Ornithorhynchus_anatinus Locus Mono:SNORA47
snOPY snoRNA Orthological Gene Database
Ornithorhynchus_anatinus Mono:SNORA47
Ornithorhynchus_anatinus
Mono:SNORA47
1
SNORA47
1001..1136
2136
TATCTTAGAGCGGGGTGGGGGAGGTGTTTTGGAATTGGAAACTGAAGGGATTTCTCCTG
CAGCAGAGTTAAAACAAATCTGTTTTGTCTTGGCTTGCTCCAAAGATAGATTCAAGAGCT
CTAGGTTAAACAGAAAACAAAACCATAGTGAAAGTGAATACTTGGGAGCTTTCCTCAGGC
AAGTTGGCCCTAAATTGAGAAGCAGCATGGAGTAGTGGATAGAGCACAGGCTTGGGAGTC
AGAGGGTCATGGGTTCTAATCCTAGCTCCACCGTTTGTCTGCTCTGTGACCTTGGGCAAG
TCACTTAACTTCTCTGGGCTTCAGTTACCTCATCTATAAAAAATGGGGATTAAGAGTGTG
AGCCCAATTTGGGACAGAGACTGTGTACAACCTGATTAACTTGTATCTACCTCAGTGTTT
AGAACAGTGCTTGGCACATAGTAAGCGCTTACAAATACCGTAATAATAATAATTATTTCA
GATTCCAGAAAATACTGCAGTCAGATGCAGCCTGGGCCAGCAGAGGTGGATTTGGGGGTC
TCTGGATGATTTCAAAGAGAGCAACTGGAGAATGATTCAAGGTAAGGGACAAAAATGTAA
AAATGTCTCAGACCCCCTGGTCTTTCAAAATTACTCAAATTCCATTTGGCTAAGAATGGT
TTTCTCAGCTGACGGTTCAGGCTACACCCCCGAGGCTGGGGAAGGGATTGTGCCTGGTGA
CTGTGTGGCTTACTAGTTAGTCTTCCTCCTGGATCCTTATGGCGAGCTTTCCTAGCCATT
ACACTCACCCCAGCCCCTCCCTGCTTGGCTCGTCTCTGGACCAAACCACCCTTTTCTTTC
TTTACAATGAGCAACTGTGACTTCAGAATCTAATGGGGGAACTTAGATTCTGTACTTCTG
GAAAACTTTGGCTAATACCTTTCTTTTTTCACCATCTTCCCTCCAACTTAAGCTAATAAA
TCCCAGAAGTACGATCGTAGCTTGAGCAACACGGATGTTCTTGGAGGACTGAGAAGGTAA
GGCAGTTTCTCTACCATGCTGCCTCTTACTGGTTAGAGCCTCCTACATTAAATCGCAAAA
GCATCTCACGTGCCTCCTGTGAATTGGGAGGGACCTTACTGCATTTGCACACATCATAGA
GAAGCAGCATGGCTCAGTGGAAAGAGCCCGGGCTTGGGAGTCAGAGATCATGGGTCTGAA
TCCCGGCTCTGCCACTTGTCAGCTGTGTGACTGTGGGCAAGTCACTTAACTTCTCTGGGC
CTGTGACCTCATCTGTAAAATGGGGATGAAGACTGCGAGCCTCACATGGGACAACCTGAT
TACCCTATATCTCCCCCAGTGCTTAGAACAGTGCTCTGCATATAGTAAGCGCTTAACAAA
TACCAACATTATTATCTGTGGCCTGGTATCTACGTGTAGTTTCCTTGGTCTTGATGAATC
ATTCTTGGAGAGTGATTGAAATAATCCTTAGTGATCTAGTCCGCAGTGCTCAGGGCTGCC
CTTGTTTTCTAAAATGCTTTATTTTATACAGTAATTGTTTGTGCTTATTTCACAAAAATC
TCTTTTAAATGTCCTTTCTTTCACCTCCCCACATGGAGCCAGGTTGAGACTTGGGCCTCT
ATGGCCGAAGATACCAGAATGAGTCTCGCTGCTCCCCTTTGTCTGCCCACCCTGAATACC
TCGGATCAAATCCTGACAGCGTAAGAAGCCCTTCCCTATACAGAGGTTCCTCCCTGCACA
CGGCCAGATTCCCAGGGCAAGAAAATCTGCCAGGGATTGAATTTGCTGTAGCCCTTCTCC
CTGCCGGAGGGTGAGAGGCTGCAGAACTCTTCCCTAGCACTTTGGTTTCCCAACTCACTG
CTTTTCAGATCCTCCTGACTAACGTTACAACCACCACCTGCAGTAAAGGCATGGGAACTG
CAAAGATGCAGGTGAAGTCAAAACTAGACTGTCAGCTCCTTGTGGGCAGGAAATGTGCCT
ACCAACTCTATTACATTGTCTTCTCCCAAGCACTTAGTACGGGGCTCTGCATACAGTAAG
CACTCAATAGATACATAACATGGTCTAGTGGATAGAGCGGGGGCCTGGAAATCTGAAGGA
CATGGATTCTAATTCTGACTCCCTGCTATGTGACCTT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved