATAGTTATAGTTAACTATATACTATATAGTTATATAGTAATAGT
AATACTGAAATGTAAGTTGAGCATCAGTCTGTGCATAAGCAGTTTTCAGTCTAGGTGGGT
AATTGGAATTTAAGTGAGAATAAGGTTTAACTTCCTTCAGTCTTGCTTTGGAAACCTGTG
TTTTAATAATAGACAAGTAACTTTTAATTCCTTAGTTATACATGTGGCATGTAATTTATG
ACTTCACCATAACTGGAGGAAGTGGTTAATGACTCCCCACTTAAGCTAAATACACCTGCA
CCGCCCCTTGTGGAAATGGTACTGTTCTCCTTTTATTGGGACATTAAATTTATGGTAGTT
CCCCATTGTTATACCCTTTAGCCCTTTTCCACGATAGCAATATTGAGTTTAACGCTTACA
TTCCATACGGTCATCTCACGTTTCACTGCGGTGCTCTGGTTTTGCCATCCGTGCACTGTG
AGCAGCGTGTGTACACTCTGCAAGTTGTGTACTCAACTCCTCTGTGTAGGACAAATATTC
AGCTCTTGACTTACTGAAGTTAATCAGTCACCCCTCAAATTACAATGAGTCATGACCTCA
AGACACCTTTCAAATAATGCACCCTAGGAATAATGTTGTGTTTTCTCACCATGCATAATA
CATGAGCCCAAGACTTCAAGACCAATAAACTGCCCAAAGGAATCGAGTGTAGCGTTAGGG
GTTGCGTAGTGCCATACACACTCTCGTGCCTGCCGGTCATGTTCCCTCTGGGCATTGAGT
GCACAGAGCAAGTAGGTGGGCAGAGATGTAGCACATTGCATAATGCATGCCAGACTTTTA
CATCCAAAACCCAAAGTAACAGCACCATAATACTAGTACTGCTGATAGCCCTTAAAACCA
ATTGGAGGGCAGTATTATTGTTGTTATTATTAATAACAGTAATAATAATAGTGGCATTTA
AATGCTTATTATGTGTTGTCAAGCACTGGGGTAGATAGAATTTAATCAGGCTGGTTACAG
TCCCTTTCCCACATGGAGCACACAGACCAAGTAGGAGGGGAACAGCTATTGAATTCCCAT
TTTACAGATGAGAAAACTAGGCACAGAGAAGTTAAATCACTTGCCCAGGGTCACACAGCA
GGCATGTGGTGGAGCTGGCATTAAAAGCCAGGTCCTTTGCCTGCATGCTTTTTCCAGTTT
GGTAGCCACTGCGGTGTCCACCATCCATGTTATCCAGCTACTTGAAGAATTCCTGCCCAC
TCTGTTCATCATGTGAGATGCTGTAAGTGTTTCTTTGGTCAGATACTGTTGGCTTACTCA
TCTACTTCTTGCTCTTCTATTCTCCCAGTACCTTGAGATAGTGGCACTCTCTTGGGAAGC
GTGCAGCAGTCAGGTGGCTTCTTGAGCAGGCAGGTGCTGCAGGTAGCAAATTCCTTAGCT
TAAATCTCATAGTTAAATTAGTTGTGCTGAAGCGTCTGGACTCAGGGGAGCAGCAAATCA
ACGTATGTGAGGCTTTTGATGAGAACAGTTCAGTTTTTTGGTGTTTTCATTCATTCAGTA
GTATATATTGAGCACTTACTGTGTGCAGAGCTCGGAAAGTACAGGTCGGCAACAAACAGA
GACAATTCCCTCCCCCACAGCGGGCTCACAGTCGAGAAGTGGGGGCACAGAGGGACAGAT
AGCAAAGCAAAACAACTAGATAGGCATCAATATAAATAGAATTATAGATATATACACATT
AATAAAATAGAATAATAAATATGTACATGTATACACAAGTGCTGTGGGGCGGGGAGGCGG
GTAGAGTAGGGGAGGGGAGGAGAACCAGAGGAAAGGGGGGGCTTAGTCTGAGAAGGTTTA
ATGTATGCCCTTGTTAATGATAAATTGTTCAAATTTATAATCATCTAATTGTTATGTATT
TATATTGCTATTTGTGTGTATGCTAATAGTATTAAAAATAATGTGTTTTTAAATCACTTT
TTTTGGGTGTTGGTGATGCATTGTTGCCCTATAGATTGTTGCCAGTGATGATATTATGCT
TTGTGGCGCACTGTTTCTCTTAACACTGTTTTTTCATTTTGGGGGTGTAACAGAATTACT
TGGCCTTTTACAAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNCTGGGGACATTTATTGAAACAGAATTTGTGGGTGTTTGCAAGAGGG
ATTCCTGGCCGGGAATAGAGAGAGGGGCGTTCTCTAATATTCTTGGAGAATCCATGGCTG
ACAGGATGTCCGGAAACATCTACTAATTCATGGGGGAGTTGAAGGATTGGGAAATTTTAG
CCCGAGTGAGGAAAAGGTTACTTAGCCATATGAATTGCGTTTTTTCTGTGAAACATCAGT
ACTTGGAAGAACTTGAATCAGTGAATCTGGAAAATCTTTAGTACCTTCAGTTACCCCTCG
GCGAGGGGGACCCTTATTTCTACCCAGTTGCCTTTTTTTGGTATTTGACTTTAGTTTTCA
TTTTTGCCGTGTGCCTTTAGTTAACCTCGTGGGACTTTAAACAGTAAAATGTCTTTCTGT
AATTATTTCCAAATTTGTAATCCAGTGTAAGTGCTTTTTATGGATAATATGAAATTTTTA
TGATTTCTCATTTAATACAGTTAAAATCCTCTCCACCTAAAGATCTGAAGTGACTTAGCT
TTCCAATACTGACTTCTGAATCCTAACGTGAAAGGGCCATCTCCAACAGTGAATAAGCAC
TTTAGCTACTGTGATTTTTATATATAATCCTTGATACCTTTTTCAAACCTCTCAGGCAGT
CTAATTCCATCCTTAATGAGTGAGAAGTGATATTGTTACACTGTGGGGTTCATTGGGAGA
ACGGAGGGCAGGGACTTGCAGGAGACTTTCCCCTTTGTGTCTGGAACTTCCTACTCACCG
CTTAACTTTCTAAAGCTTGGGGAAGGGATAGGGAGAGGAGGAAAAGTTTTGCCTCAACTT
CTAAGCTATCAACAAATAGACTTCAGCAAAAAAAAAACAAACCTGAAAATTTTTGGAATT
TCACTTGCTGTAATTTCTGGCTGGAAGGAGGCACTTCAGACTTGGAATGCTTGAGGGAAA
ACAGAGAGGAAGAGGGGGATTAAAAGTCTTGAGTGATGCCAAACTGGTCAGCCAGAGTAA
TCTTTGCGGGGGGGGGGGGGGGTGTTTTAAATGATATCAGCAAATCTGCATTTCTGTGGC
TTTCAAAATTTTCCCCTTGTTTGACTCAAGTAAGTGATTACTAAATATCTAGAATTGAGT
GCCACTCAGAGGGACATGACCACTGCTATATGAATTTCCCCCTAAGAGTTTACAGAGGTT
TAAAAACCTTTTTTTGAACCCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNCTAAATATCTAGAATTGAGTGCCACTCAGAGGGACA
TGAACCACTGTATAATGAATTTCCCCCTAAGAGTTTACAGAGGTTTAAAACCTTTTTTGA
CCCATTAGTGCATAAGCCCTTGTTTATGGAGACACATAGGCCCACCAAGAGGGCAGGCAA
ACTCCCCCCTTTTACTCCAGGATCCAGTTGGTCGATTCCCAGCCCCTTTTTGCTGCTTCT
CCAGAGAACTTGACTGTTTCCAGTGGCCCCTTCATCAGGGGGTTGTTTGAAAACTAGGAA
ACTAAAGAGCGTTAATAAGGGGGATGGTAGGGAGGACATTGAAACAATCAATTACAGTGA
AGTTTTTGGATTGGCTGTGGATTTCAATTTTCCATGCTCTCCGGGCTTCCTTTTGTTTTT
TGAAATAATCGAGAACTGGCCATAGGTGAAAAGCAAGCCATACGCACTCCACCTACTAAT
CCCCTTTATACAATTGTTTGCTCTTCTCTTTTAGTATCAATTTTAAAGATCCTCAGTTTG
GTGAAGATTACATCTTCAAGGCTGTAGTCCTTCCAGGAGCAAGGTAAATGAATTGTTTTT
TATGAAATAAGTTAATTTATCTTAGAGCAGTCATTTACTTATATGAAATTAATTGTGTTA
TATTTTAACACTCAGAAAACCAGCACCAGTGCTCAAACCAGGGGACTGGGAAAAATCCAG
CAATGGAAGGCAGTGGAGGCCACAGCTTGGTTTTAATCGAGACAGAAGACCCGTTCATTT
AGACCAGGCAGCTTTCAGGACATTAGGGTAAGTATTTCACAGAGTGTTCTCATGATTTTC
AGAGTGTTAATTTATTTGCTTCAGGGGGAAATGGTTATCTAAAGTAACACATTCTAAAAA
AGGAGCCATTTGTATGTAAATTTAAATCATGAAATTTTATCTAAACACACAAGGAAGAAG
TAGTTGAATTTGTACATCTATTTTTAAATAGCTTTAGCTTTTTTCTGTCTTTGTATTTTT
AATTTCTTTTACCACATCTTCATATTGGGTTTCATTCATATTATTGTCCCCTTTTGTGCC
GCTGTTGAAGCGAGGTGCCTGGGCCGGGTGCACTGTAGGTCTGATGCAGCATCATCTCAA
GGAAGTTATTTGTAATTAGTGTACTAATGGCATTGGCCCCAGCAGGCATTTCCCTCCCAG
CTGTTTTCCGCACCCTCACTACCTGGATGCGTAGATTGGGTTGTACGTATAGGACACAAG
CATACTCTGACACTGACACAACACAGGCACAGTAACAGAGCGACCAAGTGAGATGCGCAG
AGGGCCAGAGGACAAAAGAAAAGAGGGACCGAGAATAGAAATTTGGGGAAAAACTGGGAC
TGGAAGGAGTGTTGGAAAATGAAGAAAAAAAAGCGTGAGATTGAAGGCAGTTAAGATTCG
AAAATTCCACTTTAGGTACTGTTTTTGTTTAAAAGGCAGATGACACTTAAAAGGACCAAA
TCTTTACCCTTAAAATTCTGGAAAGGAAAATAATGATGATGATTATGGTATTTGTTAAGC
GCCAACTATGTGCCAAGCACTGTCTAAGCACTGATGAGTGTTTGGCAAAGTCAGAGTGTT
TAACAAGACCGTTTAAGCATTCAGAAATTGTGCAAATTTGAATCTTTGTTTAGTGCTTCA
AACTAGCATCTTTTCTTTTTCAGGTTTGTATGTAATCAACTGCCCTGTTTCTGGGCTAGC
TTGGAATACAGTTAGGTTTGGATGGGGAGAAATGGAGAAAAATCTGTAGTGGGAAGGTGG
AGGTTTCTAAAAGTAACACTTTATTTTGTGTTTGCGTGTTCAATCCTGGTAATGATATCC
TTAAGGACCATTGAATTGCAATTGAGTTGCAGTCTAAGATCTCACAAGGACCTCAACAAA
CTCATCTTCATCTAGTACCTTAAATAACCTTGCTAGAATGTGAGAAATGCTTTTGTTGGA
GAGTCCATGCAGTGTAAAAGTTTAAGTGCCCAACCTGCTTATAGTGCTTTGCTTGATAGA
TATATATTTCCACTGCAGTTTCATATGTCAAACTAGCAAAAAAAAAAATCCCATTCTTTG
TTGCATATCCATCTTTTGATCTATCTTCATTTCCCCTTTCTGCGACTTTCTCTTAGTATC
ATTGCCCTGCCATTTTTCTCTCTCGACTTGTCCATCTCTGTCTTCCTCTCCACCTATTTT
TGTGTATCTTTTGCACTTCTCCGTTTCTAATGCTCTCTTTCCCTTTTCTTGACTTTGTAG
TTATGATCTTTCTGTGTCCCTCTCCCCTTTTATTGAAGGCCTTTTCCTTTCCATTATGTA
TTGTCCTTTTCCTCGTCCACATAATACTCTTCACTCTATTTACCAGCCCCTGTACTCGAT
CAGTTTTATTTATCGAGGGCTTACTGTGTGCAGGGCACAGTGCCGAGCGCTTGGAAGTGC
AGTATAAGAGTCGGTTGACACGTTTTTCCCTCTCTATCACTCATCCCTTTCCCTCTTCTC
ACCCATTGTATTTCCTTGTTTCCTGTCCCTTTCTTCCCCTCGACTTTTCCCTTCCCCTTC
TTGTTCCCTTCTTATTATCCCTGCCTATGCATCTCTCCCTCTACCATGTTCTCACCTTTC
ATGTCTATCCCCCTCCATCTCTTTTATTCTTTCCCCTTCCCTCTTCTCCCCTTCTCCCCA
CTCCCCTCCCCAGGTACTCATTATGAAATTCCGAGCCCAGCTAGAAAGTCTCCCATAAAT
ATGGTTGCCAGGTCAGCGAGCCAAATTGATAGCTTGTTTTTATTAATTTACAAATAGAAA
AAAGGGGAAATGTGATTAGTTTCTTAAAAGTTGCTCAGCGTGCTTACTGGGTGTTTTAAT
TTAAAATGTCTGTGTACTAAATTTGGGGTTTTTCATTATTTCCATTATTAAATCAAGACC
CTTTGTCCGCTTTGTCCATTAACCTGAATGTGTTGCGGATAAAAGAAAGCTTATGTTTTG
TGGTGGAGTGGCCCACTTTTACTCCATAGACGATAATATCTGTCACGTGAACCAAAGAAC
AACCGAAAAAAGGCACTGAAGGCAATGTAGAAAAGAGAGTATATGCTGATTTAAAGGAGC
GTTAGTTCAACTTTGAGGGACCTTTCAGCGATGGTGTTATAAACATGAATATTGCCACTC
TTTTGCCACTGTAGTATCAGAAGCCCCCAGTAGCACAGATATCTACCAAGTAAGTGCTTA
CTTTGTGCAGAGTACTGTATTAAGCATTTGGGAGAGTACAGTACAATAGAGTTGGTAGAC
ACGGTCCCTGCCCCTAAAAATCTTACAGTCTAGAGGGGGAGTCAGACATTCAAAAAAACT
ACAATAGGGGAAATGGCAGGGGGTAAGGATATGTAAATAAGAAGTATGGGGCACAAGGTG
GAGTGACTGTCATTCAGTTCATTCAGTTGCATTTATTGAGCACTTACTGTGTGCAGAGCA
CTGTACTAAGCTCTTGGTATAGTACAACAGCAAGCAGCAAATAATAATGATGGCATTTAA
GTGCTTACTATGTACCAAACTCTTATATTGCACTCCCAAGCGCTCAGCACAGTGCTCTGC
ACAGAGTAAGCCCTCGATAAATAAAACTGATCGAGTACAGGGGCAGGTAAATGGAGTGAA
GAGTATTATGTGGAAGAGGAAAAGGACAGTAAATAATGGAAAGGAAAAGGCCTTCGACAA
AGGGGAGAGGGACCCAGAAAGAACACAACTACGAAGTCAAGTGTACTTTGTGCCAAACAC
TGTTCTAAGCTCTGGGGAGGATACAAGGTAATCAGGTTGTCCCACATGGGGCTCACAGGG
GGTGAGGTAACTGAGGCACAGAGAAGTTAAGTGACTTGCTCAAAGTCACACAGCTCACAG
TGGCAGAGCTGGAATTAGAACCCACGACCTCTGACTCTCTTTCCACTGAGACATGCTGCT
TCTCTGAATGTATGTGAAGCTGTTGATGAGAACAATTCAGTTTTTTGGGGTTTTCATCCA
TTCAATCGTATTTATTGAGCACTTACTGTGAGCAGAGCACTGTACTTAGTGCTTGGGAAA
GTACAGTTCGGCAACAGATAGAGGCAATTACCTACCCAACTATGGGCTCACGGTCTAGAA
GGGGGAGATAGACAACAAAACAAGTGGGCAGACATCAACAGCATCAAAATAGCTGCATAG
AATTATAGATCATGAATAAAATAGAATAATAAATATGTACAAATATACACAAGTGTTGGG
GGCAGGGAAGGGGGTAGAACAGAGGGAGGGAGTCGGGGCAATGGGGAGGGGAGGAGGAGT
AGAGGAAAAGTGGGGCTCAGTCTGGGAGTTTAGCTGGGAAGTAGCCGTTTGAGATACTGG
AAAACTGTATTTTCTAAATGTCGACTTTTTTTCCTTGCACGGGGCAGCCACGTAATGCCA
AGAGGAGGATCTGGGACCGGACTGTACAGCAATGCGGCACCTCCTGGGGGTTATCAGGGA
CATTTCTCCAGGCCAATGATGAGAGGCCAGCCACAGATTCCAAAGCTCATGTCAAGTAAG
CAATGGTGGAGCTTGCTCTCTTTCAGTAAGATGACATTTTCCCAAGGAATGTGTATTACA
AAAGGCTTTTTAATATTACTCTTTGGTAGAGGCTGCAGTAAGTGTTTATGCTGCCTGTTA
AAATTTAATGTTAAAGTGGTTTTTTCTCTCCAAGTTGTCTTTACCAGCGGTTGCGGTGGT
GTGTGACTCGTTAGTGGGCTCTCAGGGTGTCAGTTGCCTGCGTCTCCTTTTAACGCCTTC
CATCCACTTTCCTCTTTGAGTGCTTATCTTGTGCAGAGCTCTGTACTGCGTGCTTGGGAG
AGTACAATATAACAGAATTGGTAGGCCTTCACAGTCTTTCTGGGTAGAGGGGAAAGCGTG
AGTTTTCAGCAGACAACTCCATTCAGGGAAACCTGTGGTCTGCTCATCTTTTTCAGCGAT
TGATCTGCAATTAAAGATTCCTGCTTGGATAATTGTCTTGATTGCCAATTTAGGTCTCAA
CTGAAGTTAAGTATCTCTTTAAAACGCACTACAGTCCTGGTTCTATTAATATTATCAAAG
AGTGGAGTAGTTGAAAGGGCCTTGTTTGCTCGCTTTGACAAGATTCCCTTTTCTTGCTCT
TTCCCCATGTTGTTTGGGGTGATGCTATGTAAGAAACCATAAAGAATGTTACGTGAGTTG
TGTTGTTTGCAACAATAGACAAAAGCGTTTTCCTTGTGACTTTTTTTTTTTTTTTTGGAG
GGGGTAAGAGCAGGGAGGCCTCCAGCACCCAACATATGGCAGGGAGGGCAGATACACAGC
CCTTGAATATGGAAAATTAGAATTACTAAGAGCAGCTATTGGGATTGTAGAAAATTTGTC
AGTTTTACCAGAACTTTGATTTTCTGGTCCCCACCATGAAACATTTCTGAACATTTCCTT
CACTTGACTGTCATTAGAATTGCTTGAGAAGATTGTGAGAAGTCCTGACCAAATAATCCA
GGAACTGGCATTTTTTGCCTTTCAGGCCTCATAGGCAGAAATCCATAGTCAAAAAGAGAG
CTGTTCATTTTCCAAATGGGCTTTTCTAGAAAGGTTCCTCAGGTGCTTTCTCCTTGGCTT
ATTTTCACCAGTATTTCCATCAAATATTGTTGCATTCAGAAAGGATCATGCTGAAGGATA
GTATTTGTAGAAGGGCCTAGTGAGAGGGACAAAAGGAAGAAGCAAGGGATACAGCATAGA
ACTTGGTGGCCATTTGATTGTGTGGGGGGAGGAGGAGCCTGCAGTGGGTTTATGCTGTTG
TGGAAGTTAAAGACGGAGGGTATATAAGCAACTGCTGGGGAAAAGAGCACATTGTTTAAT
AAAATAATGGCATTTCTTAAGCCAAACAGCGTGGTGTAGTGGATAGAGCTTAGGCCTGGG
AGTCAGAAGGTCATGGGTTCTAATTCTGACTCTACCACTAGTCTGCTCTGTGGCCTTAGG
CAAGTCACTTCATTTCTGCACTTCAGTTACCCCATCTGTCAAATGGGGATTGAGACTATG
AGCCCCAAGTGGGAGAGGGACTGTGTCCAACGTAATTTGCTTATATTCCCCCTAATGTGT
AGTACAGTGCCTGGCACATAAGTGTTTAACAAATACCACTGCACTTACTATATTGCTAAG
CACTGTACTAAGTGCTGGGATAGATGCAAGATAATTGGGTCCCACATGGGGCTCCCGGAA
TAACTAGGAGGGAGGACAGGTATTCAAGCCCCGTTTTGCAGATGAAGGAACTGAGGAACA
GAGGAATTAAGTGATTTGCTCAAGGTCACATGGAAGCTAAGTGGCAGAGCCGAAATTAGA
ACCCAGGCCTGTGCTCTTTCCACTAGGCCATATTACTTATCTAATAGGATTCTTCCTTTT
AATTTGGAAGGCAGAATCAAAAGACCCGCTGGAGTAGGTGTAAAGACGTGTTGTTTCCCA
ACATTCTTAATGCTTGAATTATTAACTTTTGGCTCCTGCAGAGTTGGCATTGCAGAAATG
CTTTTGGGTGGCATTACAGCCTCCATTGGATAGAAAATCAGACATGAAAGCCTAGTTCTG
GAAGGGAATTTCAAGATATCCAGTCCAGAAATAGCCACACTGTGGCTCTTTACTTTGTTT
TTTGTTTTTGTTTTTTACCTAGGGTATGGTTCATTTTGGTGGCTCATTTATAAGGGAATG
AACTGGGTAGGGGCAGTGGCGCCTGCATTCATTCATTCAATAGTACTTACTGAGCACTTA
CTATGTGCAGAGCACTGTACTAAGTGCTTGGAATGTACAATTCGGCAACAGAAACAAGCC
CTGCCCAATAACAGGCTCACAGTGGGGAAGGAAATACTAGTATTAAAAATGTTTACTAAT
TGCTGTATGCAAAGCACTGGGGGAAAATTAGACAGGATCCCTGGCCCTCAAAAAGCTCAC
AGTCTTGGAATAAATTAGGAGAGGGGACTGGTGTCGGATACCTAAGGAAAAACGTAAAAC
AATAAGAACAGAAAAATCAGCAGGAAAGACAGTGGACAGCGATAAATGCAATATTAAAAT
AAAAGGTTGTAGGGCAGTCTGGCTAGGAGAGCAGAGTTTCAGGCTTCTCACAGCTCAGAA
TTTCCATGGTCACAAGCCACAGTGACCACCACAGATGTAGCCTTCCTAATGTTCTCCATT
TTGCGGAGGCAACATGGTGCCACTCAAGATAATAGCACACATGTTCCTCCTGTAACCGTC
CTCACCCATAACCTTCCTCTGGCTCCTAGCTGGCTGCTACTGCTTGGGTCTCATAGTCTT
CAAATATGTGTAACATAATTTTATATGATTCCCAAGCATGGTATCTGGCAATCATTGGTA
TTTATTGAGTGTTTACTGTGTGCAGAACACTCTACCAAGTCCTTGGGAGTTTACACAATT
CCCTGCCCACACAGAGCTCACAGTCTAGAGGGGGAGAGGAAAAGCATTAAAATTACCAAA
TTCCATGGTAATTGTAAATATGTGTCTCTAAGTTTCATCCCTCTACATCTAGCCAGAACT
CTGTATGTGAAATAACTTTGCCTGTCCCAGTCAGACTCTTTTGCTTGCTTTTTAATGAAC
TACTTTAAATTAGCTGGTAGTGTTTTCTTTCAGCTTTAAGTCTTAGATTAAGCTTGTGAA
AGCTAGCACGGTATGGTGTTTCTCTTGTGTCGTTATTTGGATCCTGAGTCCCCTTTTCTG
GTGTTTCTTTTTGTTTTTCGTGAGGCTGTGTGGTGTTGTTCTGGGAAAGATTACTTAGTT
ACCTTTCAAATCTAAACCTTTTGCATGGTGTTTTCCTCTTGACCCCAGTATAGTTTTCCT
TAGGCAATCTTTGAAAGCAGATTCAAAAAGCTGCAGGTAAAAAAACTGTGTGTTTAGGAT
TAAAAGCACAGCATGCTTACTTGCAGCTAAGTAGTAATGAGTATGTTAGCCGGAGATGAC
ATCCCAACTGTCCATTAATTCATGTAATTTGAATTGCTTGAATTTTTGTCACCAGTGCCA
TAGGTCAGTTTAGTAAAATTGAAATATCCTGATTTTCCTGTAACTGTGGGGTTTTTTTTG
GTATGTGGAAATGTGAAATTGTACTCAAGAAGGGCACTGCGGACAATCAGACTGCCACCT
CTCTTTCAAGTATCAGATGTGGGTGTTTCCTACTGGAATTGTTTGATTTGACTTTGATGT
ACCAATTTTCTGTTGATGAATAATTGTCTGTGTGCTGATAAATTGGGGGAGTCAAGTACA
GTCTGGTAGTAGTCTGTGAATGGCACATTTGGTTCCTGCAATCCGGAGCATCTGATTTAT
GACTTCCTTTCATTTCATTCAGTAAACTTGTCAATTAGCTGCATTTGAAAAGTGATTTTT
GATTAGTGCAATCAGTAAACATGAAGTCTTTTCTTTGATTGCCACACTGATTAGATAAAT
TGTCACTTGAGAACCTATTGGTGAAGTCAGTGTATGTGGCCTTATGTCTCTCAGTAATGC
CTCAAGGTTTTAAAAAACAAAGAAAAATATTAACTGCCATATTTCCTCTCCTTTCTATAT
CTCTTTGAAGTGCCATTCACTCCCTCTGATTTTTTCCCCCCACCTCCTATTGATCTTTTG
CAAACTCATTATTCATATGGCAGGAGACACTTCTGCTTGTGAACCCTTCCTGAGCTTCAT
ATATGGTTTGAAATCCCAATATGGAACAGGAATGGTGTCCGATCTGATTAACTTGTACCG
AGACCAGCGCCAAAACAGAGTTTGACATATAATAAGAGCCTAACAAATACCATAAAAAAG
GTTTGATTAGAAATAGTCATAAAATTATCTTTGGTTCTCTCAACGATGTATCTGAAAATG
TTAAAATTCCCAGGTAATTATGGAAATGTTTAGATTTGAAAAATAAATTGTTCTAATGTA
GAGGAAGAGAAAGGCAGACAGTAGGTGGGAAATTTCATTCTATATAAGAACAGCAGTGGT
TTTGGGAGTTGGAAAAATGAATAAATTAGGTATATGCATTACGATCTTCATTATACTACC
TAAATGGGTTCTGGGTGTGTTTTAGCAGGTGTTTTGCTAGTAAACTGTATTTGGGTTTTT
TTGTTTGTTTTTTAATTGTATTTTTGAAGGGCATATGTAATCAAGCACTCTTCTAAATAC
CGGTGTAGATACAAAATAGGTTGGACACAGTCCCTGTCCTCCATGGGGCTCACATTCTAA
TCAAACAGAGGAAGATTTAATTCCCATTTTACAGTTAAGATAACTGAGGTTCCGAGAAGT
TAAGTGACATGCCAGTAACACAGCAGACAAGTGGCTGAGCTGAAATAAGGATTCTGGTCT
TCTGACTCCCAAGCCTGTGCTCTTTTCACTAGGCCACACTGCTTCTGCTGTGATTTTAAG
TAAGTTGCAAGTATTTCCCCATTCACAAGAAGGAAAAATGGTTAATTGCACACTAGAGAT
CTTAGTTATAAGATTACTGTATATAGTGGAACTTTGAATTACAGTGATACCTCATTTTGT
CTTTGGTATTTGCTTAATTGCTTAATACCTTGAATTCTTTCATTCAGTTGTATTTATTGA
GAGCTTGCCTTGCACAAAGCACTTGGGAGAGTACAATATAACAGACATATTCCCTGCCCA
CATGAGCAAATTATTAATAAACCAAGAAAATACTTTTTCAATTAAAATGTTCTTACTCCA
TTCCCCTTTCCTTTTAATCTTCCCTCCACCCCAGCCCCATATTGAAATTACTTCTGAACT
GCAGAAGTAATTCTTCTCCTTTCTGATTTAAGGAGCTTCAGAGTACTCTGGGTCTCCCTT
GGCCTCTTATTGCTAGTGGTCTGCCATAGCCCTAACCCCATACATTTAGTAGATAGAAAT
GCTATGGAGACAAAGTCATGGCTGAGTGAAATTGATAAGTCTATAAAAAAAAATCTGGTG
GCAAAATCCCTTCAATCTTCTGTCTTGAAGTTAGCATTTTGTCATTTTCTGGCAATGTTG
AGAAACTGCCCTGAATTAAATTCATTATGGATTTTGGAGGGCAAATGCGTTTCTCCCAAG
CCTCCCCTAATTCATGTGATTATAACTTGCCTTCCAAGGGAGTCTCAAACTGATGGTTTT
CTGATTTCTTTTCACATTTTGAGATCTAAGGTGTTGGGTTGACAAGGTTGGGTGTGAATA
CTCTCATATCTGTATTAATATTTTTATGAGTTTGCTTTAATGGAAGGACCAATTTCAGTT
GAAGGCTTACTGAAATTTCTGATCAGGATTGGACTAATAATCATAGTGGCTACTGAACCA
ATTCCAATGTTGACTGACTTTTTTTATGGCATTTTTTAACCAAACTAATCAGGATGGACA
CATAGTCCATATTCCCCATGGGGTGCTCAGTCTTAATCCCCATTTTATGGTTGAGGCAAT
TTAATCACTGAGAAGTGAAATGACTTGCCCAAGGTCACATAACTGACACATAGCAGAGCT
AGGAGTAGAACTCAGGTCCTTCTGACTCCCAGGCCTCTGTTCTAGCCCTTAGGCCATACT
ACCTCAACTTTGACAGTCATCCTTCAGGAACCACCCTCTTTATGTGCCTCTACTGTGTTT
CTTAAACCTTTATTTCCTGAGTCACCCAAGAAGGAAGGAGTTGAAAATAACACTCTTTTT
TAAGGAAACTTCAAGTCTGACTTTGTTTGCATCCCAGTTCTCAGCAGTTAGCTTGTTCCC
AGTGAAAAAGCAGAGGAAACCACTCTCCAGGTAATTTAGTATGCGTGGCCGGGTTTTAAG
TTGGAAGGAAGCCCAGAACAAAAGTAGCAGAACTGTTGCCCATTCGAATGAATGTGGACT
GGCTCCTGCCTTGTTCTAGTGGTGATTTTCTTCTGCGAGACCATCAGTTTTACTGATTTA
TTTTACTTTTTTTTAAGGCTCCACCCAAAATACAGTGGAGCTTCAAAGGTCCTATCAGGA
CTCACTTGGGCTCTCTGAGGAAAGCCCCCCAAAGCTGCATAATCTAAAAGACCATTTGAG
AAAGTGCTCTATTTTATATTAGGGTTCAAACTGTGAACCTGACTTAATTCCTCTGCGCAT
GTTGTCCTTGTGTATTGGCAGTTTTAACAGGGTGTTACTGTCTTACCACAATGTACTCAT
TAGGCAACTTCTGGAACCAGCTGTTTTAATTAGGCCACACTTAAAACACCATTGAAGATC
ATCAAAGATGTCACTGAAACTGAAGCTTTTGATTGATAGACAATTTGCTAAGTGCTGTGA
ACTGGCCAGGGGGCTATTGATTAGTTGTTTCTTTCATCCTGTTTACTGGTCAATTTATTT
AGAAGAACAGCAGTCATTTAATTGTGTGTCTTGTTAAAGCAATGTTGCTGTTACATCTTT
GTAGCAGGGTTGGAGTTTGACTACAAGAGAACAATGGAAAAGTGGGTGGTCCTTTCATTA
CCATTTCTCACTGCACTGCCTGGGGTTGAAGGAGATTTTGCCAAATTCCCTTTCTCTCCT
TTTCTGTAGTGAGAGCAAGGTACCCGCTTCCTTTCAACAGTCTAAAATTGAGAGTTTCCC
TTCACCAAACTCGTTTTGTTCCCCATTGAGAGTCTTGTGGAGTAACCCGGACTTAACCGA
AATCTGGGAAGTTAAGTTTTGTTTTTCCTCTTTGCTAAACACAACTCCAAAGGTTTTTCC
TCAGTATGTTTGTGCTGGCATTCAGATTTAAATGATTTTTAATGTGGGATTAAAAATGGC
ATTAAGCATATCGAACCATCTTTATTTCAGCAGTGATTTCATTGCCCTTTAGAATTTCTT
AATTGCATATTTCCTGCTTTTTCTGTGGTCTTTCAAGCTTTCTCCCAGGTTTTACATTAA
CATAGGCAATAGTTTGATGGGTTTTAAGGTCCTGATGTGAGACTTCTTCCCTTTTGTTTT
ACAGATATGAGACCCCAAGACTCCTGGCGAGGACCTACTCCCCTATTCCAGCAGCAACAA
CGGTTCGACAGGTAATAATGGTATAGACTTGTAGAGAGCTTTCCCACAGAAGTAGCTATT
TATTTGTTGGGCTATAAAGAGAAGATTGCAGGGGCGTGCATTCCATTTTCAGTTTTCTTC
CAGACGGAATAATGGCGTAGGTTTTGAGAAAATGGAGTCTTGAAAAATACCATTTCTGTT
AAACTCAAATCTAGTGGCTACTGTTGATTCTTGACTACCTTTCTGGGTTCTTGGCCTTGA
TTTTATTGGAGCTTTTGAAATACCATGAAATTCAACACAGAGAGCTTAAAACTGCATTAG
GTTTTGGACAGGCTAAACAAATTTCTTTTTAGGAGGGTTGTGGGACTTAATGAGGCATAA
CTAATAGTGTTCCACTTTTATCATTTCTGTGCTGGCACCACAGCATTAGTACAGACCAGC
CATTGATTCTTGCTACAAACCTCTTGAAGTCCTAATCAGCTTCTTTGGTACAACTTTTTC
AGAACTGACAAGCCTATTGTGGGCCAGTGTCACTGTAGGTCAGTAGTTATTAGTTGCCAC
TGAAAACAGTTTCTTTAACTACTTAAGACTGAACTGAATTAAATGCAGAAGGGACTCAGA
AGAGGATTATGGAATCTGCAGGCCAATAAGTACCATGGAATAGAAAGAATGTGACATGGT
TTAATAATAAGGGATGTTTTACATGGGTTCCTTCATTGAGGAGCTGGTGCCCTTAAGTCA
GACAGACTCTACAAAGGAATATATATCTGTGAATGTTATGAATAATTATATTAATATGCT
TAGAAACACTTAAGTACGGCTGTAATGCGGATCGTTTCTGCCTTTCTTTAACAGCATGTG
GTATTCCGGTCCAATTCCCAATTTACTTGACACATTTGGAATCTGGAATCTTGTTGTATC
AAATAAGTAACCAGGATTTTTACATCGTACTCAGGTTTCATCATGGCAAATTAGGGCCAC
ACTTAGGTAATGAAACTGCTGTGGTGTAATAAACACTAAAAATTTGGCATTTTGTTTTGT
GTATTTTCAGAACTGGAAGAAAACATTTTATTGAGGGCAACGGGCTTTACCAGCACCAAC
TGTACTGGTCATCCCATTTTTAAAATGTAGTGGTGGTAATGCTGTGCATTGGTATTTATC
TTCCATAAAGCTTAGAAATCTTTAACAAATGCCTCCCAGCCCTCAGGGAGAAGTCAGTCA
ATCATATCTACTGAGTGCTTACTGTGTGCAGAGCACCATACTAAGCACTTGAGAGAGTAC
AACAGTACAGAATTGATAGGCACAGTTCCCTGCCCACAATGAGCTCACAGCCTAGAGGAA
AAAAAGAAGGGCAGATATTTCCCCTTCTCATAAATTGATTATGATTGTTACCAAAACATG
GTTGGGTGAAAGCATTCTGCTAGATCTCAGGGGATATTCTTGAGCGAATAAACCAGATTA
CTTAATCTGTGTGACCGTGGCAAATACACCTATTTCCTTCTCTTACCCATTATCCATCCT
TGCTTTAGGCAGTCCTCCATCCCTCCTTACCTTTCAAATGACCATTTCCTATTCAGTGTA
ACAAACCTCTTCCTTCTCTGCCATAAAGCGCCACTGAATTTCACTTCTTCCAGGAAACCT
TTCCTCAGCACCTTCATTACCATCCCCAGTTAGCTGCTATCCAATAGGAGATCATTGCGC
CTTTTCTCCATTGTATTCTTTCATGAGCCCAGAACTTCCCCTCAGCCTAATTCACTTCGT
ACTCCCAGTGTGTGGGTGGAAGAGGGGGACACAATACTATAATAATAATAATAATAATAA
TGTTGGTATTTGTTAAGCACTTATGTGCAGAGCACTGTTCTACGTGCTGGGGTAGACACA
GGGTAATCAGGTTGTCCCATGTGAGGCTCACAGTCTTAATCCCCATTTTACAGATGAGGT
AACTGAGGCACAGAGAAGTTAAGTGACTTGCCCACAGTCACACAGCTGACAAGTGGCAGA
GCTGGGATTCGAACCCATGACCTCTGACTCCCAAGCCCGTTCTCTGTCCACTTTACAGGG
CACCTAGTATCAATACTCTGGAATGGGACAGAGAGGTCGGATGTGTGGACACTGAGCCAT
TAGAACCCGAGTCGAAGGATTTTGATTGTAGAATGACAAAACCAGGCCCAACTGGGAATG
TGAAAATAGTGTGGAGGACTGCTGCTGGGAAAGAGCAGGAACACAGCTACACAAAACTAT
TATCCAAATCTTGATTAGAAGACAGGTGGGTGTAGGGCTGGGTTTGGTTATTCTGTCTCG
ATATCCATGGACAGACTACAAGCCCCCCATATTTATCCTGCTCCGCAAAGAGTCAGTTAT
ATTGTAGCACATGGTGCCTTCACCCCTACAGCACCCTGGACATCCTTGAGTGTTAAAGTT
GATTCTGAACCATCAACCAATCAGTGAGTGGGATTCATTGAACATATGTGCCAGGGACTG
TACTAGACCCTTGGGAAAGCATAATTCAGTAAAGTTGATACAAATGTACCTTGCACACAA
AGAGAAGCAGGCTGGCTAGGTGGCTACAGCATGGATCTGGGAGTCAGAAGGACCTGGGTT
CTAATCCTGGCTCCTCCACCTCTCTGTTGTGAGAACTGGGCAAGTCACTTCACTTTTCTG
TGCTTATTACTTCATCTATTAAATGGGGATTAAGACTCTGAGCCCCATGTGGAATAGGAA
CTGTGTCCAACCTGATTAGCTTGTATCTGCCCCAGCAGTTAATACAGTGCCTGGCACATA
GTAAGTGCTTAGTAAATCCCAGGAAAAAAAAGGAGCTTGGAAACTCACATCCAGGTTCTC
CCATCAGGAAACTATTGTAGCATGGCATAGTCTTGACGTTACCACCTCTCCTTTGCACCT
ACTTTCAAGATTGGCACCTACTTGGGTCCAGCTGTATACTCTGTTGGCCTTCCATCACCT
TAACTTTATCTACAGGCCTTTCACCCTACATTTAAACCATACAGTTCCTCCCCCTTATCC
AAAATAGACTAGCACATATTCAGTTTTGCAGTAAAATTCTAATCTGAAATTCAGGAAACC
CAGTGGTAATGTTCCTCTGACGACTGGAATGCTGCCCCTTAGCTATATACAGTTTTCAGT
AAGATCAGTTAAGTTGTTTTGCATCACCTAAACACTTATGTACTCACAACTCTGCACGGG
ACATATGAATATATGCATTAATCTTATATACTCTTGTTACTTCCTCCTTTCTGTAATTTA
CCTTAGCATCTGCCCCTCCCCACTGATTTTTAAACTCCATCTACTAATACTGTTGTCCTC
TCTTTCACCTTTAGTAGAGGGATTGATTTTTATCTACCTCTATGTCTGGTGCTGCAGTTG
TAAATCAAGTGGGCGGGCACAGGAGAGATTGAGAGGTGTCATGTCACCTTAAAATTTACA
AATTACCGAATCCTTTAAATGGCCATTGGTTTGCTCATTGTTAACGACACATGAGGTCAT
TAAAGGGGAAAGCTGCATGCTTCCAATTCTGTTTGGTCAGAGAATTACTGTACATTGCCA
GCCAGTTGTCAAAGAACAGCATCCTGGAGACTTGGCTATTTTGGAGAACCTTCCTTAGGA
TTGTGGTCATGGCGGTGAACTGCCAGAATAATTGGCAATTTTAAGTCCAAGATCTTTTTT
AGTTACTTAAAGCTTCAAAATCTATTTATCAGTTTTATTTAAAAGGCTTGTTCATGATGT
GAGAACATCTGAATTAGCTGTTTAAACTCCATCCCTGTAGAAATATCCCAAGGCAAGATC
CAATTTAACAGTGTTTCCAAGTTGAGTAAAATATTGGCAGCAAGCTAGGGAGGTTAGACT
GGAAATGCTTTTAAACTGACATGCCTACCCAAATAATTTTTATGCCATAAGAGTTTTGGA
GACTTTTCCAGGAAACAGATTTCTAAGATTGCTTGTGCTAACCAAGTGCCCAACTCGATA
TGATAGAAATCTTACTCTCTGGCTTCTGCAGAGAGATGAAGCTGTTACTGATGGGGCATA
ATAGATGTACTACAGAAAGATGATGCTTTCTTGCTCTAACGTGTTAAATTTGAGACCAAA
ATCAACTGGAAAAAAATTGAACTCAAGAACCGCTTTAAATCTGAGCATTTTGTGGCTTTG
GGAAGTAAATCTCACCTGCAGGTTTTAAACTACATGAAGCAGTTTGCTATACAGTAGTCA
TTAGTTGAACTCATGCCCTTTTCTTTTCCTCCCACGAGAAATCATCAATCATCCCTTAGC
GTTCTCTAGTAAGTAGAACGGCCCAGCTCCAGTGCTAAAGTAGGTTTAGCAAAGGGTGAG
GGGAACACTTTCCTTTTCAGAACCGAGCACCCGGTTGGTTGAAAAATAATATTTTCACCT
AATAAAACCCTGTGCTTGGGTTTTCAAGACATGGAAAGTGAAGTGCTTACGGCAAATGTC
AGATAAAAGGTCCAGTGAAGAGCTTTCTCCATAGCACTTGGAGAGATGCCTAGGGTCCCC
AGAATTAGAGTTTTCTTTGGCTGCAGAGATCACCCTGCTAATGGTAAGACTCAGTGGGTT
TCAGATTCTTGCTTTATCCCCTTCTACAGGTCCTGAGTTACAGAAGAATTTAAGAACAAG
CGGGGATGTGACTTTTTTTGTGGGTGACTTATTGCATAACCCCCAAAAGAGAACTGCAGC
TTGTTTACTGACAATATATGGGCAGACCTAGATTCCTAATACTCTTTTTCTTCCCTTGAT
ACTTTAATATTAAATGTTTGAGGTGGATTTTGATTGAGCGAAAAATGCTGTGAACGACTA
AAGCATCAAAGGGAAAGTCATACTTTAAAGAATGCTTGGCCCTAGAGGCTATATCACTGC
AATATCATTATTGCGAATATTTCCAATCAAGGAACAATTTAATGTATTATACTTTTCACT
TTATCTTTTTTGCAAGGCTAGAATAGGTCCTTGAAATCAATTAAAACATTTCTTTCTGCT
AGTAATGTGGGATGACAAACTAGGTTATAATAGTTGTTGAATTTGTGTTCCCATATAAAC
TGTACACCAAATGTCACTCAGTCCATGCCAATTAGTGCTTATGTTGCTAGGTCACCGTGG
TCAATTGAAAGCTGCATCAATAGAACTTGAAAAGGTTTCTTCCCGATCAGACCTTCTGAC
ATATTGAGCAGAATAATGGATGGGAAAAACAGCCGAGGCCCCTACCCTAGATTCAGAATA
CTCACAGTAAGAATTCATTTGCAACCTGCAATTAGCTAGAGAGAAAAGACTCCCAGAAGG
AGTCTGGACGTTTAGAAAATAAAGCCTCATTCGGCCGGGTGGCACATGTTTGCGCTTCAG
ATGGGGCCAGGGATTCTGCTACCGTAGTGATGTTTGCTCCTAAATCCAGATGACAGGCTG
TTGCAAACTGGTTTTTAGATGGGCCCGAGCATTTTTGAAAGGTCAGAAGAACTGAATGAC
TCCATTGAGTTTTGACACCTGCTATTTTCACTTTCTCTATGTTTGTGGGTATAAAACACA
ATCGCAGTGGCTGACGAAAGAGTTGTTGGGGGAAATAGCCTTGGTCGTGGCGACTCCCCT
GTCGCCGTATTCTTGTTTCCAAACCTGTTTCCGCTGGCATTCATTGCTGTCTCCAGACTT
GTCGCGTGAAAGGAAAGCTGACCTGGTGTCTCACCCTAACAAACCTCTTTTCCCAAAGGG
GGGGTGGAGCTGAGCCTCTGCTGCCATGGAACCGTATGTTGCAATCCCAGAATGCAGCCT
TCCAACAGAATCAGTACCAGCTCCTCTCGGGACAAGGCGGATACCCCCCTCGGAGAGATG
ACCGAGGAGGGAGGCAGGTAAAGTCCCGCCGACTGATCGGCCACTGATAACTCAACATGC
CTAAATGCCTTCCTCCGCGGGTCTCGCTGACCCTTTCTGGGTCCATTTGTTGGCATTGGG
AATCCCTAGGGAGTGGTCGTTTCATTGAATCAGGAAGGCTGAAGTCAAACAAAAGCTCAC
TGTTGTCGCAGCCCAAGTCACCCTGGAAATACTAGGGAAGGAGTCTGCCAAACTTAAAAG
TACCCCACTCTGCGAGGGGGAAGTGACTTGGTGTTGTCCCTCACAATAAGGCGCAAAAAA
TCACCTTCAGAGGGGGTCCTTTTAAGCAGGACCTTCAGTGCTAAATGGTATTCCAACACG
TCCTTGCAGCCTGGCCTGGTGGCAGGTGGGGGAAGGGGAGCAGAAGTGACTCCGCTGAAT
ATGTCATCGCTCTCGGGTGCCAAGACAGGGAATTCCAGGCTGGCACTTCCAGCTGGATCT
CCTCCCACTCCTTACTTCTCCCCTGAAAGAACCACCTCACTCCCTCTCCTGCCCTCTACT
GTGATTTGATCTGTCTTCAAAAGGGTTTTCTCAACCTCGGTGAGAGTGGGTAATTTCTGG
GCTATGCAAAACTTTGTCAACTAGTCCAGTCCAGCATCTTTCCCATGTCCAGTTGTTTCA
GTGCAAAGTGAGCCAGTGTCCATTGCTTGATCCCCCAATAAGAATCTGTGATTGCCAGTG
AACATTCAAGAGAGAGGGAGGAAAATATATATATTGGGTGAGACCAGGGAAAGTCATAGA
TTGTGAGATTGAAGTGATTTCCCTGGAGGTGGGCCACAGGTCTGGGTGTTAGCTGTAGTT
TGCTAGCAAATGTCTTAATGCTGTTTTCTAGCTTCATTTGGGGTTTTGTTTGAAGGTTGA
TGGTTTGGGGCTGTGCTTCCTTTTTAAAGCTGTCCACAGGGCCTTTATCCCTCCAGACCT
CCTTCGATGAGAATGACCACTTAATTAGCAAAATGATTTCCATTAACATATGCCAGCTAA
AAGGATTTCTCACAGCAGTGCAGTAAAATGTTTTCTAGAAATTCAGCTTGAAGAAGATCA
GGTAACAGGGCAGGGCATAGGAAAATCAGCCTTCTGGGAAAGCCTCACTGGCTCTGCAGT
TCCAGTGGGCCAGGAGAGCTGCCATGCTGCTTTTTCCTCTTTTGCAGGTGTACAGATATC
CACCATTAAAGTCAGGAGATTCACTGTCAGGCTTGTGGGATCAGGGCATTGGTGCACAGA
AATTTTCAAAATCCTCATGGCCTGAAAGGGCCACTAATCTATGGGGGCAGGGTCCTGCAT
GGAGTAGAAATACGGTGATGATTGTTTACAGAACCGTCTTTCAGTGGTTCGGAAAGAATA
GAGTATAAAATAGATGTGTGTGTTTAGTAGAAGGCTAAATGTTTCATTAGCCATTTCAGA
GCAAAGTATTAAGAAGGGGAATGTGATTTTTTTTCCCCACACTGCCCCCCCCCTCCAGCT
AAATGCCCCATCTCAGTAAAAGTTTTGTTCAAAAACCTGGCCACCTTTGGTCTTCCACCT
TTGAATCACAGGAAGAGCTCCAAACTATTTCCCCAGTAATTGACTAGGTCAGATAAGCAA
TGTTAATAGATATGTTGTAGATAGAAAGTAGCTGTGAAGAGGACCAGTGAAGTGATCTGT
ATGTGTGAAGAAATAGCGATTAGGACACATTTCTTGGTTCAGTCCCATAAATAATTTTTT
TTTCTATGGAAGAGTAAAGTGAGACTTCTTTCTTTAAAGAACTTTTTGTGTAGATTGTGC
AGGTGTCTGTAACAGACTACTAGCTGATGTCAAATGGGTGCATTTCAGACAGCTAGTTTA
ATGTCAAAGGTTGCTCTGAAAATCTTGACTTTGAGTGCAAAGGGTTACGGAAACCACATT
TTCAAAATCAACCATAAATTAATTAGGTGTTTGGAATGATTACATTTATTGTAGCATCCT
CCCTAAAGAGTAAACCAAAGGTTTTTCCAAACTCCTTAAGTAAAAGCTAAAGCACATGTA
TTGAGGAGATCCTTTGTAAACAGGCTTCAGAACATAGTGAGCTTTCTTTAGTAGGACACT
AAGTAAATGCCGTATTGTTTCTTCTCTATTTCATAGAGCTGTAAAGTTAAGTTAATTTGT
TTGCGGGGGGTAGTTAATCCAGAAAATAAACTTTTCCTTTTGTTTATTTCTCAGGCATAT
GGCTCGGGAAGGAATTACTCTCTGCCACCTCCCTCAGGAAGATATAGTTGGAATTAGGGG
CTTGAAGAGCTTTCCCAGATCCACCCTTTCATCCGCCTGCGACTTTTTGCTCCCTGTGGA
TTCAAGCATATCTAGAAAGCAGTAGTTTTTAAAACTCTGATACTTGTCGTATTTGTTTTA
ACTGTATATTTCTTACTGGTATACTTTTCAGTGTTTTTATGTTGCCTTTAAACGGTGTGT
TCCGCTATCCAATGAATCTGAATTTATTACTTTGCTTGTGAGAAACATTTGATGAGGTGG
GAGTATTTTTGTTACTGTAGTTGAGAATCGAACAGGATTGCTGTGAATTTCAAGCACAGC
ATCCTCTGGATCATGAGGACCCCTCTCATACATGCTGTTTTTGATGAGTGAACAAAATTA
GGTTTGAAAACTTAGTGGACACTGCAACCAGCCTAGAAAAATACATTTTTGAGAAGCTTT
TCTTTAGTATTCCTTTAGGAACACTTCACTGATGTACCAGACCTATGAAGTTTTCATTTC
TGGACTTTAGTAAAAAAAAAAAAAAAAAAAAAAAAAAAAGAATTTTATATTTGTGTTGTG
TTTTTGTTCATTTTTATAACATCTTCCCCCATCCTCCTTTTCGTCAGATTCTTAAATGGG
AAATCTTTGAAAAAAATTATTCAGCCCCACAATTACATGCAATAAACTCAACCAAGTTAA
GGTACAGACTAATTCATGGTTATGGTAGTAACAGCATTCCTCATTAGTGTATATTTCACG
GTGTAGGAAATATTGAATACTGGCTTGATTCTGAAATGCTTGAAAATGTGAGAAGTGATT
TATTATACTTTTTTAAAGTATCTGTATTCTTTCCTATAAATGTTTTGGCATACTTTTAAT
GTGTCGGAAGCTATTTTGGGAAATCTCCTGTGCCCCAGTTTTTTTCATAAGTTTATGTTT
GCTTCATACCCTTAAGGGAAAGTTGAGATTTTTATGCTCCCTGAGCATATTATGGATTTC
TCTGAAATAGATTATGAGCTTTCCATTTGAGTTGCACATTTTCCTAGGGTTTTATTGTTT
CATAACATACAAACATTGAAATTCAGTCATTGTTGGGTTTTTTAATTTTTTTACAAAAAA
TAAATTATTGTAGTCCTTTGTTGCTTTAAGTTTCCTTTTTTCCATACTCGTGAGAGGTAA
AAAAAAAGAGAGAGAGAGAGAGAGAGAGAGAGCTTCCCTGGGCCATCTTGAATGGGCATT
GTAGCTGCAGGCTGCTTTAAAATCCAAATGTAAATCCCAGCGAGTAAGAAAAGAAACTCC
AGCACCTCTTCTCTGGGGGAAGGGGATTACTTGAAACTGGCCTCATTATTACTTGCAAGT
GATGGCTGAGAGTAGTCCAGGATGTGTGTTTTCATTATGCATTTTGGATAGAGTGCTGTA
AAGAATTAGAAAATGTTCTTCCAACAGTGCAAGTCTCTGGATACAGCACAGTGTGGTTTC
TAATCAGTCAATTGAATCAGTAGTATTTGAGTGCTTACCTTGTGCAGAGCACTCTATCAC
TACTTGATAGAGAACAGTGGAGTAAATCTAGTGGGGAGAGAGACAGTAAAATAAAATAGA
GGCAACTGAGTAAAAGGATATGTACATGAGTGCTGCAGGGAAGGGGACATTTTTTAAACA
AACTTGTGTATATTGGTGTGATGTCGAACTTGGAGCTAGAGTACTGCATTGTGAGTTTTC
GCTAATAATGATGGATGGTATTAAGTGCTTACCAGTTGCTAAACTCTGGGACAGGTGTGG
AATAATCTAATCAGATTCGGTGCCTGTCCCAAATGGGCCTCCTAGTCTATGAAGGGGGGA
GAGCAGGAATCTCTATCCCCATTTTATGTGTTAGTGGAGTCACTAGGAGTCAGAAACGAC
TCAACAGCAGAAAAGTCAAACCTGTGGCCCAGAGAGGTTAAGGCATCTTACTTAGCTCTG
GCAGAGCTGGGAGTAGAGACTCTAGAGTCCTGGCTCCCAGGCCCATGCTCTTTTTACTAG
GCCACACGACCTCCTTACCTTGCAAAAACACAAACTCCATGTTTTAGCACTAGGCCTATT
GGATAGAGCACAAGCCTGGGAGTTAGAAGGACCTGGATTCTAATCCCAGCTCCGCCA
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1075, 14195..14322, 14409..14520, 15144..15255, 17783..17841, 17919..18008, 19786..19858, 19960..20010, 20537..20694, 21278..21352, 21450..21583, 21673..21730, 21816..21923, 26830..26874, 28003..28134, 31515..31633, 33833..33968, 35497..35604, 35686..35775, 36378..36450, 41290..41373, 43774..43871, 43953..44032, 45276..45332, 54934..55002, 55095..55226, 58847..58974, 66364..66430, 72118..72256, 74454..75616
1001..1075, 14195..14322, 14409..14520, 15144..15255, 17783..17841, 17919..18008, 19786..19858, 19960..20010, 20537..20694, 21278..21352, 21450..21583, 21673..21730, 21816..21923, 26830..26874, 28003..28134, 31515..31633, 33833..33968, 35497..35604, 35686..35775, 36378..36450, 41290..41373, 43774..43871, 43953..44032, 45276..45332, 54934..55002, 55095..55226, 58847..58974, 66364..66430, 72118..72256, 74454..74516
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved