Ornithorhynchus_anatinus Locus ENSOANG00000020641
snOPY snoRNA Orthological Gene Database
Ornithorhynchus_anatinus ENSOANG00000020641
Ornithorhynchus_anatinus
ENSOANG00000020641
1
SNORA7
99262..99413
104231
TAAGATTGTGTTGTGTGTAGAATTCATGCTCAGTTAGTAGATTGTCTAGAGAAATGTTT
GTGTGCGTGAGCATGGAGTTAGTCAAAGTGAGACTGCTATGACACCAGTTTTGCTTAATG
CAGGGTTCATTCAAAATAAACTTTCCTTGATAGAACATGGTTTACTGAAAGCAACTGGGA
AAATGTAGTTGTCTATTAAGTGACAGTAGCAGGAATCGGCGGTTCATCGAACAGAGGCGG
GTGTTCGTCGTCTGTGGCCAGACTGGAAGATCTTATCACCCAGTCAAAAATCTCATCTAG
TTTCCAGCAATTTCCAGACGACATGTATAAATTCTGTTGCCTTTTCGCTTGATGGCAACT
TGTATTTTTAATGGTATTAATAAATGTGTTTTATTAATATTAATTTAATGGTATCGATTA
GTGTATTTTTAATGAATAATGTTGTTTACTAAGTGCTCGCTATGTGCCAGGCACTGTACT
AAGCACTGGGGTAGATGCAAGATAATCACTCATTCGTTCAATAGTATTTATCGAGCGCTC
ACTATGCGCAGAGCACTGTACTAAGCGCTTGGAATGGACAATCCCCGTCCAGTGACGGGT
TCGCAGTCTAAACGGGGGAGACAGCAAAGCGAAACAGAACAAAAAATCATGTCGGGTTAG
ACACAGTCCCTGTCGTACATGGGCCCCACAGTCTTAATTCCCATTGTATAGAGGGGATAA
CTGAGTCACAGAGAAGTTTAATGACCTGAGCAAGGTCACATGGAAGATAAATGGTGGAGC
TGGGATTAGAACCCAAGACCTTTGACATCCAGGCCCGTACCCTTTCCACTAGGCCACACT
GCTTGGTTGCTAACTGTGCGTGCTGTTAAGCAACGGGTGTTTTTGTCCGCCTGTCTCCCC
CGATTAGACTGTAAACCCGTCAGGGGGCAAGGACTGTCTCTATCTGTTATCGGTTGGTCC
ATTCCAAGCGCTCAGTCCAGCGCTCTGCACATAGGAAGCGCTCAATAAAGACGACTGCAG
GAATGATGGAATATGTGTCGCCCAACTGTGCATTCCGAGCGCTCAGGGCAGTGCTCCGCA
CCCCCGTAAGCGCTCAGTCAATAGGGTGGAAGGAAGGAAGGAAGGAATGAGTGAATGAGT
GAGTGCCGGGCCGAAGGGGTGCGGGCCGGGCGGCGGCCGGGGCGCATGCGCGGACGCGGC
GGCTCCCAGGGTGCTCGGCGGCCGGCGGCGGGAGGTAGGTGTGGNNNNNNNNNNTTTTAT
ATTAAATCCTTATTTTTTGGTTAATTGAAGGTTGTTACAATCCCCCTGCATGGTAATTTT
TTCATGATTATGTTGTCTTGCTTTTGTCCGTCTCTCTCCCCCGATTAGACTGCGAGCCCG
TCATCGGGCAGGGATTGTCTCTGTCTGTTGCCGAATTGTACATTCCAAGCGCTTAGTACA
GTGCTCTGCCCATAGTAAGCGCTCAATAAATACTATTGAATGAATGAATGAGTTTGCTAG
ATCATCATCTTCTGTATTCTGCAGCCCGATCCATGTTTAACCTGAGGGATGTTCAGGTAT
GAATGGGGCATTGCCCTCCATATTTCACACGTTTCCCAACACTCTTTTCCACCTTCAGCC
AGGACCACGGAATGCTCATTTGATGTGATTTAGATGACTGTAGAGTGCCACTAGTTAGTC
CAAGGCTGTGGGACGTGGGGAAGACTAAACACTACCTGATTCAAACTGCTACTGATCATC
TAGATGTAAGTCACGGAGCTCAGAACTGGGTTAGGGTTGAGAAAGGTGTTGAGATGAGGA
AGTAGAGTCATTGGTATGAGTTGGTCTAAGCCGGAGGTTACTTGTACTAGAAGCTCTTTC
AGTCAATCAATCGTATTTATTGAGCGCTTAGTGTGTGCAGAGCGCTGTATTAAGCACGTG
GGAGAATATAGCAAAATAACAGGCACGTTTCCTGCTCAAAATGAGCTTCAGGAATATTAA
CAATCAGGCCGCACTTCAGCAAGCTTCCCATGATTGCTTGAGCTGCAAATTCATCTCATT
GACCAGCATAATCTTCAAGATAATCTCCAAGATGGCGAGCATCTACTCTTATGTAAGGCC
CACAGGCATAAAAGTCCATGGTCTCATGCGGTCCAGATCTCAGAAGATGATCCCATATTT
GGAAACATTCTAATAATAATAGTAATGTTGGTATTTGTTAAGCGCTTACTATGTGCAGAG
CACTGTTCTAAGCGCTGGGGGAGATACAGGGTAACCAGGTTGTCCCATGTGAGGCTCACA
GTCTTAATCCCAATTTTACAGATGAGGTAACTGAGGCACAGAGAAGTTAAGTGACTTGTC
CAAAGTCACACAGCTGAGGAGTGGCGGAGCTGGGATTCGAACCCATGACCTCCCAAGCCT
GGGCTCTTTCCACCTGTCTACCTAACGCTACTGAACTCTCCCTAGTGCTTAGTACAATAC
TCTGCCACAGTAAATGCTCAATGAGTACCATTGATGAATTAACTGCAAATACACTCAGTT
TTACCATAAGGTCCTACCTATAATCTATTTTAGTGTCTCCCCCAGTAACGTAAGCTCCTT
GAGGGAAGATATCACATGCGCTAACTCTTACACTCTTCCAAGTGTTAAGATTGTGTTGTG
TGTAGAATTCATGCTCAGTTAGTAGATTGTCTAGAGAAATGTTTGTGTGCGTGAGCATGG
AGTTAGTCAAAGTGAGACTGCTATGACACCAGTTTTGCTTTAATGCAGGGATTCATTCAA
AAATAAACTTTCCTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNCCTTCTCTCCTCTTTTCTCCCTCTCCCCTTCTCCCCTTTTCCTTCTCCCTCT
CTTCCTTCTCCCTCTCCCCTCTCCTCTTCTCCCCCTACCCTCTTTTCTCCCTCTACCCTC
TTCCTTCTCCCTCCCCCCTCTTTTCTCCTTCTCCCCTCTTCTTCCACCCTCTTCCCTTCT
CCCCTCCTTTCTCCCTGTCCCCCTTTCCCCCCTTCCTTCCCCTTCTTCCCCCCCCTCCTT
CTCCCTCTCTCCCCTTCCTTCTCCCTCTCCCCCTTCCATCCCCCTCCACCCCCTTCCTTC
CCCCTCTCCTCCTCTTGTTTCTCCCCCCGCCCCCTTTTCTCCCTCTGCCTTCTTCCCCTC
CGCCGATCTTTCTCCCTCACTCCTTCTCTCCCTGGTTTTCTCCACTACTCCTTCTTGGCA
GACGGAACTCCTTCTCCTCTTCTCTCCCCTGATTTCATCCACTACCCTACTCTTTTGACT
ATCCCGAGCCCTTCCCATTACCACCTCCTCCCTCTTTTTTTCTTCTTCCTAAATCTCTAC
TTTCTAGATATTCAACCTAATGAGTATATGCGTACGCTACTAACAACAAAATAAACTCAC
CTCTGCTGACTCTCCCTACACCCTGATTTGATGTCTGCAAAAGCAGAGCCCCTGCTGATT
GCAAATGCACCACGCACGTATGGAAGATGGGCGTAACAAGGAAGAGAGAGTATAGGGAAG
AGAAGTTACGCGAAATGTGTACATGAAGCTGAGTCTCATCGAGGAATAGAANNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNTTAAGCACTTACTATATGCAAAAGCACTGTTTAAGTGCTGGGGTAGATACAGGGT
ATCAGGGTGTCCCATGTGAGGCTCACAGTCTTAATCCCCATTTTATAGATGAGGTAACTG
AGGCACAGAGAAGTTAAGTTACTTCCTCTCATTATTCTCCCCCTCTTCCTCCCTCCCTCC
CCCCTGGCTTGTGCGAGAGGGAGCTGGATCCCTGGTCTTGGAGAGAGAGAGGGAGGGAGT
GGGGTGGGGGGAAGAGAAAACTAAGGAGAGGGGAGAGTGTTAAAGGAAGGGGACAGGAAA
AGGGAAAGATTGAGGGTTGGAGGGGGTCGAGGGAGGGGAAGTTTGGAGCGAGAAGATTGG
GGTGGGGAAAGGGGAGTGGGCAGCATTGAGGGCCAAAGGATCATTTTTACCACAATTGCC
AGGGAGAAAAGGAATGGAGTTCAAACCGTTCAGGGTAGTGGAATCAGGATTTCTTGCTTC
TCTGCCTTCCCTTGACCTACTTAGCTGGGGAACCCTGGGATTAATATCAGTATGCAAGTA
CTCAAAATGTCTGGGACATTCACGGGGCATTTTCCCAGGAGAAGTTTAGAATAATCCAAA
ACATCGAGATAAAAAAAGCGAGCATTTCTGCAACACGTGGATTACATTCTTGGCAAACCG
TCCCTTAAGGAAAAAATGCCTTGTAGTACTCATCCCGTATCTGATGCTCTGTGCGTGCAC
ACAACTGTTGCTGTTGACCTCTCGCCTCCGTGATCCGTTCAGTCAGATGTCTGTTGGTGG
ATGAGTTCCGTCATCCTGCCGTCAATCGTTCCTACCTTAATTCGGTGCATTGCTTATTTT
TTATGATTTATGTGAACAATTAAGGTGGGCATGTATTTTAAACCCACCAGGCATTTTTAT
TATAAGAGAAATCCGTAAAAAACTGTGGTCACTATAAGCTTCAGGCAAAGGACCCTGTTA
GATGATGGGTGGTTGGTGGGGTGGAGGATGGGGAGAGAAACTGTGGAGGCAAGAACAGTG
TTAGGTTGGGAGGGGAGGCACCTCAAGAGTTTGCATCAATCACTCAGTTTATTGCATTTT
TTTAATGGTATTAAGTGCTTACTATATATCAGGTGCCATTCCAAGCACTGGGCAAATACA
AGTTAATCAGGCTGGGTACAGTCCCTCTCTCAAATGGGGGTTACAGTCTAAGTAAGAGGG
AGTTCCTTGTGTATAATCAGGGAATGTGTCTGCTAATTCGGGTTTTATTGTACTCTCCCA
AAGCACTTAGAACACGCTCTGCGCATATACCATATGCAAATACCAATGATTGATTATTGA
ATTCTTGCTGTGTGCAGAGCACCCAACCTACTTAAGAGAGTCCAATATAATAGTTGGGTA
GAACATGTTCCGTGCCCCCAAGGAAGCCTTTTGTGTGATGTGTTGGGTGGGNNNNNNNNN
NCGCTCTGCGCATATACCATATGCAAATACCAATGATTGATTATTGAATTCTTGCTGTGT
GCAGAGCACCAACTACTTAGAGAGTCCAATATAATAGTTGGTAGACATGTTCCCTGCCCC
AAGGAGCTTTTGTGTGTGTGTTGGTGGGAGAGAGGGGGATTTTGAGGGAATAGAGGCTGC
CCTCCCTCTCTTCCTCCTTCACCTCTTGCCTTCTCCTTCCCTCTAACCTTTTCCATTGTT
CCCACCCATTTCCAAAATTCCCTCAGTTGGATTCTCCTAGTAGCAGATTGATAAGAAGCC
AACTCGTTGAGGGCAGGAATCACGTCTACCGACTCATACTGTATTCTCCCATGTGCCCTT
TACCCACACTGTGTGCTCAATAAAAATCACTGATTGATTGAAGTTCTTGAATCATGCACA
GCAGTTTATAGGAACCAGTAAATTATTTTTGGCAAGTGAATTGGCTGCCATATTAATCCT
CTCAGATATGTTTTTTTTATGGTATGTTTTAAGCGCTTCTTATGTGCCAAGCACCGTACT
AAGCGCTGGGGAAGAATCAAGTTAATCAGGTTGGACACAGTCCATGTCTCCAATGGGGTT
CACAGTCTTAATCCCCATGTTGCAGATGAGGTAACTGAGATACAGAAAAGTTATTTGCCC
AAGAGCTTAGAACGCAAGTCCTTCCGACTTTCAGGCCCATCTTCTATCCACTAGGCCATG
ATGCTTCTCTTGGTAGTAATTTTCTGCCCTCTTGAAATTGGCAGTTCTCTAGGTCCATCT
CTGGCCTTGCGAGCCACTTCTTTTCCCCTCTCCAAGAGAATAATCTATTCGGATAGGAGC
TGGGCCCGTTGGTCTGGCCACTTTTTCCCCCTCTCCAAGAGAAAAATCTATGCAGACAGG
AGCTGGGCCCATTGGTCCACATGAGTAGCAGACGGGGTATATCCATGATGACTGCTTTGG
TGATTTTACCCTCATCCTGGCCCTTCCTCCTACAGCAGATTGTACCTTCATTCCTGGGAT
CAAGGAAATGTCTGTTAATGGGAGGGAAAGAGCTCAATTTGTGGTCATGGCCAAAAGTTC
TTTAGAAAACAGGAAGTTCGTTGGCAAGAGATAATGGCAAAGTGGGTGAAGAATAAATGA
AACCTAAAACGCTTTGGTTGCTCTCTCATCGTTAATGACATGTCAGGTGTTAATGTTGGG
GTAGCGAGACTATTTTGGATTAAGTGCATAATCTCTGGCTAGATAATTTATTTTTAAACT
CTGCCTTTTAGTTGGTGCTCAGGGAAAAGTTAAATATTTTCCAACTGGTAAAATCAGTTG
ATTCCCAATAGAGCCACTTTGAGGACCGAAATTGTGCTAATTCCTATATCATTTGAATGG
AGCTTTTCCTTCTAGTAATGTTTTTCTGGAAAAACCACACACACCAAGAAGCAGTAAGAA
AAGTTTATATACTAACATTTTCTAGGAAGTGGTTCGCATCCATATGGTGATCAAATACAT
TCATTGGTTTGTAAGCGAATAAAGAAGCAAAATATACATTGTTAATCACATTTCTATAAA
TGACTTGACATCCTGTGAAAGTTGAGACTTTTATTTAAAATCTAATCTGTTTTTGTCCTT
TCCTCAGTCTAGATACACATTGATTTTTGTGTGTTTGTTTTTTTAGTTTCATAAACAGAA
ATAGAAAAGGCCAAAAGTAATAGAAAAAGTCCTTTGCTGATATTGAAAAAAAGATCCTAT
AGAGCTACTAATTAAAAGAGCGACTTAATTATATGCATACATTAGGTTAGTTTGCCCTGG
GGTTCTTTTCCCGAAGAGATTCAGCCTCAGGAAAAACTGGGTACCTTTCCTCCCTATACT
CCCTCTCCCTGTTACGCTATTTTCCACAAGTGGGGGGGCATTTGCACTCAGGAAGGCGCT
GCTTTTGCAGACATTTAATCTGGGTCTTTGCTGAGTCAGCAGAGGTGATTTTGTTTTGTT
TTTAATGGCGTACCCATTTACTCCTTAGGTTAAGTATCTAGAAATTAGAGATTTGGAACA
AAGAAAAATGTCTGGATTCCCTAGTTCTGGTCTCAGCTCGGTCTCGTCCTTGATGTGTGG
TGGTAGGTAAAATCAGGCATTTCCTGAGCCAGAGGGTTTCCATCTGCCAAGGAAGAATAG
TCGTACTTGCCATTTACCTCTTTATTCGTACGTGAAGATCAGCAGAGTGATGGGTTTGCA
TCATTATTTCTGAACCTCGGGTTGCAATAATAAAATGCATTATTAGTATGGTTACTCTGT
TATTATTACTATTATTCTTGGGTAATCCACAACGTCATCTTGTAAAAGAGAGTTCCAAGG
TTCTAATTTGGACTATGAATAATAAAAAGTAAAGGAAGGCTCAAAAGGTTTTGAGACTTC
TGAAAACTGCTTAGTACTGTATTTTGCACACAGTAAGAACTCAATCAATACTACTGATTG
ATTGCATATTCAAATTATTGTATTTTGTTTTGATGTGTAATACATTTGAATATTCATGTA
CTCAAACCCTACACAGAGAAACAACCATTCTTAAACCCATCTATTTTAATAAGGTAAGAT
TTGAGTAGAGATGAAAATGTCATTTAATTGACTTGACTGATTTGGCAATCAAGACCCAGA
TTCTTAAATTCCGGTTTGTTTTTTAATCTTAAAAAACCTGGATTCTGCAAAAAGCATTTT
CAAACGTAGCTCGTCTCTTAAACAACAGAAAAGATATTCAACTAAAAATGAATTTGATCG
GTCCATTCGGAGCTACCACCTTACTAGTATGGCTAAGATTACTGTTGTTGCAATGAAATG
ACAAACTCCAAGTAATAATGTTACCTACATTTATCATTTTCCGCCTTAAGTGGTCATACT
TTAATATTCATTGGCCAGATCTTCCATATTTGATCCCTGTTTCATATTTGGTTCATGAAT
TTTGAAGTGTGCATGCATCTGTTAAAAGCAAATATATGGGCAGAGAAATTCCCAGAGGAA
AATTAATAGCAGGTGGTATTCATTTTTCACATTATTACATTAAAGGAAAGCTCTTTGTAT
TCTGTTCGCATTCCATTAGGTGTCCCAGGAAAGAAAACAGTCAAGGCAACATTTTACTAG
GTTTTTCTCTGAACTCTTATTTTTTTTCTGTTTTTTGTACCGATTTTATTTTCCTAACAG
TGGAATAATTGAAACTCCAAAAATAGGGTCTCGAGGGCCGTTGGCTCACTGGGAAGACTA
CCGCTCTGGGAATCAGGAGACCTGGCGTTCTGCGTCCAGCTGGCTAACGTGGACAAAGAT
CGTCTTCACGCCTCGTCGTAATGCAGCCCCGTTCACCTCCTCGCTTGTTGCACTCTGTAT
TCCAGTGGGAACGTGACTTGATGGGGACAATCAATCAATCAATCAATGATATGTGTGCAG
AGTACTTTTCTAAGAGCTTGGGAGCGTACAAACAGAAACTCCTAACCATTGGCTTTGAGA
CACTCAATCACCTCAATACGTCTGTGGCACCTCAATCTGTGACCTCCCCAAGAGTATTCT
CCCCAACCTCACGACACTCGTCTACCGATCTTTAAATCTTATATTATAAATTACTTATAT
TAACGTCTGTCTCCCCCTCTGTAAGCTTATGGACAGGGGATGTGTCAGCTAATTCTTTTG
TATTGTACTCTTCCAAGTGCTTAGTACAGAGCCCTGCACGTAGTAAGTGCTCAAATAATA
ATAATCGATTAATGGATTGAATCAGCTCTCCCCTGAGCCTTATCATGAGCTGATCTGCTG
CATCCCAACCCGCACGCTCTGGTCCTCTAATGCCAACCTACTACTCGATCTTGCCTATCC
CACACCAACTCCTTGATCCCCTTCCTCGGTGGGGACTGGCACTCCTTCCCCCTTCCTAGC
TGATGGTCTCCCCACTTCAAAGCTCCCTAAAATACACTTCTCCAAGAGCCTTCTCTGACT
GAGCTCTCATTTCCCCTATCTGTCCTCCCCTCTGAGTTATAATAATAATGATGTTAAGCG
CTTACTATGGGCCACGCACTCTTCTAAGCGCTGGGGTAGATACAAGGTAATGACGTCGTC
CCACATGGGGCTCACAGTTTCCTTCCCTGGTGTACAGATGAGGTAACTGAGGCACAGAGA
AGTGAAGTGACTTGCCCAAGGGCACAAAGCATACAGGGTGGAGCCGGGATTAGAACCCCA
GCCCTCTGACTTCCAAGCCCCCGCTCTTTCCACTAAGCCATGCTGCTTCTCTGCGCACTT
GACTGGGTACCCAGTTTGCTATTCACTCCAACATTTTTAGCACTTCTATAAATATCCCCA
TACTCTAATATTTCCCTTATCTCTAATTTATTTTTATGTCTGTCTCCCCCTGCCTACTGT
AAACTCCTTTTGGGCAGGGATGGTGGCTCCCAATTCTGTTGAACCTTCCCAAGTGCTTAG
CACAGTGCTCTGCACACAGTGCTCAGTAAATATTGTGGATGCAATTCATTGTCATATTAA
GCGCTTACAGTGTGCAGAGCACTGTACTAAGCGCTTGGGAAAGTACAATAAAACAGTGAA
AAGTGACATTCCCTGCCCACAGTGAGTTCGCTGTCTACAATAGAGTTGGCAGACTCTATC
CAAGGGAATGGCTATGCTAGCTCGAACCTCTTCCCAGGGCTTAGTACAGCTCTCTGCACA
CAGTAAGCACTCAATAAATACGACTGACTGGGCCAAAAGGAGCTCATAGCCAAGAGGGGG
AGGTGGACATTAAAGTAAATCGGATCATCAATTAATCCATTGAATTTATTGAGCCTTTAC
TATGTGCAGGGCGATGTACTAAGCGCTGCACTGTACTAAGAGTACTAGAGAATTAGCATA
ACAAGCTTACAGTCTAGAGGGGAGACAGAAATTAACACAAATCAATAATTATAGTATATA
ATTTAGAGAAGCAGCGTGGCTCAATGGAAAGAGCCCGGGCTTGGGAGTCAGAGGTCATGG
GTTCGAATCCTGGATCGACCACTTGACAGCTGTGTGACTGTGGGCAACTCACTTAACTTT
TCTGTGCCCCAGTTACCTCATCTGTAAAATGGGGATTAACTGTGAACCTCATGTGGGACA
GCCTGATTACCCTGTATCTACCCCAACACTTAGAACAGTGCTCTGCACATAGTGAGTGCT
TAACAAATACCAACATTATCATTATTATTATTAATTAATGTGGGACTGGAGGTTGGGGGA
AAATCAAACGTTCAAAGGTCACAGATCCAAGTGCATAGGTGATGCAGAAGGAAGAGAGAG
GGAAAATAGTGGAGCATAAGGATATGTACATGAGTGATGCCGGGATGGGGTGAATATCAC
GTACTTGAACGGCACTGCAGAAGCCACAAGAACCCTAAGCAATTCCCGGAGCAGATTTGG
GGTCCAAAGTTTCAGGAAACTCCATCATTATCATCACAGGATGTTATGTATTTAAGAGAT
AACTGTGATTATCCAAAAGATTTTTTTGCCAAGCTCTCGTCCGAGTGGTCAGAATTCTGT
TCATTGTCGATTCTGCTTTGAATATTAAAATTTCCTTTTTTTCTTTCCAGATCTCCATTA
TCATGGAAGCAGAAGGAGAGTTCTTGGGAGAAAAGAAGTTCAAGCAGTGTTGTGCAGATT
TTATTAAACACTCCCAGAAGATAGGTGACGGATGGGAGTGGAAGCACTTAAAGGTATGAA
CAGAAATCGGTTTAGGTAAGACTTAAGGCTAGGTTGTCCATAGAACAGTGAATGTTAAAA
GACAATCTTGCTATCATTTATTCTTTCTGGGAAGTTCACCTCCATTTTTAACTTAATTAA
AAAAGAAATAACTAAAGTGATGATAAATTATATTTAGTTGGATCGTTTTGTATGTATGCA
CTTATAATCGATATCATCCCCTAATGAAAGACGTTTAAAATACTCCTGATAAGCATGTTA
ACCTCATACAAGGAGTAAGGAAAGCCTGGGCCCTGGATATGGTTTGCTAGCATTCAAGTA
AGTGTTGGATGCCATGTTTGTTTTGTCTGGGGCCCTAATAGAGTACCCTGCACCCAGTGG
GGTTCAGTAAATGCTATCGCTACTACGACATGGGTCAATGCCCAGGCAAATGTCCCAATT
CTGTCCTCTGAGGCAAGTCTGGTAAGGGCCAAGATAAGTAGAGAAAGGTGTGTGATTCAA
TCTGGATGGGCCGGGCTGGGTCAGCTCCGGGCCATAGGGCACCCGGGAGGTCACATCTGT
ACCGGGGTTGGTCAATGGGCCCAACTAACCTGGACATGTTCTAGGGGAGACGTGAATCCA
GGAGTTGGCCATTTCCTCTGACCTCCCGGGGAGTGGACCCATCTCTGGGCTTTCTTGGAA
CACGCCACCAAACACAAACATCTCACCAATTCCATACCTACACTTATTTCTCCTAGCAAA
TTATTGAAATAGCGTGAATAACTTCAATTTCATTGAGCTGGAGGCTGCTCTCCATTTGTG
CGCTGGCTACAAGACTGCCTTCAGCGGGTAGCAGGGAGGGATCCTGTGCACCAACTCTAT
TATACGGTATTCTCCCAAGTGGAATCCACCACNNNNNNNNNNAGGGATCCTGTGCACCAG
CTCTATTTATAACGGTATTCTCCCAAAGTGCTTGGTACCCAGTTCTGCACCTAGGAAGCG
CTCAATAAATACGATTGATGATTATTGCAGAATCCCAGCTGAGAGGGCAGCCAACAGCCC
CAGGTTGTTGATTCACTTGAGCTGCATTTGGATGCTTCCCCAGCCCGGGCAATTGGTTCC
TGCATTTATGCCACCCAAAAGATGCTTCCACTGCTTAGGGAATGAGCAGAGCGGCTGGAC
CTGGTTCCGGGGAGCCATCTCCGGGTTCGTCTCTCTTACTCCGTTGCGGGGTGTCTGAAG
CTCAGTCCCCTGGAGTGAGGAGGGACCGGGTGAAAGAGGGAAAGTCGGATTGCCCTTCTT
GGACTGTGGGCCTGGGGATTTGAGCAAAGTGAAGTCTGCTGTGGTATTTGCCTCCTGGCA
GTCGTTTTACTATGGATTTCCAGTTTGGTTCCCTCTCTGATCAGGCACAATCCCTGAAAA
AAGTACCTGATGCTTCGAGCGGCATCCTTCCCTCTACAAAACAACTAACAATTTCCAGAA
ACAGGGCATCCCAGTCTGTCTGGATGCAAAATTGTGGCTTTAACACATATTTTCCCTTAG
GCAGTTTGCCCATATGGAATCGCTGAGAGGGAGTGAAGCCAAAATGATTTCCAGCTGATG
TCAGGAAACTGTAGAAAATATTCTGTATAGATGTTTCCTAGGAGAGTATCAGAATTCATT
TTAAGCAATGCCTTTTTTATATCAGCTTATTTTTCTTAGAGACCTCTTGCACACAGTGAC
TTGTGCCCATCCTATTTTGAAATCTTGGGCAAACTCCTTGTAGACAGTCACCTTAATGGG
GCCTCGCAGAAAGATATTGAAAATTTCTTATCTTTAAAACACTTTTGCCAGTCTGCAAAA
TTCGCAATGCCCACCTGCCTGAGTCTGTGATTGTTATTGCAGTTGCACACCTGATGTCAT
TGAGCATCATAAGTCTGGAGTTTTATTTTAATTCTTACATTGTCTACTGTCTCCTCTCTT
TAATCCCTAGTTTAATTTCCTTCAATTCCTGAGCCTGTTGAGTTGTGATAATTTGCACAG
CTTTTTTTTTTTTTTAGTTTCCTGAAAGACAGAATATTCCTGGGTTGTAAACAAAAGTCA
GTAATTGTATTTCTAGTCCCATCTCTGTTGCGGACTTCGTGTCGATAACGTGGGGAATTT
GCTACCTCTTTGTTTAGATTCTTGAGCCAGAAAATGGAGGTGATCACATTTAGCAGTAGG
ATGACATAATGGTGAAAGATAATTAAAATATTTTATGAGTAGAGCATAATCAGTAAACTC
TACAAGAATAAAATAAATCATAGTGCCAATATACAAGCTGATGAATAGAGAGAAAAAAGA
GCAGATGTCTCCAGATGGAACAGGCTTAGCTGCAGAGGTAAATAACCCACCCCCTAACTG
TGGGGGTCCCTCGAGGTTCAGTCCTGGGTCCTCTTCTGTTCTCTGTCTACACTCATTCCC
TTGGAGAACTCATTTGCTCCCTTGGCTTCGTCTTTGTACAGATGATACCCAAATCTACAT
CTCCTCCCCTGATCTCTCTCCTTCTCTCCAGCTCGCATCTCCCACCTTCAAGACATCTCT
ACTTGGATGTCCTCCCGTCACCTCAAACTTAACGTGTCTAAAACAGAGCTCCTTATCGTC
CAATCCCAAACCCTGACCTCTCCCTCACTTTCACGTCACTGTAGACGACACCACCATCCT
TCCCATCTCACAAGCTTGTAACCTTTGCATTATTCTTGAGTCCTCTCTTTCATTCGACCC
ACATATTCAGCATCACCAAATCCTGTTTAAAATCCACCCTTTCCTTTCCATCCAAACTGG
TACCACGTTAATACAGTCACTCATCCTATCCCGCCTAGATTATCGCATCAGCCTCCTTGC
TGACCTCCCATCCTCCTGTCTCTCCCCACTCCAGTCCATACTTCACGCCGCTGCTCGGAT
CATCTTTCTACAAAAACGTTCAGGACATGTCAGCCTCCTCCCCCTCCCCCCCTTTCAAAA
ATCTCCAGTGGGTGCTTATCCACCTCTGTATCAAACAAAAATTCCTCCCCATTGGTTTTA
AAGCAGTCCATCACCCTGCCCCCTCCTACCTCACCTCACTTCTCTCCTTCTACAACCCAG
CCTGCATACTTCGCTCCTCTGGTGCTAACCTTCTCATTGCGCTCCTATCTCACCTCCGAC
CCCTGGCCCGTGTCCTGCCTCTGGCCTGAAGCTCCTCAGATCTGACACATTCTCCCCCTT
CTTCAAAGCCTCATTGAAGGCACATCTCCTCCAAGAGACCTTCCCGGGCTAAGCCCCACT
TTTCCTCACCTCCCACTCCCTTCTGCGTCACCCTGACTTGCTCCCTCTGCTCTCCCTGCC
CCCTCACCCCACAACACTTATGGATATAGCTGTAATTTTATTTGTTTAAATTGATGTCTG
CCTCCCCACCCCTAGACTGTGAGCTCATTGTGGACAGGGATTATCACTGTTTAATAATAA
TAATAATAATAATAATGGCATTTGGTAAGTGCTTACTATGTGCAAAGCACTGTTCTAAGC
GCTGGAGAGGATACAAGTGATCAAGTTGTCCCACGTGGGGCTCACAGTCTTAAACCCCAT
TTTACAGATGAGGTAACAACTTCTCCACGCCTCAGTGACTTGCCCAAAGTCACACAGCTG
ACAAGCGGCGGAGTTGGGATTAGAACTCATGACCTCTGTCTCCCAAGCCCAGGGCTCTTT
CCACTGAGCCACGCTGCGTACTTTCTCAAGGGCTTAGTACAGTGCTCTGCACACAGTAAG
CGCTTAGTAAATATTATTGAATAGGAAAATTATGATTGAATACTTAAAGGACTCTCACAG
TGTTTAGTACAGTGCCCTGCACACAGTAAGCCCTAAATCCATATTATTATCACAACTGTT
ATTTTTGCCTCTAGATTGTAAGCTTCTTGTGGGCAGGGAACATGTCTACCTATTCTGTTC
TCTTGTACTCGCCCAAGTCCCTAGTACCGTGGTCTGCACACAGTGAGTGTTCAATAAATA
TGATTGATTACTAAAAATGAAGGAATGGGATGAGAGTTGCTTCTATTACCCTTTCTTCAC
CCTTCTAAATTTCAAATACCTCCCTGCCCTGAAACAAGCTAAGCCCCCTAAAATCGAATG
CTTTGGAATGGAAAAATAATAAATCACTCCATTAACCCTTTCCTTTACCTCTTTGATCAT
ACCTCTCCCTATTTTTCTCTGCATTTTTCTCTAATTGATCCTCTTAAAGGCCCCCTTTTA
GATGCAGGGGTAAGAGGCGCTGAAGGCGTTTAGTTACACCTGTGGAAGGGCTTCCCTTCA
AGCGGCTATTTTTTATGTGTAACTGAAATCGCTTGTGGCAGTTTGTACCCATAACTCACT
GTGGATGGATAGAGAGAAAAACTAGGTAGTGCCTCCTCCTTTGAGTTGACCCTGTTGGGA
CATACTCAGTTAAAGAGTGCGGAGAGGAAGAAGAGCCAGGAGAAGAAGTTGAATGATGGA
CAAAGTAGAAAGAAAGGTGAGGTGAAAGTGATGGGGGAGATACCCAGACCCTTGATCCCC
GATTCACTCCATCGCTTGTCTTCCTCCCCTCCTTTGACTCTTTGTCCTAGCAGAGAGGGG
AGGGATGGGACATATAGAAGCACATGTGAGAAGCACGTAAGAAGCAGCGTGGCTTAGTGG
AAAGAGCCTGGACTTGTGAGTCAGAGGACGTGGGTCTAATCCCAGCTCCACCACCTGACT
GCTCTGTGACCTTGGGTAAGCCACTTAACTTCTCTGTGCCTCAGTTACCTCATCTGTAAA
ATGGGGATTAAGACTGTGAGCCTCATGTGGGACAACCTGATTACCTTATATCTCCCCCAG
CGCTTAGAACAGTGCTTGGAACATAGGTGCTTAAATACCATAATAATAATTATTATTGGT
GAGGAACATTTGGTTCCAGGGCTTAGGGAAGGGCTAGGAGATTAGGGTCAGGTTAGCGGA
AAGAGCTCCGGCCTCGGAATCAGAGGATCTGGCTTCCGATCCTGGCTCTGCCGCTTATGT
GATGTGTGACCTTGGAAAAGTCACTTCACTTCTCTGGGTCTCAGTTCCCTCTAGTCTGTA
AGCTTGTTGTGGGCAGGGGACACGTCCACCGACTCTGTTATATTGAATTCTCTCAAGCAC
TGAATACAGTGCTCTGCACAAGGTAAGTGTTCAATAAATAAGATTGGTTGATTGATTGTA
AAGTGGGAAATAAATCCTCACTCCGATTTAGATCGTGAGCCCCGTGTGAGACAGTCTGTG
CTCGACCTGATGATCTTGTCTGTACAGGACCTGGCACATAGTAAGCCCTGAATGAGAGCT
ATTAAGAAAAAAAAAAGTATAGTTTTGGTGAAACCAATGCCAGAGGAAGTCTAAGAGAAG
GAAATTGCCCACAGCACCAAAGGTAACTGAAAGGTTGAAGAGGCTTAAGACAGAGCAGAG
TTCATTAGATTTTGTCATAAAGAAGTCACTGCAAATCCTGAAGGGCACAGTCTTGGTAGA
ATGAAGAGGACAAAACCTGGATTGCAAGGAGTCAAGAAGGAGTTGATAGAGAGAAGTAGA
GGGAGTGGGCATATCCAACCCTTTCAAGTTGTTTATACAGGAATGGATTGGTGCAGTGAG
GTTGAGTATAAGAAAAACTTGGGTGTATTTAAAGGCTTAGGGAAAGAGTCAGGGGAGAGT
ATGAAGGAATTGTATTTATTTTATTTTCTTAGTGCCGGATCTATTAAGTGGATTGTCAAA
AATAAGGTTTTCACTTAATTCTGGACAGACTAGTTTTATTCTGATAAATGGCATCATCTA
TTGTGACCCTAATTTTCATCTCTGTCACCTCTCATTTGGGAGTGCATATTTTCGATCAGA
AAAATTTTCAGATAATCCAGTTTGATAGTCAAAGATGGAACCAATAAATGAAAAATTTTA
AATTTCACTCTGCTGTTATGTTATTATCTATTCACTAGACTGTAGTGAATTTTATTGAGC
AAAAGGGAATTTTCCCACTTAAATTTTTCTTAGTATGTGTAGGTGAGGGTGATGGTAATA
TTTTGGGGGAGAGAGAGAGAGAGAGAGCAAGAGTAGTGTGGGTGTCAAATGTAAAGATCA
CCAAAGTAACAGAAACTGCAAATTGGGCTTTGTGAAAAAAGATGGTAGCCTAAAAGACTA
ATTAATAAACTTTGAACTTAGAAAACTTGATTTTTATTGTATTTGTATTTGTTTCTGCTT
GACTTATTGTATAAAGCATTAATCTCCCAGTCAGTAAAATCCTTTGGGGAGAAGCTGAAT
AGGCATCTCTTCCTACAGTTGTGTAATTCTTATGAATCTGTAACACAATATGGAGCTCCA
GACTTCAAGAGAACAAAACCAAATAAGCCTCTATCTATTCTTCCTTTAACGAGGCTAAAG
AAAAGGAATGTGTTTGGTTAATCTTGGTGGGGAAGAGGAAATTTAACCCGGAGCAACAGT
CGAAAACATGCTGTACTACTAAACATTTAATCCTAGTTGGTTACATTTGGCTTCTCATTC
ATAATTTATTGAATGTAGTGAAATGATTCATCCCTTTAGTATATGTGAATTTTTACTAGT
TATTTCAGGAAGAACAGATTGTGTCATTTATGAATTAGATACTTCTGAACATCATGACTT
TTTAGACCATTGACAGTGGATTTAGGGATGAATAGTTACAGTTTTTTTTTTAAAGACACA
TTTCCTTGTGGGGGCAGGCAAAATATTAGGCTCAGAATTACAAAGCACCCTTTCTTTAAG
GTAACCTTAGATTTCAGTCAAAGGGTATGTTTATGAGGGGTTTATTCAGTACAGAATGAT
GCTGTGACTTTCTATCGGGAATTCAATACTTGGGTAAAAGTTTGAACTCTCTGTGAAAGG
GAAAGCCTTCGTTGGAAATAGTGGAATGAACCAGATTTTTGTTCTCACAACTAAAAGAAA
AAAAATTTACCATTTTTTAACGAGCCATCTTGGCGACTCTGAGATTCCAAGTCACGATTA
AAAACTAGGTCACTATTCAGTGGCTTCATTTATATGAGGCACATCTGGGAGAGAAAAGTT
TTCTTGAAATAAATTAGTGTATCAAAGGCCATCTGGAAATATTTCATGCTCTGTGTGTTT
TTATTGATAGTGTGATGTTGTCTACCTACCACGATTAAGGATATGGTTTTTGTTTAAAAT
TATTATTTAATCCTTTCTAGAGTGATACTAAGAACTAGCTTGGTATACAGAATACAGAAT
CACTGTTATGTCCAACAGATATTTATTGGGGATCTACTGCGAGTAAAATCTCATTGTGGG
CAGGGAACGTGCCTACTAACTCAGCAATATTGTACTTTCCCCCGCACGTAGTATAGTGGT
CTGCACTCAGTAAGTGCTCAATAAATATGATTGATTGTTTATCACACAGGAGATGCAAAG
AGAGTTTACAGAGTATGCATAAAAACCTCCCAACTGTTGACCAGGGGCTTATGAAAAAGA
AAAGAAGTAGGATTGCTAGATGTTTCCAGGCAATTTGCGCTAATCAGAAATGTATGATTT
CTGGATTTTAAATACATCCTTCGTCCTCTGATGCAGTGGTCTGAGTAGCATCTGTTAATT
CCTAAAGTTGCTTATCCAGTGACATCTATTTCTTGATTCTATTTATCTTGATTCTATTTA
TTTGCTATTGTTTTAATGAGATGTTCTTCCCTTTGATTCTATTTATTGCTATTGTTCTTG
TCTCCCCCGATTAGACTGTGAGCCCGTCAAAGGGCAGGGACTGTCTCTATCTGTTACCGA
TTTGTACATTCTAAGCGCTTAGTACAGTGCTCTGCACATAGTAAGTGCTCAATAAATACT
ATTGAATGAATGAATTTCTCTATCCTGTTCAGTACCCATCCTTCTACCTAAGGATCTTCT
CCCCTACTGGAAGCTTCAGCTTTAGATGACCCAGCTGGATGTGGGTAATTTTTTCAATAA
GTTGTCAGAAGTAGATCACTGAATATTATCTCGGGGTTGATGTCGCTTTTTAACCTCTTT
TAGTTTTACTTCAACCTCTAAGTATAAGGGGTTGAGAAACTCAGGCCTTTTTCCTTAGAT
ACCATTTCTTAACTTCACATATAAGGAAATCTGGCAATGAATTTGAACCAAATCAGAATA
CAAAATGAAATAAAAGCCGATGTGGTAGGTTAGTCATCTGAAGTTGATCTCTATGTAGGT
ACCATTCATTCATTCAATAGTATTTATTGAGTGCTTAATATGTGCAGAGCACTGTACTAA
GCGCTTGGAATGTACAATTCGGCAACAGATAGAGACAATCCCTGCCCAGTAATGGGCTCA
CAGAGACATGAATTCAGGGTAATCTGGTCATGCAATATTTGACCTGTCTGTCTAGCATGG
TATTTTGTCTCTTAGAGTGGCAAGACGATACTTTTTTATGGTATTTAAGTGCTTACTATG
TGCCAGGTACTGTACTGAGCACTGGGATGAATACAAATTAATCAGGTTGGACACAGTCCA
TGTTCCACATGGGGCTCACGGTCTTAATCCCCTTTTTACAGATGAGGTAAATGAAGTACA
GAGAAGTTAAGTGACTCACCCGAGGTCACACAGCAGACAAGTGGTGGAGTTAGGATTTGA
ACTCAGGTCCTTCTGACTCACAGGCCCTGCTCTTTCCACTTGAGAGGAGTAGTGCAGTGG
TCCCTCCTTGACATCCATCCTCAATCAATCAATCAATCAATCAATTAGTGATATTTATTA
GGAACATACTGTGTTCAGATCACTATACGAAGCACTTGGGAAAGTACAATAGAGTGGAGA
GGAATGATCTGTGCCCTTGAGGGGCTTACAATCTAGTTGGAGAGACAGGCATTAAAATAA
ATTTCAGGTAGGAGATCCTATTCAATCCTATTAGGTGAGAGCCATTTCCTTTCCAAATCA
TTCCGTGGAGGCAGGAGAGGAAGGATTGTACCATACCATCATTCCCAAACTTGTGGTGGC
CATTTGTAGGCCTCACTAAACCTTTCTCATTCCCTCCTACAATACTGCCTGTAGTAAATC
ACTTGCAGCCATTTATCTGTGAATTTATCCCAACCCCTCTTAAACCTACTGGGATTTTTG
ATCCATACACTTCCTGTGATAATAAATTCCATATGCTTACCGGACTATGTTTGAAGGCGT
GTTTCCTTTTATTGGTTTTGAAGCGACCACCTGTAAGTTTCAGTGGGTGCCCGCTCACTC
TGTTGTCGTGAGATTTGTAGGAGCAATTCCGGTTTTTTTTTCCTTTTCACATCCTTTATG
ATTTTGTAGACTTCACTGGTACCCTTTTCAGCCTTTATTTCTCCAAGATGAAGAGTTCTG
TTCTTTTCAGCTCATCCTCATATGGAAGCCTCTCCATCTCACTAATCATTTTGGTTTCCC
TTCCTTTTACCATTTCCCTCTTACTTTTTTCCTTCTTTTGATGCAGGGATCAGAATTATA
CGTAATATTCCAATAGATAATAGCAAAACTATAACTAAAACTATAACTTTTATTTTCTCT
TCCCGTCATGATAATGCTCTGCATTGGATTGACTCTTTTTGTTGCTTCTACATATGAGAC
TGATTCATATATATATGAACAAATATGTTGGTATTTTTTACTATGTGCAGAGCACTGTTC
TAAGCGCTGGGGTAGATGCAGGGTGATCAGATTGTCCCACGTGGGGCTCTCAGTTTTAAT
CCCCATTTTACAGATGAGGGAACTGAGGCTCAGAGAAGTTAAATGACTTGCCCACAGTCA
CACAGCTGACAAGTGGCGGATCCGGGATTCGAACCCCTGACCTCTGACTTCCAAGCCCGG
GCTTTTTCCACTGAGCCATGCTGCTTCTCCGATTATATTATATTAGTATACACACACACA
TCCAAATTATGGTATTCGTTAAGTGCTTACTGTATGCCAAGCAGTGTACTAAGCCCTGGA
GAGACACAATATAATCGGTTTGGATTCAGTCCCGAATCCCATAGAGCTCACAGTCTTAAT
CCCCATTTTACAAATGAGGTAACTGAGGTACAGAGAAGTTGTGACTTGCCCAAGGTCACA
CAGTAGACAAGTAGTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNTCATTCGCAAAATGGGGATGAAGACTGTGAGCCTCATGCGGGACAACCTGATGACC
CTGTATCTACCCCAGCGCTTAGAACAGTGCTCTGCAAATAGTAAGCGCTTAACAAATACC
AACATTATCATCATTATTATTATTTCCACTAGGCCATGCTGCTTCTCTATATTTATAATA
TATGTGTACATAGATATCTTTCTCTCTCTCTCTCTCTCTATATATATGTATATAAAATGC
ATGTTCATTATGGTTACTTTCTTCAGGCCAAAGTGGCACGAGTAAGCTGTTCATTCCGAT
AACTATGTGAGCTCAGCATGCCTTTCCACTGCTTTCAGCAATATCTTCTTTCCAGTGTGC
CATTAAAAGCCACACCATAGAAATACAGCGCAAGTTATGTGCTGGGTTAAAATAATTTAG
TGCATATGCAGAAAGTGGGGCAGTGGGTCGCGACACAGGCAGGGGCTAGGATTGATGCTT
GGGGGGAGGGGGGAGACTACGCCATCTCTGCCGCAGAGCACCTGGAGAAGGGAGGAGCAC
GAAGGAAGCCGTCGGGCCAGCGGACCCCCGGCCCTTTGAGCGGATTTGGAGATCTTTCCC
CAGTCTGCGTGAAGCTCAGCTTTCTTCCTCATTCAGTTAGGTATGGTATTTATTAAGCAG
CAAGTATGTACTGAACAGCTGTTAATTTATGTCAGTGCCTGTCTCCCCCTCTAGACTAAG
CTCCTTGTGAGCAGGGAGGGTGTCTACCCAACCTTCTGAGGACTTAGTAGAGTGCTCTGC
ACACCCTAAGTGCTCAACTGATATGATTAATTGCTTGCTAAGTGCTGATTTGGCCACAGA
CGAAGCAGAAGCTCCCTGTTTTACATGGTGCTCACAATTTACTTGTAGGGGAAAGGCAAA
AATAGGATGGATTGAAACAGTGTCAACAAATCAAAACTACAATGTCAGTGGAGGATGGGG
AGACAGAGTGGTCTAGCGGATGGAGCAAGGGCCTGAGAGAAGGATCTGGGTTCTAATTCT
GGCTCCACCATTTGTCTGCTGTGTTATCTTGGGCAAGTCATTTAACTTCTATGTGCGTCG
GTTATCTCACCTGTAAAATGGGGATTAAGACCGTTGAGTCCCCGGCCCACTGTGCCCAAC
CCAGTTTACTTGTATCCACCCCGGTGTTTACTACAGTGCCTGGCACATAGTAAGTGCTGA
ACAGATACCATAATAACAATTTTTTTGTTATTGTTCTGTCAAGACAATTACAAGACTGGA
TCTTGGAGATAGGTGTCTCAGATACCTCACTGCTCCAAGTGAACAGTCCTTAGTTATACA
CCATCCCGGCCTCCCCAGGATTTTAAAGGCCGTATAGGTGGCCTTCTGGCGTTCGGTTGT
CGGCTGCTCCGGGTGAAGCCGGTGCAGGCTTCCGGGGCAGATCCAGGAGTCCTAGTTTTA
AGGAGGCACCATATCCCATGTGACTCGATCGCTGTCCACCCCCTGCTTTCTCTACAGCAG
TGAGGGAGGCCCAGTGGGCGAGAGTCAGCTGCAGCCCGAGCTGGGTGCAGAGCTGATGAT
AATACGGTATTTCTTAAGCACCTACCCTGTGCCAAGCACTGTTCTAAGCACCGAAGTAGA
TACAAGGTTATCAGGTTGGACGCGGTCCCGGTCCCAAAATTGGGGCTCACAGTCCTCATC
CCCATTTTACAGATGAGGTCACTGAGGCACAGAAAAGTGAAGCGATTTGCCCAAGGTCAC
ATACCAGGCAAGTTATGTCTGAACCGGGATTAGAACCCGTGACCTTCTGGCTCCAAGGGC
CGTGCTCTGTCCCCGGGGACACGCTGCATTTGAGAACCTGACTCCTTGCAGACGTAAGGT
GGCTGTGGAGCTCTTGGGGGCATGTGGAGCTAAGTGGGGACATCCAGGAAGAAAAGTAGA
AAATGAGAATAGGATCCCGGAAGCGTCACCGACATTTTTAGGTCAGCAGCAGGGAATGTG
GTTCTTGTCAGGGAAGTATCCTGACCTAATGGAAAGAGCACAGGCCTAGGAGTCAGGAGA
TCTAGGTTCTAATTCCAGCTCCACCACTGCCTACTTTCATTCATTCACTCAATCGTAGTT
ATTGAGCACTTACTATGTGCAGAGCACTGTACTAAGCACTTGGAAAGTACAATACTCTGT
GACCTTGTGCCTCAGTTCCCTTCTCCCACCTCCGTAGACTCTGAGCCCCATGTGGGTTGA
GCCTGTGCTCCATCTGGTTGTATTGTGTCTACCCCAGCACTTAGCAGAGTGCTTAACACC
TAGTAAACACTTAACAAATGTATTATTAATATTATTGCTGCTGCCGCTAACCTCCTCACG
GTGCCTCCTTCTCTCCTGTCCCGCCGTCGACCCCTGGCCAATGTCCTGCCTCTGGCCTTT
ATTATTGAGGATGCGGTCGGAACTTCAACGTGCCAAGATGTTATGCCAAGGAGAGACTAT
ATCACTGCAGTTAACACAGGCGAGGAAATAGGTGATTGTTTTTGTAAATTCAAATCCAGA
GTATGCTAGATTTTACATAATAATGCCCTCACAAAATTGTGTTTAAAAAACGGGTTTGTA
ATTGAAAGTGAGTCAAGAGAAGTGAGTCAAGAGAAGCCCTCCCTCCTCACATCCGTCAAA
CTAGCTCATTTCCCCCTTCAAAGCCCTAGTGAAAGCTCACCTCCTTCAGGAAGCCTTCCC
AGACNNNNNNNNNNTGTGTTATCTACATGCAGGGTTGTGTCTGGTGGCTACCTATTCCCC
ACCAAAAGTCAGAGCCAACCTCCTTCAGGACTGTCAGTTGTTAGCTGGACTTGATGTTAA
GGTAGGTGGAGGGCTAATCATACGGTGGTCATTTGGTTTTGTCCTAGAGAGCTTGGATAG
CCAGAGGACCAGTGTGGCCTAGTGGAAAGAACATGGGCCTGGTAATCAGAAGACCAGGGT
TCTAGTCTCAGCTCCACACCATATGCCTGTTGTGAGACCTTGGTTACATCACTTAACTTC
TCTGTACCTCAGTTACCTCATCTGTAAAATGGGGATTCAGTACTTTTTCTACTTCCTACT
TAGGTTGTGAGCATTGTGTGGGACTGGGACTTGGCCCAATCTGTTTATCCTGCTTCTTCC
CCAGTGCTTAGGGCAGTGCTTAACACATAGAAAGATACCACAATTCCACAATTATTATTA
TTATTATTATTATTATTCCAGGTTGTCCATCCCTTGCCTGGTACTCAATATGTTGTTAGG
GAGGGGGCATGTTTGAGAAATGGGTATGTAAGTATTCTTGAATACCACCGATAGCCATCC
TAGCCGAAGGCCACAGCCCCAAATACAGATTGTTGCAGGAGGTCCCCGTGATAGAAGGGA
ACTCGGGACTAGCGGATCTTGGGTCCTGAAACGTTCGTCCCATCTATGTAACTCCAACCT
ATTATAATTCAATTGGCAGCTAAAATTAAGTTGCCCCATACAGATTCAGACAAAAAGGGT
ACTTTCCTATTGGAAAATTCTTTTTAAAAAAACATCTGCTCCAAATGCACAGCTAATCAT
TAGCTGTGCGTTGAATATTGTTCTCTATCTTTGTGCAAAAATCTCGCCCACCTAACATTA
ATTGCTAGAAAAGTGGATTGCTGTGGTGGCGAGGTATAGAGAGCAGCCATAGCAAAAGGG
GGCATTCGGTGTGAAGGTTAAAGACGATTTTATTCCCTGACTTGCAACGAGTTACCCAGT
GTAGAAAAAAGACTTACTCTTTGTAAAATAATTGTTGCAAATAGCGCAAATGTTACAATC
TCAAACCTATTTCTAGAGATAATTCTCTAAGGAAATTCTTAAGTGGCATGAGATAAACAT
CAAAAATGAACCGTAACCAAATTTTTACCTGAAGAAGATCTAGAAATGTACCAAATGGCA
TACTCTCTCAGTGGCATCTTTTGTGCTATTAATCGAAGGACGCAGATTCTTCACGGGACT
GGTGTGGAAGGGACTACCTATCATGTGTCACTCTAGTTCTGCTCCATTTCCACTCAAGGA
AAATAACACCTTTGGCAGAATTATCTTCAGACGCAAAGGACGACGATAAATATATATTTT
GTGACCCATTACACTTTTGTGCATATTTTATGTCCTCTGCTCTCTTTAAGCACTTATTGA
TTTATCTGCCCATCTTTCCATTATCTTGCTTTCTCCATCATACACGTCAGCTCTCTTCAC
CCTTTACTCCCCAGCTTGCTATTTTTTCTTCCCCAGCTCACCTACCTCTCCAAGAGTTCA
TTGATCGCAATTCATAAATCTGGAGTTAGTGTGCCCTAATCCCTGACATAGCTCAGGATC
CACAAACCCTGCCCAAGGTTACTTCCAATCCCTGTAGGAAAGGCAGGCCCCTCTCCACTC
CTTCCTCCCGTCTCCTCGTTTCTACCTTGGCACTTTCCAGTCACTTATTTTCAGTTACTT
GGGCTCGGCCTGCCGTATGATCGAAGAAGCAGCCGACTCTCTAATCTCCACCTTCCCAGG
GTCAAATGTAGAATTACACCTTTTGATCTGTAGAAGAATGGCATTTAACCTTTCTGTTTC
AAATTTGATTTTTTTAAAAATATGCTCTTTTGGGCTTCTGCACAGGACTGCACTGATGGC
TACATGTGCAAAATCCATTTCAGAATGAATGATGGGACCACGGAGTCACAGCTAGAGACA
ACTTCCAGGGAACAGTCCCCCTCTACTCAAATTGAGGTAATCACTTATATATCTTCCTCT
ATGTTATCAGCTTTGGTTATACAAATGAAACTTTTTTTTAGGTGGCATTAGTTAAGCGTT
CTACTATGGGCTGGGTACTGTACTAGGCGCCGGAGTAGATACAAGCCACTCAGGTTGGAC
CCAGTCCATGTTCCACTCGGGGCTCACAGTCTTAATCCCCATTTTACAGATGGGATAACT
GAGACACAGAAATTAAATGAAGTGCCCAAGGTCCCACAGCAGACCAGTGGGCAGGGAGTG
TGTCTGTTGTATTGTCCTGTCCCAAGCGCTTAGTAAAGTGCTCCTCACACAATAAGCGCT
AAATAATTGAATAAATGGATGCATGAAGTGACGTAGCCGGGATTAGAACCCAGATCCTTT
CTGACACCCAGGCCCAAGCTGTATCTGTTTGGCCACACTGTTACTTAGCAGGATTGAGTA
ATATGGTAATTCATTTTGCTTTTCCCCCTCCAACTATATTTCAAGTCAAATACTTTAGCT
CCTGGAACATTCTGAAACAGAATTCATGTATTTTCTGAGAGATTTGGGGCTAACGTCATA
AAGAAGTTAAAGAAAGAGGGCATGGACCAAAAGCCCTTGCAGGATCCCCTAAACATATTT
TAAAAGTGAAACCCAATGTCATTCTCAGCTTTAGTGGATTAATTCCCCGTTCATGACACT
TTCTGTTGGGACCATCCAAGTGTTGCATCTGAATATGTGCCCTCCCAAAGTATAGCACCT
CAAAAATCACTTCTTTTTTTTGTACTATAATAATGGCTATTTACAACTCAAGGCTGAAAC
TGGGCTTTAGATTTGTGTGCCCTGAAGTCTAGTTGCAGGTTTTAGTAATGGTATTTTTTA
AGCCTTCACTTTGTGCTAAGCACTAGATGCTGGGGTAAATTCCAGTGCTTAGAACAGTCC
TTGTCACACAGTAAGCTCTTTACAAATACCATAATTATAAATGCAGGATAACTGGATCAC
AACGGGGCTCACGACTATGGGCAAGTCACTTAATTTCTCTGGGCCTCAGTTACCTCATCT
GTAAAATGTGGATTAACTGTGAGCCTCACGTGGGACAACCTGATTACCCTGTATCTCCCC
CAGCGCTTAGAACAGTGCTGTGCACATAGTAAGCGCTTAACAAATACCAACATTATTATT
ATTATTCTGGGCCTGACGTCCTGCTCGTCTCACTTGGGTCTAGGGTCAATGGAAGGGGAG
GAAATTGGTTATGTGCGACGAGATGTGCCTTTAGCTTCTGGTAGATCAATTTTTGTTTTC
TTTTGATATTCTCTCTCCTCTTTTTCTCTGATAATTTTCAAGAAACCATTGTGTACTCCT
TGATGTGACGCTTGGGAGCGGGGAGATGGCGGAGCGGATAGGAAGGAGGTGCGTTCTCTC
CGTATCTTCTCTCCTGGGCAGGCCCTACTGGCCGCTACCACCGGACCTGCCTCCCTGTCT
TCAGAGCTGAAAGGAGGGTCAAATCCAAGGTGGACAGTGATAATAACGCACTTCGGCAGC
CTCCGATTTTACTACCGAAAGGTTGACGACATGGCTTAGTGGGTACAGCACGGACTTGGG
AATCAAAAGGACCTTGCCTCTAATCCCTTGGCTCAGTGGAAAGAGCCCGGGCTTGGGAGT
CAGAGGTCATGGGTTCGAATCCCAGCTCTGCCACTTGTCAGCTGTGTGACTGTGGGCAAA
TCACTTAACTTCTCTGTGCCTCAGGTACCTCAACTGTAAAATGGGGATTAAGACTGTGAG
CCCCACGAGGGACAACCTGATTACCCTGTATCTACTCCAGCGCTTAGAACAGTGCTCGGC
ACATAGTAAGCGCTTAACAAATACCAACATTATTATTATTATCGTAGCTCTGCCATACAT
CTGCTCTGTGACTTGGGGCAAGTCACTTAACTTCTTTGGGCCTCAGTCATCTCATCTGTG
TAATGGGGATTAAAACTGTGAGCCCCATGTGGGACTGGAACTGTTTCCAACCTGATTAAT
GTATATCTACCCCAGCACTCAGAACAGTGCTTGGCACATAGTAGGCTTTTAACAAGCATC
ATTACTGTTATTATTATTAATTAATTAAGAGTAATAATATTAATAATAAATCTGCAGTGT
ACTTGCACTGATAATAAATGTGCCAACCCTGAATTCCAAGACTGCTTAGAGGCCTGCCCA
GACTCTGGAGGGACTCCATCATTCCCAGCCTCTAAGAGTTATTACTTGACAGTTGACAAT
GTAGTCATGCCATGTCTTTCTTCTATGTTTTCTTCAGCGCAGATAACGCGTATCGTTCGC
TTTTTCTGATGGTTTGATGTGCGACTATTATGAAATGAGTAGTTTTTCATTTTCTAATAT
CTCATAACCTTATCATAGAATGAGGTGCTACTCCTGTTTGTGACATTTAGTGTGGGTTAA
TATCGGCAGAAAATGTTATGTCAATTCAGATACGTATAAAGGATGAATCTAATTTGATAG
GTAATGGCCACAGGCTTTTTATGTTAAAATGTGAATGATAGCTGACTTTTTTTCAATGTA
ATTTTTTGGTGAATTTCCCTGTTGATGAAAGTGAGAATTGACTGTGCCAGCTACAGACAG
ATAGAGGTTTGTCAGATTTCTCTTCACGTCTGCCAGAGCACCTTATTTTCCGATCTGGTA
GAATGTAGCCATATTCAGGACCAAGGGCACTTGTAGAACAGAATGTGCCAGTCCATGAGA
ATTCTTGGAAATTTTCTGATAATTAATGAGTTTCATGACCTTTTAAGAGACTGTGTAAAA
CAACATTACTTAGCGTTTTCAGTCTTCAGGTCTCAGGAGAAACTTCAACTTGGTACAAGA
CAAAGACAACCCCGGATAGCTACATTTTCCAGTGTTCAGAAACATGATCTAAGATAAAAT
ATATTATCTCAGGATTTCAAAGTGTACCAATTAAAAAGTATTTTAAGCATTTTCACATTG
TTCATTAACTTCACTTCAGTACCAAGTAGATTAATGAAATAAAGTTTCATGCTTAGAAGT
TGTTATGAGGGAAGAACTTCTGTTAAGATCTGATTAAATTGAGTTTGATTAAATTTTTAC
CTGGCATGACTTGAAACTTAGATCAGAGTGCCAATCTAAACCAGCAGCTCTGTAGACCAG
TCGTGGTGGTAAGGAGCTTCTTCTGAAGGAAAGTAAAATGGATACGATGAGGTGATTGAG
GAAATGCTTGACATGGCTCAGTGGAAAGAGCCTGGGCTTCGGAGTCAGAGGTCGTGGGTT
CGACTCCCGGCTCTGCCACTTGTCAGCTGTGTGACTGTGGGCAAGTCACTTCACTTCTCT
GTGCCTCAGTTACCTCATCTGTAAAATGGGGATTGACTGTGAGCCTCACATGGTACAACC
TGATGACCCTGTATCTACCCCAGCACTTAGAACAGTGCTCTGCACATAGTAAGCGCTTAA
CAAATACCAACATTATTATCATTATTATTATAGGCCTGCATCAGTGATGGTCCTTAAAGT
AACCAGGATGTCGAGTATGTTTTTCTACTTGACTCCTTGTGTTTCCTGGATTCATAAATC
TGTTAAAGTTTTAGCCTGTTTGATAATTGCAACGTTCCAGGATAAAAATCCATGAGAAGC
AGAGAGGCCTAGTGGAAAGACCACAGACCCGGGAGTCAGAAAACCTGGGTTCTATTCCCG
GCTCCACTATTTGGTGTGTGACCTTGGGAAAGTCATTTAACTTCTCTCTGTCTCAGTTAC
CTTATCTGGAAAATGGGGATTAAGACTATAGGCCCCCTCGTGGGACATGGACTGTGTCCA
ACCTGATTAGCTTGTATCTATCCCTGCGCTTAGTACAGTGCCTGGCACATAGTTGGCACA
TAATAATAATAATTGTGGTATTTGTTAAGCACTTACTGAGTGCCAGGCACTGTACTAAGC
GCTGGGGTGGATACAAGCAAATCGGGTTTGACGTAGTCCCTGTCCCACATGAGGCTCATA
GTCTCAAACCCCATTTTCCAGATGAGGTGACTGAGGCACAGAGAAGTGACTTGCCCAAGG
TCAGACAGCAGACAAGAGGCAGTGCGGAATTAGAACCCACGAGCTTCTGACTCCCAGGCC
CGTGCTCTATCCACTACGCCATGGACAAATGCCATTAAGGAAAAAATGACTGTACTCAGA
AAATGGTAGTAAATTCTCCTAAACGTCAATCGGTAGCTTAAAAAAAAATTTCTTCCCTGA
AAGTAAATGCCAAGAATTAAAATTTTTAAGTGATTGAACTTAGTATTTGCAAATGAAAAT
ATAATGAACATTTGTTTAGAAATAGGAAAGCCTGATAAATTGGAGCTATGGATGTCAATA
GCTCTTTCTCTGTAGGAACGGTTGGAGACCTAAATGGACTTTTTAAAATAATGAATAATG
ATAACTGAGGTATTTAAGCCCTTTTATCCAAAACACCAAGCTTAGCGCTGGAGTGTCAAG
AAAATCAAATCGGACCCAGATAAACCGTTAGGCATTGGGCAGAGCGTAAATTGCCCTTCA
TTTCTATTTTATGAAGGCAGGGTCATGCTAAGATTGTGGCCAGGTTCCTGGGAGTTGAGG
AATGGAACCTATTGTTCCAGTCCTCAGAGAAGCAGCATAGCTCAGTGAAAAGAGCCCGGG
CTTGGGAGTCAGAGGTCGTGGGTTCGAATCCCGACTCGGCCACTTGTCAGCTGTGTGACT
GGGCAAGTGACTTACCTTCTCTGTGCTTCAGTGACCTCATCTGTAAAATGGGGATGAAGA
CTGTGAGCCTCAGGTGGGACAAACCTGATTACCCTGTGTCTACCCCAGCGCTTAGAACAG
TGCTCTGCACATAGTAAGCGCTTAACGAATACCAACATTATTATCGTTTGCTATGGGGCA
GGAGGTGGAGCGGCTACACAGGACACTGAGAGGTGTAGGTTTTCCTATCGCCTTGCCGCT
CAACTGGGTGGTAGCGACTACATGAGTGTACTCTAGCGAGAGCGGCAATCGCCTCTTCCT
CTCTGTGCACAACTCCCTCCGTGGCCTACCTTGCGGTGCACAGCTGGCTCAAGGGCTGAA
GGGGAAATAAAGGAGCTATATACAAACGAGAAGAGGTAAGTGCTACTCCCATTAGCCTAT
ACACATCCAGTGGAGCAGCAGGGCCAAAATGGCCAAGTACGATCTTATTTATGAATGTCC
ATTTTCTGTTTTGAAATGTCAAGATGTAGTCCGTAGCTTGAAGCGATAATCATGTCAAAG
GAGCAAAAGGATCTGCTTGTGGGGGGAAATCAGGTTCCAGGAGTTCAGAGAGATAGAGAA
GCAGTGTGGTTCAGTGGAAAGAGCCCGGGCTTGGTGGTCAGGGGTCCAGGGTTCTAATCC
CGGCCCCGCCATTTGTCAGCTGTGTGACTTTGGGCAAGTCACTTAACTTCTCTGTGCCTC
AGTTCCATCATCTGGAAAATGGGGATTAAGACTGTGAGCCCCACGTGGGACAACCTGATC
ACCTTGTATCCTCCCCGGCGCTTAGAATAGTGCTTTGCACATAGTAAGCGCTTAACAAAT
GCCAACATCATCATCATTACTATTATAACTAAGCCTCACCCCAACTGAATCAAGTCAGTG
AATAAGAGCCTGATCTAGCTTCTACTGTGGTCTGTCGCTACTCCTTCTTATTCATTGTCC
ATTTTGTCGTAGGACCTCATACCTGTTTGGATGGGAAAGTTTCACTTATTCTCAGCTCTT
GGGGGACTTTTGCGATACATTTCTATATAAAGGGGATTTTGCAAAGGAGAGCACATACCT
AGCTGTAGATGTGCACTTGTGTAACCGCAGACAGTTGTTAAGGCAACCAAATCAGGTCAG
CGAACAAAATGGAGTTTTTGGGAAAACGTTTGCTGGCTAATTGGAATGCTTAATGCGTAA
TAATTCAGCTACAACCTGCCTCCTGTTCTGGCGCCATTGTGGAAGGAAACCTTAAAAGTA
TTACCACAGTTCCTTTAATTCGTCGGCTTTAATGAAGCTGGTATGCTTTCCGTGGCCTTG
CTATTAGAGGGTCCAATTTTAAGGAAAGCCCCTTTTTGCAGTGAAGAGGTGGATGGGTCA
TGCCATCTTTGGGGATCTTTATTGTCCTGAATCTTGATGCGTGCTTGTTTTTAGAAAATC
AGGGGGTGTACGTGGGGGCTCAACTTTAACTTGAAGCAAGTGAAAGTAAACACAATGAGC
CCTGTTTTCCTGATGCTTTTCTCTTCTCATAGTGTTCTCTTTGAAGCCAGTGGGAGCTCC
ACATGTGGAGAGGGAGATATGCAATAGGAGAATGGATTGCAATTATGTGTGATAAAATAG
GATTGAGTCTAAAATCTTATTTGATTTTCCAAAATGATTATATTATGTGCATTTGGAATG
CTTTTTCATTCTTAGCTAAGTTGAAAATATTATTTTTTTTTGTAAATCTCACCAAATGGG
AGAAATATCCATCAATATAATTTTCTGTGTAAGGATCAAAAATAATGTGATGAATTCTGA
AAGGAAGAAACAGAATGTAAGTATGGCAATATAAAATCTCATGTAAAAATGCCATCTTCG
GATTTGTTCTTGTAGATGGCGAGGGTTTTCAGAAGGTGGAGTGAAAAAGAGCAGATGAAT
GAAATAGACTGCAGTTTAGGATTCACCAGGCCCCGGCAACACGTTTTACACATAGGGTAC
AATTAGGAGTTCATCAAGGGGCTTACCTGATGCCTTTTTTCTCTATAAAAACTGAAACCT
TTGAAAATGATCAAATATTGAACACAAATGTTCATTACCGTGTACAATTTAAAGGGGAAC
CTTTCTATGGATGTATTGAATTTGCCTATCCAGTAATCTGGAAGAAATGACATTAAAGTT
CCCGTGTCAATTTTCAAGTTATTCATTGAAGGGTGGATAAATGGCAAGGAGGAAGGAATT
TGTGTTTTTGACACCTAGGCAGTAGTACAACAAATTCTTTTTAAAAAATAAGTGTTATTT
AGAATAAATTGTGAAAAATGGCGGGAAATAGAAACTTTCCATTGAAACTCTAGCCCACTA
TTAACAGTAGACAGAATGTAACATGAGAACTGTAGGGATGCCCTTGTATGTTGCCCGTGA
AAAATGGCTGTTTTCAGAGTTGTTATTCCTCTCAGAACACTGTTTGCTTGTTTATGCTGA
TAGTGACTTTTAAGAAAGATCTCACCCCCCACAAGGAACTACATGGCTCCTGCCAGAGTC
TTAAGCCCCTCTGAAATGGATGGAAAAAATCAATCAATTGTATTTATTGAGCACGTACTG
TGTGCAGAGCACTGTACTAAGTGCCTTGGAGAGTGCAATACGCAAGAGTTGGAAGACATG
TTCCCTTCCCATTAGGAGCTTACAGTCTCGAGGGGCTGACAGACATTAAAATAAATTACA
GATAAATACATAGGTGCTGTGTGACTCAGGACGGGTTGAATATCAAATGCTTACCACTTG
CCAGCTGTGTGACTTTGGGCAAGTCACTTGACTTCTCTGTGCCTCAGTTACCTCATCTGT
AAAATGGGGATGAAGACTGTGAGCCCCACGTGGGACAACCTGATCACCTTGTATCCCCCA
GCGCTTAGAACAGTGATTGGCACATAGTAAGCGCTTAACAAATACCACAATTTATTTTTT
TTTAAAGGCACAGAACTAAATGCATAGGCGACAGAGAAGGAAGCGGGAGTAGGAGAGAAG
AGGGCTTAGTCGGGAAAGGCCTCTTGGAGGAGATGTGATTTTAATAAGGCTTTGAAGCTG
GGGAGAGCAATCATCTGTTGGATATGAAGGGGGAAGGGGTTCCAGGCCAGAGGTAGGATG
TGGGTGAGGGGTTGGCAGTGAGATAGATGAGATTGAAGTACAGCGTTGGCATTAGGGAAA
TGAAGCATGTGAGCTGGGTTGAAGTAGGAAATCAGAGAGGTTAGGTAGGAGGGGGCAAGG
TGAATGAATCCTTTAAAGCCAATAGTAAAGAGTTTCAGTTTGATTCAGAGGTAGATGGGC
AACCACTAGAGGTTCTTATGGAGTGAGGAGACATGGACTGAGCTATTTTTAGAAAAATGA
TCTGGGCAGCAGAGTGAATTAAGGACTGGAGTGGGGAGAGGCGGGAGACAGAGGTCAGGG
AAGTGACTGACACAGTAGTCAAGTTGAGACAGGAAAAGTGCTTGGATCATAAAGTTTGGA
TGGAGGGAAAGAGTGCATTTGAGTGATATTTTGAAAAAAATGACAGGATTTATTGTCACA
AGGAACAAGTAGGTTGAATGAGAGAGATGAGTTAAGTATAATGCCAAGGTTATAGGCTTG
GGAGACTGGAAAGATTAGTGGTGTTGCCTACAGTGATGGGCAAGATGGGGGATCACAGGG
TTTGGGTGGAAAGATAAGCAGTTCTATTTTGGACCTGTTAAGTTTGAGGTGTTGGCAGGA
CATCCAAGTAGAGACGTCGTGAAGGCAAGAGGAAATTCTAATTGCAGAGAAGGAGATTGG
TCAGGAATGAAGAGGTAGATTTGGGAATCATCTGCTAGAGGTGGTAGTTGAAGCCCTGGG
ACCAAATGAGCTCTCCAAAGCGGTGGATGTAGATGGAGAATAGAAGGGGACCCAGACCTG
AGGCTTGAGGGACTCACATAGATGGTGGGAACTAGAAGAGGAGCCTGTGAAGGAAACTGA
GAGTGAATAATCAGAGAACTAGAAGGAGAACCGAGAGAGAGCAGTGCTAGTGGTTAGATA
ATGTTTCCTGGAGAAAGGGACAGGGTCAAAGGCAGCAGAGGGGTCGAGGAGGATAAGGAT
GGAGTAGAGGCCATTGGATTTGGCGAGAAGGAGGGCATTGGTTGACCTGAGAGAGTGCAG
TTTCCCTGGAGTGAAATGGGGGAAGCCAGAATGGAGGCAGTCAAGGAGAGAACTGGAGTT
GAGGAATTGGGTATAGACTATTCACTTGTAGGAGTTTGGATAATAATGGTAGGAGAGAGT
TGGAGCGGTAATTGGAAGGAGCCAATGGAGGGGTCAATGGAGGGGTTTTTTTTTATGGCT
GGGGAGACGTTGAGCCATGTTTGGAAAGCCGGTGGGGAAAGAAGCCACTTGGGAAANNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGCATCTGCATTACGTCGAAGTCTG
GGGCATTAAAGGGAGAAATCCTCGGGTCTTTCCTAAAATAGACCCCAATCCTCTCATTGA
TTATCACCCTCATCCTCACCGATTTTCCGACTAACCCATGGCAAAGCATTGAACGAGGGC
TTGGGAGTCTACAGTCGAAGTAAAGTCACCCGGCCCCGCCTTTGAGGAGCGGTCTTAAAA
TCTCCCCAGATCCTCTAACCACTCGGGCAGCTTCTGAACTGGAGAGGGCTGAGGGTCGGT
TCAAACCTCTTTGAACTGTTAGGCTTTGGGTTAGGCCCAACCGTGATCAGACCCACACTC
CACGCTGAGCCAGAAATCTAAAAGGGAATAAGGGGACATTTACCTAGGTGGATTTTTTTC
CATGTCAGGCTGGGTGGTTCTCCTGGAACTAGTTCTTAATTAAGATCAGCATGACAAGCT
AGCAGGAAAGCATAGCCACAGGAGCATATAAATCAGAGCATCCGAGACAGCCTTGAAAAA
AAAGCTTGTCTTTTGGTTTGGCCTCTTGAGAGGCTGCCGTGAGGAACAGCATTTGTTTGT
ACTTTTCAAAATGCAAGTCTAGTTAACTCTTGATCATCCAAGACTGATTATCTAGACTGT
GGATTACCCAAACCTCTTGTTTCTCCTCCTCCTTGGACATTTCACGGCTTGCCGAGTGCC
TCCATCAAAGGATGAGAAGGGAAAGGACCAGGAGGTGAAACTCAGACTGCCAATTTGGTT
CCTCGTTAGCATCTCTGCTAAAGGGTTTGTAGGGATGGCAGTCGACACTAATGGCCAAAA
AGAGGTTTTAGGATTGTTTGTGGATTTTGCTTACTCCCTCCCCACTCCCATTCTCCTGTT
ATCAGAGATAAGTAAGAATTGATCATTAGAATCCTAAGAAAGAAAGATATGGCAGGCAGA
AACATCTTTATTTTAGTTTCTGCGCATAATCAACGCTGACCTTGTTTTTGTCACTTGAAT
AGCATCATGATTATGTCAACTGAGTCATTGCTTTGATATCAACGGCGAACAAATGTCATT
ACACCAACCGTCTCAACATTTAAAAGTCAGGGCTTCTTTCAGTCTACTACTAATATTGAT
TATCTGTTGATCGCTGGGGCTAGAGAGGGGGGAATTGATCTGGTGGGTAAATTCTGGTTC
ACAGGCCATCAAACAATCAATTGTATTTAAGTACTTACCATGTGCAGAGCACTGACAGAG
TACAGTAGAAAAAGTGGATATGATCTATGACCACAGGGAGCATACAGTCTAGAGGGGAAG
ACAAATACTAAAATAAATTAGATAGGAAGTAATAGAATGTGTCCATATCTGGATATATAA
GCATACATATGCATATCAGCGTGGCTCAGTGGAAAGAGCGCGGGCTTTGGAGTCAGGGTT
CATGAGTTCGAATCCCAGCTCTGCCACTTGTCAGCTGTGTGACTGTGGGCAAGTCACTTA
ACTTCTCTGTGCCTCAGTTCCCTCATCTGTAAAATGGGGATTAAGACTGTGAGCCCCACG
TGGGACAACCTGATTCCCCTGTGTCTACCCCAGCGCTTAGAACAGTGCTCGGCACATAGT
AAGCGCTTAACAAATACCAACATTATTATTATACTCTATTCAAATAAATCAATCATTGGC
CTTTATTGAGTGCTTACTGTGTGCTGAACACTGTTCTTGGGAGAGTACAACAAAGCTTGG
GACAACCCCTTTGGTAGACATGTTCCTACCCACAAGGATGCTTACATTGTAGAGGGAGAG
GCAGGCATTAAAATAAATTACAGATATGTACGTAAGTGCTGGGGGGCTTAAGGTGGGATG
CCAATCAAGTATTTAAAGGGTATAAAAATATATATACACACATATACAGTACTCAGCAAT
GTCCTAGAGGAAAAAACACAGTCCTGGGAGTCAGGAAACCAGGGTTCTAGTCCTGGCTCT
GCCACTTGCCTACTTTGCGACTTTGGGCAAGTCACTTAACTTTTTTGTGCCTCAGTTATC
CCATCTGTAAAATGGAAATACAATACCTGTTCTCCCTCTCTTTTAGACTGTGAGCCCCAC
AGGGGATAAGGATCGTGCCACACCGATTGAGTGACTTGTCCAAGGTCACACAGCAGACGA
GTAGCAGAGCCAAGATTAGAACCCAGGTCCTTCTGACTCAATTGTATTTATTGAGCACTT
ACTATGTACAGAGCCCTGTATTAAGTGCTTGGGGGAGTATAATGCACCAGAATTATCAGA
ACCATTCCCTGCCCGAAATGAGTTTACAGTCTAGTGCTCTATCCACTAGGCTGTGCTGCT
TCTCCAGATTGAAGAGGAATGAAGAATGCAGGCTGGTATGTAATGAGAGACGAGAGTGGA
TAAATAGGAGAGAGAGCCGATTGAGTCCTTAAAGCCATAGATCAGGAATCTCTGCCTGAA
CGATAAATCGGTGGTATTTATTGAGCGCTTACTGTGTGCAGAGCACTGTGTTAAATCCTT
GGGCAAGAGTTGGTAGACATAATCCCTGCGAACGAGAAACTCACAGTCTACAGGGGGATA
TAAGCATTAAAATAAATGAAATATGTACATTAGCAGAGTACAAGAAGAGTTGCAAAAGTA
TCGTGGGGCTGGGGCGGGTACCAAAGTGCTTAAGGCGTACTCGGCCAGGTGCAGAGGGGA
GGCCGGATGGGGAAACAAAAGAGCTTAGTCTGGGAAGATGTCTTGGAGGAGATGTGATTT
TAAGAGAGTTTTGAAGGTGGAAAGAGTGGTGAACTGTTGGATAGGAAGGAGGAGGGAGTT
CCAAGCCCAGGGGAGAAGGTGGCAAGGAGTCGGTGGTGAGACAGATGATATGGAAGTACC
GAGAATATGTTAGAGGACAAAGTGTGGGTTGGATTAAAGAAGGAGGGGGGTGAAGTAATA
GAGGGGAGAGAGGTGATTGAGTGCTTTAGGGCTGATTATAGTTTAGAGCACGGTCTTGGG
AGTCTGAGGTCATGGGTTCTAATCCTGTCTCCGCCACTTGTCAGCTGTGTGACTTTGGGC
AAGTCACTTAACTTCTCTATGCCACAGTTACCTCATCTGGAAAATGGGGATTAAGACTAT
GAGCCCATGTGGGACAACCTGATTGCCTTGTATCCCCCCAGCCCTTAGAACAGTGCTTGG
CACATAGCGCCTAACAAATGCCATCATCCTCATTATTTTTATTATTATTGATGCAGAGGT
GAATGAGCAACCTTTGGAGGTTAAGAACTGAGGGAAATATGGACTGAATTCTTTTTCAGA
AAATGATCCAGGCCACAGAGTGAAGTGTGGACTGGTGAGGGGAGAGGCAGGATGCAGGGA
AGTCAGCGAGGAGACTGATGCAGTAGTCAAGGTAGGAAAAGATGAGTGCCTGAATTAGCG
TAGTAGTAATTTGGGTGGAGAAAAGGTCAAATTTTAGAGAGGCGATGAAGCTAGAACCAC
TTTAGTCACCCGACATGGAAAGACTTGGGCAACTAAGGGAGACTTTTGAGGAGTGGGGTG
ATGTGGGCTGAAAGTGTTTAAGGAAAAACATCTTCTGAGCGACTAGAGAGAGGAGAGACT
GGAGCTGAGGAAATCACCAAGAGGGCTGCTTAAACTATTAGCAGTGGCTAATAATGGCCA
AATCTCCCTGTGCCCCTTAGGGGATGTCCACAGCCATCTGGACATGGCTTTCCCTTTCCC
TCTGCTCCTCCCCCTCTCCCTTCCCCTCCCCTCAGCACTGTGCTTGTCCGATCATTTGTA
TATATTTTTTATTACCCTATTTATTTTGTTAATGAGATGTACATCCCCTTGATACTATTT
CTTGCTATTGTTTTAATGAGATGTACATCCCCTTGATTCTATTTATTGCTATTGTTTTTG
TCTGTCTCCCCGGATTAGACTGTAAGCCCGTCAATGGGCAGGGACTATATCTGTTGCCGA
TTTGTACATTCCAAGCGCTTAGTACAGTGCTCTGCACATAGTAAGCGATCAATAAATACT
ATTAAATGAATGAATGAATTACAGCATTTCTCTAGTCTCCCTCACTTCCTTTCCCTTTTA
TTATGCGGCCATTTAAAGACTTGAAAAATGGCGCAAACTGGGTGCATAAACCTCCAGAGG
AGACACGAGGAGGAAAATTTTGACTTCCCACTGTCCAAGGCCTATTGGGATAATAACCGG
GCCCTGTTGTATATATTTTTATTACCCTATTTATTTTGTTAATGAGATGTACTTCACCTT
GGTTCTATTTATTGCTGTTGCTTTAATGAGATGTACATCCCCTTGATTCTCTTTATTGCT
ATTGCTTTTGTCTGTCTGTCTCCCCTGATTAGACTGTAAGCCTGTCAATGGGCAGGGACT
GTATCTGTTGCCGATTTGTACATTCCAAGCGCTTGGTACAGTGCTCTGCACATAGTAAGC
GCTCAATAAATACTATTGAATGATTGATGTTGATCATGATGATGATGATGGTATTCGTTA
AGGCCTTACTGTGCATCAAGCACTGTTGTAAACCCTGGGGTGGCTTCAGTCAGATCAGAC
CCAATCCCATATGGTCCTCACAATCTAAGGAGAACTGATATTGAAACCCCATTTTACAGC
TAGGGGAATTGAGGCCCCAAGAAATTAAGTGACTTGCCTACGGTCACACAACGGGCAAGC
GGAGAGCTGGAATTCAAATCCAGGTCCTCCGACTCCCAGGCATGCACTTTTCGCACTAGG
CCACACTACTTCTCTGTCTGTGTGCAGTATCCTGTTTACTCTGGAAAGGATTGCCATGTT
GCATGTAAAGTATCTATGACTTGTACAGTGTAATTTGGAAGATTAACCATATTTTTGGAA
GAAGCTGTTGGTTGACCATTCTCAAACTATTCTGAAGTCATAAATTCATAATTGCCCGGA
TTTGGGCATCATTTGTGGAAAGAAATGTCACATTCAAATGTTCACAATGCGACTCTCCCT
CAATCTTCCTTCGAGGTTTCTTAGATGTTCAAGAAAAGAAGTGAATTGAGGCTAATAATG
TTGACCTCCCAGGGATTTAAAAATTGACTGTAAAGAGGTTTTAATGAAAATATGTAAATG
TAATATTGGTGGAGCTACAATAGAAACTATGAAAGACTAGAACAGGCGAAAAATGGGCAG
GTCATCCTGGATGATATACGTGTTTGCTTAATGAAACTCACGGTTCACGAAGATCTTTTT
ATTGTTACTTGCCTTGAAGTGGCACATACAAAAATGTGATTGAGACTTTTGAGGGTGTGA
CCTTCAGTGGGAAGCTCTTTTTAATGGAAGCCGCTTTTAAGCCCCAATTTATTTGATGAT
GGACCCTTTCTAAATTGGCAAGTTTTGCGGGTGTGTGTTTTGCTTTAAAAATAATAAACA
AATTAATGTTTCAGAAAGCCTCAGATAGACTGAATCAGCTGGAACTGATTTAGTTTTATG
GATAATTACATAATTAGTGGGGTTTAAAGAAAGCACAAACCTTACTCTGTACTTGATGGA
CTGAAACTGCTGTGAAGAAAATTTGTAATTACATAATCAGTACACTATTTGTATCAATAA
CCTTATCAAAATTCCTTAAAGTGGTCATTTGCAACAAATAGCATTAAAAATTTCAGTATG
TCAGCCATTATCCTATTGAATTTATGTTCAACAAGTGACTTGAATTTTTAAAGCTGAGCA
CAGATGATTCATCTCCTTTAAAAAGCCTAGACTTTGTCCCTAGTAAGAATTGTGTTTCCT
TATGTGTCTCTGGGAGAGTCTAGTGGAATTAAAAGGCATGATCCTTGCCCTCAAGGAATT
TACAGTCTAGCATTGTCGTCGTATCATCATCATCATCATCATCAACTACACATTTATTGA
GCACCCACTAGATTTAGGATACTTGTAACCGCCGAAGGGTTATAGAGGAGGAAGGAAACA
TGGGTGTTTGCCCTCAAAGATGTTAAATTCAAAAGAGGAAAACAGGACAAACATAAATGA
AAATAAGCTAATAAAACTAAAGTACCAGAGATATTTTAGCACCTGCATCACCAGCTGCAG
CTGTTCAGAGATGTAGATGTTTGTGCTGAGGGGGTTTCTGGAGAGCTTGGGGTCACGTGG
GCTTGATCTAGAAAGATTCCTTTATGGAAATGAGTTTTGGGAAGTATTCTGAAAACAGGT
TTTGAAAGCCATAGAGAGAAAGCACGCAGAGAAGAGGTGGGAAGTACATTTTAGACTGGA
ATAAGGCACTCAGCTCTTTCCCTCTTACCTTTCTTCGCTCCTTTCCCAGTCTAACCCAGC
CCACACACTTTGCTCCTCTAACACCGAGCTACTTCCTGTGCTTCGATATCATCTCTCTCA
TCGTCTTGGTCACGCCGTTCCTTCTGCCTGGAACTCCCATAACCTTCACATCCAACAGAC
CACTGCTCTCCCCATCTTCACAGCCCTTCTAAAACTGTAACTCCTCCAGGAAACCCTCCC
TGGCTCCATTTAGACTGAGCTCGTAGCAGGCAGGGAATGTGTCTGCCAACTCTGTTACAT
TGTACTCTCCCAAGCACTTACTACAGTGCTCTGCATACAGTAAGAACTCAATAAATAATG
ACTGATTGATTGATAACCTCACATCTATTCTTCCTTCTGTGTCACCTACGCACTTTAGTT
CATACCCTCTAAGCATTTTGATACTCATCCCGTCCCTGCAGAACTTAGGTACATATTTTT
TGTCCTTGGTTGCTTCCCTGACCTGTAATTTATTTTAATGTCTAGCTAGATTGGAAGCTC
CTCAAGGACAGGAGAACATATATTCCAACTCTATTGTACTCTTTCAAGTGTTAAAACAGT
ACTGCACATACAATAAACACTTAATAAATATCATTGATTGGAAGATTGTGCGGTGGGGTC
AGGTGAGGTGTGTGAGGAGAAGGCATAATTAGGTGCCCAAAGGTTGAACAGAGGATTAGG
GAATGGATTGTAAATTGATATAAATATGGGTCCTCACTCTGTCTTGCTGGGGTGAATTTT
CTCCAAAGGATTTATTTTCAGTAGCCAGAACCATTTCACGGAAGTGCCATATTGTCTCCT
ATCAAATAATCAGTTCCATAGGGTAAGACAGTCCATGAAATAAATGCATGTTAGTTGGTT
AGGTTGATTTTGTCTTTCGCTGTCGTATTTATTGAGTGCTTACTGTGTGCAGAGCACTGT
ACTAAGCCCTTACGTAAGTATTGGTGGCTTATTAGCACTAATTACCTGGGCTTTGCTTTC
TCTGCCAGTGTAGCAAGATGTAATAGATCGGATATTTTCAAGAAACAGATAGGCAGTCAT
CATTTTGGGTGGGTTCAAAGGAATTCTCATTCAACCTCCATAAAATTATGGAGCCCATTA
CTGACCCCCTTTCCATCCTCAACTCCCTGAATTTACAGGTACAAATTTACATTTACTGTG
TTTGCCTTTTCTTCCCTATTAGATTACATGCTCTTTGAAAATAGGCCGTAGGTCCATCAC
TAGAGACACCACAGTGCTCTGCACACAGTAAGTGCTCAATAAATACGATTGACTGACTGA
CTGACCAGTCCACTCAGTTTGACCGTAACATGAGTTTTAAGTACAAGTTTTGGTTATAAC
ATTTTTTAAGAACTTAGGAAACGTGTCCGAGGCAACACCGGGTATGTTTGGATACAACAC
CGTACAGTGTTAGAAGAAATCGTTTGTGTGCATATGAACAGGTTTGGAATGGGTGAGTTT
TTCGTAATGCAAGGTTTTACAGGAATCAATCAACAATCAATCGTATTTATTGAGCACTTA
CTGAGAGCAGAGAACTGTGCTAAGCACTTGGGAGAGTACAATATAACAGAGTTGGTAGAG
GCATTCCCTGCCCACACTGAGCTTACAGTTTAGAGGGTGCTAACAGTCCAAAGGAATGCT
ACACTTTCCTTAGTTGAGAACTGGGTGAATAGTTTTTGCCCCAGCCGACAGTGTAAACAT
AGCATACGGATTCAAAGCAGAATTATGAATGAAAGAAAAGAGTGGTTTCAGACTTGGTAT
TTAGTACCTATTAGAGTGCCCATTGTGGAAATCAGAATTACATTTGGCATACCCCAGGAT
CGATTTCTCTGTGGGGAGTGCATTGTTTATCTTGTTGGAGCTGAGAAAGAGACGAGTTGA
ATGGAGGAAGAAAATAGAGAACTTAGTTGCTCCCATTAAGATGGAGTTCAGCTAGCAAAC
TCATTAAGTAAGGCCCTGAGGCAGTTCTCCAGTGCTGCTCCTGAAACATAAGTATTGCAA
ACATCTTTGCATCATTATCACAAATGACCTTGAAGAGAACCAGAGACCTCATAACTTTGA
ATCCATTGCATTGATGATTGAGGGAAAACTTTGATTTTTCTTTTCTTTTTAGACAATCAG
AGCCTCACACTCTTTTTATTTCAGATACATATTCATAAATCCATCAATCAGTGATATTTA
TAGAGCATTTACAGTGTGCAGAGCACTATATTAACCATTTGGCAGACACATTTCCTGCCC
GTAAGGTGCTTACAGTCAATCAATGAATCGTATTTATTGAGCGTTTACTGTGTGCAGAGC
ATTTTACGAAGCGCTTGGAAGAGTACAGTATAATGGAGTTGGTGGACAAATTCCCTGCCC
ACAATGAGCTAGTGGTTTGTTAAGGGAAGTAAGTTGGCCCTTTCTGACATTTTCTGATCT
CAATGATTTCCATACCAGTGAGCATACCACTGGGAGGAAGGGCGAGGCACTAAGAGGTTC
ATGTTTCAAAGAATGGAAAACTATGCATTTTTTCCCTTATTGAGTTCCATGTTGTGATGT
CATTATTTTTCCAGCTTTGTTTCCATTCCACATTCCTTATAAGGGATTTTTTACTGAGCT
TTCATGGTGCACGAGTGTAGATTGAGCTAGAACAGCAGTTCTGTTCTGACCACACAGTAA
TAGTAAGAAGATGATGAGGAAAAAGATGAAAAAGATTCATTTTTCTTATTGCTTATTATT
TTTACTCTACTTTTATGTGTCAAAGCACTGTGCTAAGGACTAGGGATGATGCAGAGCAGT
CAGATGATTCACCATTCCAGAGTTCACAGATTAATCTGGTCCTTTTCTGGGTCCAACTTC
CAGGCACTTAAATTTCAAATTTTTATATGCAGATTAACTTTTTTTTCTTTCTCTTATAAT
ATTTCCCCAGTTGGGAAGAAGCCTAAAAGCACTTATGTTACTTTTTCTTTTTAGAACTTC
TCTTTCCAGATTTCGTGCTTGTCTTCTGTATTTGTCTGTTTACATACGATGATACCCAGA
GACAAGACTGTGAAGTGAGTTCAAAAAATACTAGCTGATGTACAGTTAAAATATGAGATA
TGACTAAGGCTAGAAATGACAGGGCAGTAAGGTCTTTTCATTGTAGGGCAACCAGAAATA
TCTTGGTAAATAGGCAATCAGCTGGCCTTGGCTAGTTCTCCTCAATTAGTTGATTAACCT
CTTGTCTTGTGGGCAGCTTCATTTTGAAGGCCCTCTTGAGAATTTATCTTAAAATGCTTA
ACTTACTTCAAAACCCTTTCACAGTGTTTTTTTTCTACCTCATATATTTCTAGATTTTCT
GTGTCATTTTAAAAAGCAGATTCATTAAGAAGGCACAGAAACTGAAATCAATGGGCTGGT
TCTTTTATTTATTTAATAGGATCCCTTTCTTGCTAAAAATAAAGGGAGAAAATTCACCAA
TTTTTATAAAGACCATAAGTGATATAAGGGGTTCAGGAAGAAGTATTCATAGGCAGGGAT
TTATCTATGGTTAGCTCTGCAGGTGAAAACTCACACGAGTCATAAGTAATGTAAAATCAA
AATCTTTTGATTTTATGAATTCAGCTAGAAGAACTGGCTTTTGAAAATTCTCCAGTGCTT
CCGATGTCCTTTGCCTTAAAATATGGCCATGTCTCCTATACACTGAAAAAGTCATCATCA
TCATCCTTACCATGTGTTTAAATGTAGTAAGCACTAGGGTAGAGACCACGTAATCAGGTT
GGGTAGAGTCGTTGTGCCACCTGGGGCTCACATTTAAGTAGGAGGGAGAACAGGTATTGA
CTCCCCATTTTACAGATGAGGAAATTGAGTCACAGAGAAGTTAAGCGATTTAGCCAAGCA
GGGGACGGTGCTGGGATTTAAACCCAAGTCCTGACTTGCAGGCCTACGCTCTTTCCACGA
GGTCACACTGCCTCTCCCCATCGCACCCACTAGATAGCACCTCATCTCCTGTTCTTGCCT
ATACTACTCAAATAAATAGTATATAGCCTCTGCCTCCATTTCTTCTTCAAATATTCTTTT
CAGTCAGAGTTGGGATAGCTCTTAATATGGTTCCCAGTCACCTCCTTGACCATCCTGCTC
TTATTGGCATGGTAAGCAATCTTCTACCCCTAGAGGCTCTCTCCAGCTGTGATAAATGCT
ATTGATTGATTATTGACTATTTGAATTCTCTCTCAGTAACCTCCTACATTCAGTCTTCCT
CCACCCTGTCATTTCTTCCTCAATGGTATTTTTTAGTTCTGTTTTTTTGGCTTTGCCTTT
TTAATCACTAGCTGGGTTTAAGCCATAATCACCTCCGAGCAAGATTACAACAGCCTTTAT
TCTTGGTCTCCTGCCTCGATTGCCTTTTTTTCTTCAGTTGCACAAATCAGTTTTTAAAAT
GTCAGTCTTTTTTGTTTCTGGATTGTAATAGAAGTTCCAGACCGTGGTTTCATTCATTCG
TTCAATCGTATTTATTGAGCATTTACTGTGTGCAGAGCACTGTACTAAGCACTTGGGAAA
GTGCAATGCAATAATAAACAGTGATATTCCCTGCCCACAACAAGCTTACAGTCTGGGGGG
GAGACAGACATCAATATATATAAATAAAATTAAAGATATGTACATAAATGCTGTGGGGCT
GGGAGGGGGAAGAGCAAAGGGAGCAAGTCAGGTCAGTGCAGAATGTAATGGGAGATGAGG
AAAAGTGGGGATTAGTCTGGGAAGACCTCTTGAAGATGTGCCTTCAATAAAACTTTGAGA
GGGGTTGGGGAGAGAGAGTAATTTTCTGTCAGATTCGAGGAGGGAGGGCATTCCAGGCCA
GACACAGGACGTGGGCTAGGGGTTGGCGGTGAGGCAGGCGAGATCGAGGCACAGTGAGAA
GGTTAGCACTAGAGCAGCAAAATGTGTGGGCTGGGCTGTGGAAGGAGAGAAGCGATGTGA
GGTTGGAGGGGCAAGGTGAAGGAGTGGTTTAAACCAACGTGAGGAGTTTATGTTTGATAT
GGAGGTGGATGGGCAACCACTGGAGGGTTTTGAGGAGAGGGTAGAACGTGTCCTGAATGT
ATATGTTGTAAAGTGATCTGGGCAGCAGAGTAAAGTATGAATTGGATTGGGGAGAGGCAG
AAGGTTGTCTAAAACTGAGCTCCTTATCTTCCCTCCCAAACCCTGTCCTCTCCCTGACTT
CCCCGTCACTGTGGACGGCACTACCATCCTTCCCGTCTCGCAGGCCCGCAGCCTTGATGT
CATCCTTGACTCAGCTCTCTCATTCACCCCACACATCCAATCCGTCACCAACATCTGCTG
ATCTCACCTTCACAACATCGCCGAGATCCGCCCTTTCCTCTCTATCCAAACTGCTAGCGT
GCTGGTACAAGCTCTCATAATATCCCGACTGGATTACTGTGTCAGCCTCCTCTCGGATCT
CCCTTCCTCCTGTCTCTGCCCGCTCCAGTCTATTCTTCATTGCCCTGCCCGGATCATCTT
CCTACAGAAACGCTCTGGCCATGTCATTCCCCTCCTCAAAAACCTCCAGTGATTGCCTAT
CAACCTCCTCACAAAACTCCTCACTCTTGGCTTCAAAGCTCTCCATCCCCTTACCCCCTC
CTACCTCACTTCCCTTCTCTCTTTCTGCTGCCCACCCTGTATGCTCCGCTCCTCTGCCGC
TCACCTCCTCACTGTCCCCCGTTCACGCCTATCCCTCCGTCGACCCCTGGACCACATCCT
ACCACTGTCCTGGAATGCCCTCCGTCCTCATTTCCGCCAAACTATCTTCCCCTCTTCAAA
GCCCTTCTGAAGGCTCACCTCCTCCAGGAAGCCTTCCCAGACTGACCCCCCCTTTTCCCT
GTGCTCCCCCTCCCCCCCGCTCTTCCCCCTTCCCCTCAGCACTGTGCTCATTTGTATATA
TTATTTATTACCCTATTTATTTTGTTAATGAGGTGTATATCTCCTTGCTTCTATTTATCT
TGATGATGTCTTGTTTTGTTTTGTTCTGTTTTGCTTTGCTGTCTGTCTCCCCCGTTTAGA
CTGTGAACCCGTCATTGGGCAGAGATTGTCTCTATCTGTTGCCGAATTGTACATTCCAAG
CGCGTAGTACAGTGCTCTGCACATAGTAATCGCTCAATAAATACTGTTGAATGAATGAAT
GAATGAATGAATGAATGAATGAATGAGGTCAGCAAGGAGGCTGATGCAGTAATCAAGGCG
GGATAGGATGAGTGATTGTATTAACGTGGTGGCGGTTTGGGTGGAAAAGAAAGGGTGGAT
TTTAGCGATGTGAAGGTGAGACCGACAGGATTTGGTGACGGATTGAATATGTGGGTTGAA
TGTCAGAGAAGAGTCAAGGACAATGCCAAGGATACGGGCTCGTGAGACAGGAAGGGTGGC
GGTGCCATCTACAGTGATGGGAAAGTCTCGGGGAGGACAGGGTTTGTGTGGGAAGATAAG
GAGCTCTGTTTTGGAGCTGTGTTTCAAATCATCTGGCTCCCTCAAAATTAGCTGCCTACG
TGTCTTCCCCCCTCCATTTTATGCTTCCCATTTATCCTGATTTAATCTTTTAACTATTCC
CCACACTTGACTCTCCTGATACAGACCCATTGCTCATGCTATTTCTCCCACAAAAATGTT
GCCTTAAATCTGCTTCACCAAACTGCTTCCTATTTCTGCCACAGAAAATGCAGTAATTAC
ATCCTACCAACAATTTCCTTCAAAGTACTCTTAAAAGCCTACTTTTTCATGGGGCATTTC
TCTTATTAAAATTCCCATCTCTCCGGTCATGCCATTCAGCGTGGCGTAGTGGATAGAGCA
CGGGCCTGGGAGTCAGAAGGTCGTGGGTTCTAATTCCGGCTTTGCCACTTGTCTGCTCTG
TGACCTTGGGCAAGTCACGTCACTTCTCTGTGCCTCAGTTACCTCATCTGTAAAATGGGG
ATTGAGACTGGGAGTCCCAAGGGGGACAGAGACTGTGTCCAACCCGATTTGCTGGTATCC
ATCCCAGGGCTTAATGCGTAATCATCCCGCCCCTCCTACTGAACCTCTCCGATCTCCTTC
TACAGCTCAGCTTGCGAACCTCACTCCCCCAGTGCCAGTTTGCTTACTGTGCTCGATCCC
ATCCATTTTGCTGCCGATCCCTTTTCCACATGCTCTCTGTAGCCTGGAACTCCCTCTTCC
TCCATATATGCCAGACCACCTTTCTTCCCACCTTCAAAGCCATATTAAGGTCACTTCTCC
TCCAGGAAGCCTTCCCCAATTAAACCCTCTTTTCCCTTGCTCCCTTTCCCCTTTGTGTCG
TCTGTGCACTTTTAGCTATATTCTTTGAGCATCTGGTGTTCACCCCACCCTCAGCCCCAT
GACACTTTTGTACATATTTGTAAATTACATCAATGTCTGTCTCCCCCTCTAGAGTGTAAG
CTCATTGAGAATAGGGAACATGTCTATTATTACCGCTATTTATATTATTCATTCATTCAA
TAGTATTTCTTGAGCACTTACTATGTGCAGAGCACTGTACTAAGCGCTTGGAATGTACAA
ATCGGTAACAGATAGAGACAGTTCCTGCCCTTTGACGAGCTTACAGTCTAATCGGGGGAT
ATATTATACTCTCCCAAGTGTTTCATACAGTGCTCTGCACACAGTAAGCACACAATATAT
ACCATTCATTGATCGTGGGCCTAGGCCTTGTGGTCATAGAGGAATTTGGACAGTACTGCC
GATTTGCAAACCTGTAGTTTAATCTGAAGCCTGATGCTGTGTTATCAGCACACTCTGATA
GAGTCAGAGTGTGGGAGTATAAAGTATATAGGACAACTATATATATATATACACATATAA
ATATGAATAATATGCATATTTCCTTAGCACCTACAGTACTAGGCTGCTGTAGTGCATTTT
CCAAGCGTAGTGAATTTTCTCATGTTATCATGCCCCATTTACTCTCCATACCTAAAGTAC
CTTCCCTTGATGCAAAAATTGATGCTCTCAACACTACCCTCCCTACTCAACGCATCAAAC
TCCCCACTGTCTTTGCCGATTTCGTACCGCTAACCCACAGCCCTGGAACTCCTTACCATA
GCACTTAATCAACTTGCTCCCTCCTAGTTGCCTCATTGATTTCCTCCTCTAACTAACAAA
GAACATTGACTTTGCTCCTCTAACACCTTACTGTACCTTTATCTCTTCTATCCTGCCACT
GACCCCTTGACCGTGTGCTGCTTCTGCCCCGGAACTCCCTCCTCTTTATATCCAAGAGTC
ATTTTCCCCACCTTCACAGCCTTACTGAAAGCCTCTCTCCTCTAAGAAGCCTTCCCCGAC
TAGGTCCTCATTTTCTCTTCTCCCACTCCCTTCTGTGTTACCGTTGCATTTTGATTTGTA
TCGAATGTATGCATCCATAATTTATTTTAATGTCTTCCTCTCCGCTACCTAGACTGTAAG
CTCCTTGTGGGCAGGGAAGGTGTCTACGGACTCAGTTATATTGTACTCTTCCAAGCATCT
AGTACAGTGCTCTGCACCCAGTATGTGCTCAATAAGTACAATTGATTGATTAGTGCAATG
TAGAGCTCATTGCAAATTGCACATTCAGGCAAGTCGAAGTAGCAGGGAGTCTTGCATGTT
GCTCTTTATTAAGAGGGAAAGTCTAAGGATGGAGAAAATGAATCATCTTAATATATATAA
ATAGCTTGTTTTCAAAGATGATGCTTAATATCTGTGATTAGCACATTTGAATGTATTTAC
ACATTAACTTAAGTAAGGATGTTTGAAGTAAAGCTTACAAACAGTTCAGACAAGGTAAAT
TCCCTACTGTTTTCTGTAGTTCCACTGTTCTACCCTAAAGCAACAATGTTGTAGATAATA
TCACGAGAACATAAGCAGTGCCAAGGTGGGTGAGACTAAATGGTCTTTCTGACCCAGTAC
TTTGAGGAGCAGCATGGTCTATTGGAAAGAATCCTGGTTGTCAGGGGAGCTGGGGTCAAA
TTCCAACTCCACCACTTACCTGCTGTCTGACCTTGGGCAAGTTACTTCACTCCTTTGGGC
CTCAGTTTCCTCATCTGTAAAATGGGGGTTCAATACCAGTTCTCCCTCCTACTTTGAGTC
CCATGTGGATTAGGGGCTGTGCATGAACTTTTATCTACCCCAGCGCTTAGAAGAGTGCTT
GACACAGAATACACACTTAACAAATATCATAATAATAATAGTAATCACAGAGGCAGCAGA
ATGCTTGAGAAATGATATGTTGGGTGCCTTGCTTTTTTATGGTATTTGTTAAGCACTTGC
TATGTGCCAGATACGTACTCAGTAATAATAATAATAATAATAATGGTGGTATTTGTTAAG
TGCTTACTATGTACAAAGCACTGTTCTAAGCGCTGGGGGGATACAGGGTGATCAGATCGT
CCCACGTGGGGCTCACAGTTTTAATCCCCATTTTACAGATGAGGTATCTGAGGCCCAGAG
AAGTTAAGTGACTTGCCCAAAGTCACACAGCTAGCAAGCGGCAGAGCCAGGGGTCGAACC
CATGACCTCTGACTCCGAAGCCCAGGCTCCTTTCCACTGAGCCACGCAGTTCAAGCTAAT
CAGGTTGGATGCAATCCGTGTTCCACATAGGGCTCACAGTCTTAATCCCCATTTTTCAGA
TGAGGTAACCGAGGCAAGGAGAAGTTAAGTGACGCTTCCATGATCACACAGCAGACGAGT
GGTAGAGCCGGGATTAGAATCCTGATCCTTCTGACTCCCAAGCCCGTGCTCTACCCATTA
GGCCACGCTGCTTCCTCCCTATCCAGCCACGTGGATCATTTAAGGTTGGAGCTAAGGGAA
GATCCGTATGGCTGGATCTATCTTCCTTCAGCTCCAACCTTAAATATCAGCCATCCTAAC
AAAAACGATGCAACATTGTATGCATGCAAAGGTTGTTCTTTGTTAGGCTTAGGTTCTTTC
CATTTGCAGGGCCTTTTGCTGCATTTCAAATCTATCTGCCTTCTTGGCCTCCTCCTTTTT
CAAAAGTCTGTACTCAAGGACAGGAAGCCCTCTCCCGATTGCTATAAACAAACCTGTTCT
ATCCACCGCTGCTGTCTCCCAGTGGTCTGCTGTTGTACCACTTTCTTTACAGCTGTGCTT
CACTCTGTGTTCAAAATATTTCTTCTGCTTGCTTATCCTCCATTTCAGTTCATCAGTAGA
GCAATTTTTGGGGTACCCTGGGTACCATTCTCCTCAAACGTCCTCTCGGTAACCTTTCTT
AGACTTGTCGTCCAAGAATTTATTCAATCCCTCCTTGAACCGACTGGATATTTTCTGCCT
GCAGAATTTCCTGTGGTCAAGAGTTCTTTATCACTAGCTGTTGTGAGAATGGCAGAAGCT
ATTGCCACTGAGCAGGGTAAATGGTACCGAGAAATACTCATCACAGCGCTGCGGAATCAG
GCAAAGCATGTGAGGAGATTGGGTCATAACAGGACACCAAGAAGCTGCTGTTCGTCAAGT
TGAAATGGGGCGGGGAAAGCGGAAGAAACATTTTAAAGATATATCAGCGAATCGGGGATT
GTGGCAAGAAAGCTACACAGCAGAGTTGGGGGTGCTGGCAATTAGGAGGAATGCCGTTCT
CTTCAGAGAGAGGCTTCAGGCATATCGAGATACTAAGAAACTGTTGAAAGTGCCCGACAC
CATTCTGCAGGCACGGAGTGACATTGCAGAGGCTGTGAGATGGCCTACGGCTATATAAGA
GGTGCCTGGATTCTATTCCTGACTCCGCCGCTTGCCCGCTGTGACCTTAGGCGAGTCACT
TAACGTCTCTGTGCCGCAGTTTCCTCAACTGCAAAATGGGGATTCAGTACCTCTTCTCCT
TCTGAATGCGCTCCATGAGAGAGTCCCACATGAGATTGGGAATGTATCTAGCCTGATAAA
TCTGTATCATTGGGACTGTGTCTACCCCAGCACTTAGAACGGTGCTTGACACATAACGAG
CACTTAACAAATACTATAAAAAAATAAAGAGAGGGTTGGGGGGCAGGAGGACACTTCCTG
AAAAGTGGGAATCAGGGATTCCTGGAGATCAGTCATGGGGCTCTAGAGCCAACTGCAGAG
GAGAATGAGAGTCACGTCTAGGGCTAGGGAGTTGTGTATGAGGAACTCCTCTGGAGAAGA
CAGAAAAACATTAGGAAACTGGGAATCTCTAAGGAAGCAGTGAGCCCTTGTTACTCCATC
CCTTTCCTTAGTTTAATGTGGATGTTCCTCTCAATAGATGTGGAAACTTTAGGGCAGGAG
TGAATGCTTTTCGAAGTTCAAATCATGCTTGGGTATCGGGCCAGTAGTTTCTCAGTTTCT
TCAGTGTGCTTCTAACAGTGGGTTGGTGGACAAAGATGAAGTGGGACAGCCTTTTCCGAG
GATACACATTCATTCATTCATTCATTCAATAGTATTTATTGAGCGCTTACTATGTGCAGA
GCACTGTATTAAGTGCTTGGAATGTACACATCGGTAACAGATAGAGACAGTCCCTGCCCT
TTGACGGGCTTACAGCCTAATCGGGGGAGACGGACAGACAAGAACAATAGCAATAAATAG
AATCAAGATATTCCCACTGTTGGCTTCACTCTGCCACTGATCTCTGCTGTCACTAGGGTC
TTGATGTCACCTTCAAATACTAAGGGATCAGGACTGATGTTNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCCCTTGCCATCCC
CTCAGCACTGTACTCGTCTGCTCAACTGTATATATTTTCATTACCCTATTTATTTTGTTA
ATGAAATGTACATCGCCTCGATTCTATTTAGTTGCCATTGTTTTTACGAGATGTTCTTCC
CCTTGACTCTATTTATTTATTGCCATTGTTCTTGTCTGTCCGTCTCCCCCGATTAGACTG
TAAGCCCATCAAACGGCAGGGACTGTCTCTATCTGTTGCCGACTTGTTCATTCCAAGCGC
TTAGTACAGTGCTCTGCACATAGTAAGCGCTCAATAAATACTATTGAATGAATGAATGAA
TGAATCTCTTGTTACTATTTTTCTTTTCTCCTCCCCTATCACCCCTTTAATCTGTGAGCT
CCTTGCAGGCATGGAGTGTGTCTACCAACTCTATAGTATTGTACCCTCCCAAGCACTTAG
TACAGAGCTTTGCATACAATGAGTACTCAATAAATACCATTGATTGAATTTTTGTGTGTG
TGTGTTTCCCCAAACACCCAATGTGGTGCTGCAAACAGTTATTTTCAAAAACACTGTTGG
TGATGATGTCTACCTTTCACTTTCTCTCCCTCTCAATTTTCCACCCTCCAATCCCAGGTG
AAACGCCAAATTGGGAAAAGTGTTTCCAGTGTGCCCATTTTAGCACCACTTGGCTCTGGG
AGAAAAGTTAGGTAGATGGAAAAGAAGAAAGAAATTTACAGATTTAACTTTTTACCAAGG
GACCCTTTTCTTTCTGAAGCACGACACTTATAGCTGAAGACGCATCAGAGTTCATTATAA
ATTTCATTTTCGGTGCTCGAAATTTAGAGGTTGCTATCTTTGACTTGTGAGAAAAATGGA
TTTGCCATGTTTCTCCTAATTTTGATTCCTTTTTGTATCGGGATATGTTTGAAGTGACAT
CGGTGGTAAACAAGAATACTATTAAATGATAGGAAGATGACTTTTATCTGTGCAAATCTG
ATGGAGGGACCAAGAAGTGTATGCAAAATTGGTAAAATTTGCCTGGGTACCTTTTTATCT
GGAAGTGAGAGAATAGCACTGTCTTCCCCGATTGTACTAGGCCACAAATAGACAATCAGG
TGCAACCCCATGAGACAACCCGGTTTGGAACTCAGGTGTTGGTATTTCTCTTAGAGAATC
GAGTAGTGGCTAACCAAATTCTGGGTATACACGTGAACCAGAGGTGTTTGGGTGGTGAGT
GTAATTTAGCCCAATGGCCTTCCTTGTGTGATCAAGAAATATACAAGTATTGTCCCCATA
TGCTTATATCTTTCTCACACAGACACCCCCCCCCCCCCCACTCACTCCGTGGTTGGCCCC
ATTGCAAGGCATTATTATTACAGCGTGCACTAACCGTCGGCTGAGTGAGTACAGCATTTG
CAGGGCAGGACTGAGCTCCTCCTAATTCCCAGGTGAATCCCCTCAGGTCTCCCAGGTTAG
GACAGCTCTACTTTAGCTCAGCCCAGCCCACACCTTGGCTCTTGTCTTGTGGCCCATGGA
AGGGAAGGCAGGACAGCTACAGTCAGGAAGTGACGATGGTGGCCGGGGGACCGGAGAGAG
TGAGGCTATTGAGGTGGCATTAACCTGCTCTAACTACTCAATATTGGGAAAATATTTAAG
TCACAGATTTTTTTTTTTCCAAAGGAAAACGACCCCATTTTTGTCTTCATTATCTGGAGC
CCGAAGTAAGCAACAGGAATCCATAGTGTTAAAATGCCCGTTCTCAAAGACTTAAGAATC
TAAAAAAAGAATCTATTATTTGAGTTTATCATTTAAATTTATAGTCCCTTTGCACCTACA
TACATCTTTGCAATTAATCTTTCATTTAATTTCTTTCCAATAGTCAATGTGTTACTTAAA
GTTATGTTGTGTATACATCAGCCAGGAAAATCTCCAGATTCATTAAGTTGAGAGTGATTT
TGATGTTTTGTTGCAAAATAAATCCATAATTGTATTTATAGCATCATAGTTGTGTACCAG
CAAATCTTTAACGTTAGCATTCTGTTTCTTAGATTAATTTTGAATGACAGACAAACATTT
CCCAGGCTAACTGGCAATCAATAACAATACCAGGAGTACTGATGCGTGTTTTCATGCTTA
ATTGTTTGCTTTTGTCAGGAAAAAAATTGCATAACTACTTTCTAAGGAGTTAATTCAGGG
AAATTCTCAAAGTGAAACCTGGAAGACAGAAGGTTTGCCTGCAGTGTTTGCTTTTGTAAT
TCTCGTTAGACTCGATCTTTTGGGAATTGTGTTGTTTATTATTGCTAATAATAATAACAG
TTTAGATGTGGAATACACATTTTCATTTGAGGCAGCAAAGAACTGTTTTTCTCATTCTAC
AGAGAGGGAATTTTTTTAGAGATGTTAATTTGCCAAAGGTCTCACAGTTGCCAGCTCTGA
AATGGAACCTGTGACCTGATGTTTAGAGTCCTGCTGCTCTAACTAGGAGCTAAGACGCCC
CATCTTCAATATTGAACACTGGCGTTATAGAAGTTATTTACGGAAGTGACTCATGACCGA
AGAATGTTCAGTTTAACCTGCTTCCTCCAAAAATGACTTGCTACTGTATGTGTAGCTACT
GTAGCTACTGTATTTTTCAATGACCCTCAATAACAGTCAACATTTTAAGATTTCTCCAAG
AAGAGTTGGAGGGATATCGAAGCTTGGGACATACTAAACACAATGGCGCACATTAATATA
GATGCCTAAAGATGCCTCAAGTGCTTAGTACAGTGCTCTCCACACAGTAAGTGCTCAGTA
AATACGAATGAATGAATAAAGAGGGCCAGAAACTCATTGTTAGGAAAATGCCCCCAACCA
CCCATCACCACCACCATAACTAGCCTTCAAATTATTTTCTGTTGTCCTGAGTTTATTTTG
GGCATCTAAGCAGTAAAAAAACAATGCTGCTGTGGTAGTGCTTTGTGGTAAGGCATAGGA
TTTCCAATCAGACATTTCTCTGAAAAGAGTTTTTCTAATATGGAACACCGTGTATCATTT
GGTCTGAGTAGACATACTAGGTCAAGTATTCAAGGCTAGATTTCCGTGTGTGAAAAGGAT
ACAAGCGTAATTGATTTGCCCACACTGTTTCTATCTTGGAGAACTCACAAAATGATCTAA
AGATCTTTTTTTTTTTTGTAATAGTAAAAAGTCACCTATGGTGCCTTTCATCTAGGATCT
CAGAGTATTTCACAAGCATTCAAACTCGAATCTCCCCTTCCTGCCTGAGTCTAATTTGCT
CTCCCTGGGGCCCTGCATGCTCATGTTAAGAGTGATTCTCCCCTTACAGCAAGCATCTTT
GTCTGTGTTCTGGAGATTCTCTCACGGCAATAACAACCAAGGTTTGCACCCAGAAGTAGC
TTGTGCACCAGGCGTAGCCCTCCCCAACACTATTTTTGAGGTGGGTTTGAGTGCCCAGAC
CTAAACAATCTTTGAATGCATACTTTTTTCAGCACACTGCACTAAGCAGTTGGAACGGGA
CAGTGGGGATAGTAGATGTGATCCCTGCCCTAAATAAGCTTTGGAGCCTAGATGGGGAGA
GATACACCAAAATAAGTTGGTAGAAGGGAGAAGCAAAAGAGTTTAAAGATATGTAGATAT
GTGCCTAAGTGTTGTAGTGGGGAGACGGGGAGGTGAGTGACCAAAGGCTTAGGAAATGCA
GATACGCTCAAATGGCAGTAGAGGGGAGATAGGCTAGGGAGATGAGAGATGGGGAGAACT
CTAAATTTTTTTTTATATATTTAAGCGCTTACTATGTGCCAGGCACAGTACTAAACACTG
TGGGGTAAATATAAGTTGATAAGGTCGGACACGGTCCGTGTCTCAGGTGGGGCTCACAGA
GTTAATCCCCATTTTACAAGATGAGGTAACAGACCCAGTGACGTGACTTGCCCAAGGTCA
CATAGCAGAGCAGTGGTGGATCCAGGATTAGAATCCAGGTCCTTCTGACTCCCAGGCCCG
TACTCTGTCCTCCAGACCAAGCTATTTCTACCCATCACCATCGGTATGCTCTTCCCGCCT
GTTGATATCATCATCCGTCTGGCCTGCAGGATTCGTGTTGAAGAGCATGTGGGGAGAAGA
GCCAGGGAACCACCGATTCAAGGGGAGGGAGCATGAAGCTCCAGCCGCCTTAGTACACTG
CATCACCAGGTCTACCGAGGTGGGGAGGGAGGGAGAGTGGAAGATCAGGAGGGCTGTGCC
TTAGGTGCAAACATTTTTAGTCATGGTCCTTCCCCCATCCACCTCCCTCTCTGGCTTGTA
CTCGAGGTACAGCTCATGACTACACCCAATTCTTCCCAGTTTTCTCCTCGATTACCTCTA
TCCCCTTTCCGATTTGACAACGGGCAAAAATCCCATCATGTTCAGTTGGTTAGACCGGCC
TCCCCGACTCTCCTCAATGAAGCATGCATTCAGGAGTACAGTTAGAATAGGTCTGCCTTG
TGTAAATGCCTTGTTTGTCTTTTTTTTTTTTCCAGTCATCAGGGGAATCCATCAGTTGTC
TCATTGAGTTGCTGGGATAGATCGAAAGTATCAATAGCCCACTTTTTGCCCATGAATAAT
AATAATAATTGTGGTATTTCTTAAGCGCTTATTATGTGCCAGACACTATTCCAAGTGCTC
GGGTAGATACAAGGTCATTGGGTCAGACACGGTCCCTGGCCCACATAGGGCTCACTGTCC
TAATCCCTATTTTCCAGGTGAGGTTACTGAGGCCCAGAGAAGTGAAGTGACTTGCCCAAC
ATTACACAGGAGACATGTGGCAGACTGGAATTAGAACCCAGGTCCTTCCAACTCCCAGGC
CCCTGTTCTACCCCCTAAGCCATGCTACTTCTCCAGTGAATATAAAGCTGGACCTGGGGA
AATTGAGTTGCTGTAAGTTCAGACTCAACAGAGCAAAGCCAGGAATAGAGGGCATCTTTT
TGCCTCCACATGTGCTTGTCTGATCCTCACAGGCCACACCTGAGAAATTGTCTGGCACCC
ACCACTGGGCCGTTTCTGGGGAGCCTGTGGCACCTTATGGCACCCCAACCACGTACCTCT
AGACGCTTCCCTTCACCTTGGCCTTCTGACAACAGAAAGAACTATAACTACATCTGCAGA
AATTTTAAACAGTCCTCTGAGGAAACCATCTGACAAAAAGTACAATATTTTTAGAAATAG
ATGTGTGAATGCACCTGTTCATACTCACAGCAGTGCACAGAAAATATTCCAAACCCACTC
CGTCTGGTGAAATGGTTGTTTTTCTAGATTATTTGACTATTTAACAACAGCCAAGGGATA
AGCAGATGAACCAATATTTTCATTTTGAAATGAGGGAGACATCCTACCAGCATGACAAGA
CAAGGAGAGACATATTATGCTCAAGGGGAGGGAAAGAGAGATGGTAGTGTCTTCCTTCCT
GGCCTCATTTGAAGATTCCTGCAATGGAATATTGTGAGGAGTGTGGAGATGTGAAAGCTC
TGAGTGCTTTAGAAGGAAATTATTTGATTTATGTCATGTAATTTGTTCTCACTAGTATTT
CTCTCCTTCCCTCTCTCTCTCTCTCTCTCTCTCTCTCCCCCATCACCTCTCTTCTCTCCC
AGGAGTGTCCCTGTCTTGCTCCTTCTCCCAAACCCTATTTATTTTCCTAGCACAGATAGT
AGTCATATTTTGTCTTGAGGCAGAAATCCAGGGTCTATTTCCATACTCTTGTCTGTTTGC
CCCACTAGTCAGCCTCCCTAAAGGCCAATGCATGAAATCACAAAGGAGTTGAAGGGCTGA
TATGAGATGGGAGATGATACTAGTCTTAAAATAGTGTTATGTTCCTTTCCCAGACTTCCA
CGTCAAATGTTCAGGTGGGTTTTAGGGTTAGACAACACGTGGGATGAGAAATTATGCAGG
AGGGGAGGGAGTGCAAACCAAAGAACCCCAGATTTTCCCAAAATTTTTAAATTTGAAACC
ATCACAAAGAATATAATTGAAACTAAAGATGGCAGCTCTCAAGTAGAGATAATTAACACT
TGCTAATTGCATCATAATACTGATAAACTCAATGAATAATCCAAGTTGATTTGATACTGG
GCAAAAAGTAATTCTCTTTGTCACCTTTTAATTTATGAAAATATCCAGTCATTTTTGAAA
AGAATGAATTGAGCTGTTAAGTTGCTAATAGCCTTTACCGAGTGTTTACTTCATAAAATG
TGACTCAAAGATAATAATAATGATTATATATCATAAAATATTACTTATAGTAAAGATGAC
TATCATGTTAAAGAAAAAAACTTTTTGAACTCACCCGCTAATAAATCTTAATGATGAATG
GGAATGCAGTACATTGCCTGAATCTCATTTGTGCCCAAGAGCAGAGATTGAGAATGTTTT
TGCTGTTACGTTATCTGCGTGTCCATTTCTTCAAGGAGAAGATTCTATTTGGATCTGTCT
AGGTGAAGTTCCCATCCATGCCACACTGGGTTGACTAGGCATAAATTTAAGGCTCTCTTC
CTGCCACTTGGAAGAAACTCATTTTTGGGGCCAGGGAGTAATAATAGTAATAAATAGTAG
CAGTATTTGTTGGGTGTAGGGCACACTGTGGTAGGGGCTTGGGAAGTCCTAAATGAAGAA
AGAACAATTTCCATCCACAAGGCATTTTCACCCTAATGGGGGAGGCAAACTGGCAGGAGA
GGACATGCGACTGCAGGAATAAAGTGCTGCTGCCCCTCCTCTTCCCTTTCCTCCTCCTCT
TCCTCCTCTCCCTCATCGTCCCCCTTTCTCCAGCTCCTGCTTCTCCTCTCCCTCTTTCTT
CTCCTCCTGCACTTTCTCCTCTTCTCTTTCCCTTGTCCACTGTTTCTTCGAGGCTTCCGG
TGTGATGGTGGTGGGCACAGAGCCGACTTTCCAGAAACTTCCAGAATCATTCAGCCAATT
GGATTTATTGAGTTTTTACTGTGTGCAGAGCACTGTACTGAGTGCCTGGGAGAGTACAGA
ATAACACTCTGTGGGCGTGGAAATGGCAGCAGCATAGAGAAGGAGGTGGATGCAGAGGAA
AGGCCCAGTTATTTAGAAGCAGCAGCAGTGGGGAAGGGGAGAGGTAAATATTATCTTCAT
TACCCTATTTATTTTGTTAATGAGATGTACATCACCTTGATTCTATTTATTTGCTATTGT
TTTAATGAGATGTTCTTCCCCTTGATTCTATTTATTGCCATTGTTCTTGTCTGTCTGTCT
CCCCCGATTAGACTGTAAGCCTGTCAAAGGGCAGGGACTGTCTCTATCTGTTACCGATTT
GTATATTCCAAGCGCTTAGTACAGTGCTCTGCACATAGTAAGTGCTCAATAAATGCTATT
GAATGAATGAATGAATTTCTACGTTACGTGTATTTTCTCTCAGTGTCTCTGAGCAGTTGT
AGGCATATCTGACTTTATGAATGTACACAGGACTATGTATCTGTGGGTGTGTGTGTCTGT
ATAGCTAACAATGTGTGTCAATGGTGTGTCTGCGTGTTTCTGACTGCCTCCTGGGTCTAC
ACGTATGTGAGTCTGTAATCCCTCCCTCATCCATGTCCACCTCCACCCAATCTATTTCTC
CTCTCTCTCTTTTTAAAAATGGTATTGGTTAAGCACTATGTAGTGGGGTAGATACAAGCT
GTTCAGGTTGGACACGGTCCCTATCCCAAATAGTGTTCACAATCTTAATCCCCGTTTTAC
AGCTGAGGTAACTGAGGCACAGAGTAGTGAAATGACTTACCCGAAGTCACACAACAGATA
TGTGGTGGAGTTGGGATTAGAACCCAGGTCCTTCTGATTCCCAGGCCCATGACCACCAGA
CCACACTGCTTCTCTTTGAATACGTATTACTCTGGCTGTCTTTCACTCTGTGGCCTTTTC
TCTGGATCTCTATATCATTGACTCTCCTGTCTTTTGACCCTACCTTCTTTTCCATTTATT
CTGTGGAAAATCAGTTTACTTTGCAACTGAGACACCAGTACAGCTTGCTTCAGGTCTCCA
TTTGGGGGATTTCTGGCAGACTCAGGGTATGAGGGCCATCGGTAAGAGGTTGGGCCAGAT
GTTGCAGTATGGACCTAGTAGGCAGCTGGACTGGTCAACCCAATCTCATCTTCAGCCTCT
ATCCGCCTCCAGCCTCCCGAAGCAGTTCCGAGTCCTCCAAGATTCAGTCTCTTTGAGGCC
TGCAACCCCCAGATGGTTTCAGCTGCCCTGAAACAAAGGGAGGTTATTATACCATACCAG
ATCTTCATTTACTCTGGCTCTGGGATTAGCAGAAAACACAATATCTTCCTTGATTGCTTG
CGATTTAACCTTCTTCATTTTAAGATCATTTTTGATTTTTCCCCTGCAACTTTCTTCACA
GGTGTTTTCTTGAAAATGATTTAAAATATGTCAATAGCGTGGTGAATTTCTGTTTTACAA
ACTCCATCCTTTGAGAAAAAAGTTGCATTTTGTTTTGCAATGATTAGGAATATACAGCCA
TATGTTAAACACTGCATTTTCATCTTAGTCATAGTCACAATTACTAAGAATTTACTGGGC
ACAGAGCACTGTACTACTTGCTGGGAGAGAATACAGAGGTGAGAAGTAGACATGGTCCCT
ATCCTTCGTGGGGTTATGCAGACAACTCTCCTCACATGTTGCAGCAGTCAAGAATCTTGA
GTGATTGATTGGTAATAGGGAGAATGAGTAGTATTTAAGGAGTGCTTACTCTTCACTAAA
TTCTTGGGAAAGTCCAATACAATCCCTGCTCTCAAGGAGTTTCCAGTCTACTGGAAGGGG
TATGTCTCCACCTCTTCAGATGTTATAAGCACACTGACTCAGTTCACCTCTATAGTCTTG
TTTTCTCTCTTCTGTCCCACACAACCCCAGTAACGAATTTACACGACCGGTAAAATACCA
TAGGATCTTGAACATAGTATAAGGAAAGCAAAACTGGAAATTTAGAGTGAAAGGAAGCAA
GATTGGATAATTATTTTATGGAATTAATGAACACTTGAAGGTGTTTGTGTTGATTCCAGG
GGAAAGGGCACGGACCTGGGAGTCAGAATTGTCCTATCTTATGCTGTCGAGTTGTCTCCG
ACCCATAGTGAAGCCTTGGCCACCCAGAATGCCCCTCCTCTGTCTGCCATTGTTCTGGTA
GTGCATCCATAGAGTTTTCTTGGTGAAAATATGAAAGTAGTTTAACACTACCTTCTTCCA
CGCGGTAAACTTGAGTCTCCGCTCTCGATTTTCTTCCATGCCGCTGTTGCCCAGCACAGT
AGAGTTTTGACTTGTAACAGGTTGCTTTCCAATCTCTAGCCACTGCCCAAGCTAGGAATG
GAATGGATATGTCCCTGCTTGACTCTCCCTCCTGTAGTTGAGACTGGTAGAGTACTGGAA
ACTCTCCAGGTGCAACCCTGATGGGGCGGGGAATCAGAATTCGTGGGTTCTAATCCTGGC
TTTGCCGCTTGCCTACTCAGTGTCTTTGGCCAATTCCCTTAATTTCTTCTCAGTGCCTCA
GCTACCTCATGAGTAAAATGGGGCTAAAACATCCATTCTCTTTCTCTTAGACTGTGAGCC
CCATGTGGGATAGGAACTTTATCTGCTTTACTTATGCTGTGTCAACTCCAGTGCTTGGTA
CAGCGATTGGCACATAGTAAACGTTTAAGTATTGCCCTAATTATTATTTATGATTTTATT
GCAGGTTTTGACTCCTTTTAGAACTGAGAGATTCTTTAGTGGTGGAGCAGGGTGTGTTCG
CTGCTTTCTTTAGTTTCCCCCAAATTAAAAACTGCACCTGTCGAGGAGCTTTTCCTGGAC
AAGGACAACCACATCCCAGACTGAGCCCCTCTTTTCCCTCTGCTCCTCCCCCTTCCCCTC
CCCTCAGATAAGCCCCCTTTCTCTCTGCTCCCCCTCCCCTCCCCACCCCACCCTCTGCTC
CTCCCCCTACCCCGCCCCTCAGCACTGTGCTCATTTGTATATATTATTTATTACCCTATT
TATTTTGTTAATGAGGTGTACATCCCCTTGATTCTATTCATCTTGATAATGTTGTATTGT
TTTTGTTTTGTTCTGTTTTGTTCTGCTGTCAGTCTCCCCTGATTAGACTGTGAGCCCGTC
ATTGGGCAGGGATTGTCTCTATCTCTTGCCAAATTGTACATTCCACGTGCTTAGTACAGT
GCTCTGCACATACTAAGCGCTCAGTAAATGCTATTGAATGAATGAATATATTGTGTTTTT
TTGAATTAGGCAGGCCTCTTCAAGAAACCCTTCTGTATGGATGGACCACAGGGCCTCTTT
TTCTTCTTGTAATCTGCCTCCCCAGCTGAGTCATAACCAGAACCTAGCCATATCAAGCAT
TTAGTACAGCGCTTGGTGCCCAGTGAGTAATTCATAAATACCCACACTACTGCAGGACAG
CATAAGTCCTTTCCAATTGCTTTAGATGAAATTTTCAAAATTTTAATTTTCTTACAAATA
GGAATACATTTTTAGTCCTCTAAAATAAAAATCTAATATTATGATTAAAGACATTAAGGT
AAAGACCTTGAGTGAAGCTTAGCAACGAGCTTGAGATCTCATTTTTCCCTGAAAGAAGCA
TTTATAAATCAAAATCAAAGGTCATGTAATATGGATGAATTAATGGTAAATTATCAATGT
GTTTAGAAAGTTATTTTCGTAATTGTTCAAATTTAAAACTAAAAAAAATTGCAATTAAAG
GGTCCAGGCCATCTTAAATTATAGTACTGTAGCTCTTCAAACAAGCCTTAGCCAAACTTA
AAATAGAGCTCTGTCAGAAAGGTCACAGTTTCAGCCGCTCTGCAGTTATGAGTGCATTTT
GAAGCAAACCAAAAATCATAGCAAATCTAATTTTGATTAAGTACAAATTTAGCTTGATGT
CGGCACTAAGTCCTTCCGTATAGGAGAAGGTGAAGCTATTTGTATCAGAGGAACCAATTA
CTGCTTAGGCAAAGTTAACTGATCTCTTCCTGGGCTATGAAGACTGATTAATGGTTTAGT
TCATCGTTGCTGATTAGTCCCAGCTCAGGTGGCTATCATAGGTGAATCAATTGTGTTATC
AATATAGAATAATATAATAATGGGCAGATTAGGACGGAAGGTGATGGGAGTTCGCGTTCA
CGTAATTGCCGATGTGGAGAGGTTTCCCTTTGGCTGTATCTCAGAATCGTCCAGATTTTC
GTTTATCTAAGGAACGGATCTGGCCACCAACTTCTATTTCCAAGGCAAAATCGATCAATC
AGTGCCGGTTTTGAGCACCTGTTTGAAGAGCATTTAGTAATCCTCGACCTTTCTCTCTCA
TTCAACTCTTGTATTTAGTCTATCACCAAATTCTGTCACAGCTTCCTTCACAGTCTTGCC
TGTTTTGGTGCCAACCCCTTAGTTACGCTATTCCTCTGGCCTGGGTCCCTTTGTATCTGA
CAGACCATCACTGTCCCCATCTTCAAAGGCCTTCTAAAACCATATCTCCTCCAAGAGATC
TTCTTTGACTAATCCCTCATTTTCCCACTCTATTCTCCCTCCCCTCTCCATTACCTGTGC
CCCTAGGTTGATACTCTTTAATAATAATAATGTTGGTATTTGTTAAGCGCTTACTATGTG
CAGAGCACTGTTCTAAGCACTGGGGTGGATATAGGGCAATCAGGTTGTCCCACGTGAGGC
TCCCAGTCTTAATCCCCATTTTACAAATGGGATAAATGAGGCCCAGAGAAGTGAAGTGAC
TTGCCCACAGTCACACAGTGGACAACTGGCAGAGCAGAATTTAAACCCATGACCTCTGGC
TCCCAAGCCTGGCCTCTTTCCACGGAGCCACGCTGCTTCTCTTAAAAACTTTGATGCTCA
CCCAACCAAGAGCAGTCATGAGAAGCAGCGTGGTTTAGTGGAAAGAGCATCGGCTTGGGA
GTCAGAGGTCATGGGTTTTAATCCCGGCTCCGCCACTTGTCAGCTGTGTGACTTTGTGCA
AGTCATTTAACTTTTCTGTGCCTCAGTGACCTCATCTGTAAAATGGGGATTAAGACTGGG
AGCCCCATGTGGGACAAGGACTGTGTCCAACCTGATTAGCTCTATAAAGTGCCTGGCATA
GAGTAAGCATCTAACAAATCCCATAAAAAAATCCATAATTTATTTACATTAATATCTGTA
TCCCTTTCTACACTGTAAGCTCATCATAGGCAGGGAGCACATATACCAACTCTGCTATAT
TGTACTCTCCCAAGTGCTTAGTACAGTGCTCTGCACACAATAACCACTCAATAAATGTGA
TTGATTGCTTGATTAATAATACAGGACTTAACATATAGTAAGCCCTTAATGAGTACCCTC
TTTTATGAATTATTATTATTAGTAGTAATAATAGGAGTAATCTCAGTAATTGGCGAATAC
AATAGAGAAAAAATGCATGATCCCTGTCTACATAGTAGCTTACAGTCTAAGTGATGTTCT
TGTACTGTGAGATATACTAAAAAGGAATTGTTGATCTTTGGAGCGAGTGCTTAAGGTAAA
GATGTCATTTACACAGCCTAAGAAGGTTTGTTTCAACTACTTGGGTCTTTGGTCTGAGGG
CTGGTCGTAGACAAATTGGTTACCAGTGTTGAAAGTAAAAAGGCAATTGGAATCCCCTTG
GGTTGTTTGTAGAAACCTCCTTTGAAAATGAACATTTTGTTGTTGGTTATGATTTGGGTA
CTTCAACTTACGTTTGAGAAGGCTGACAGTCTTCTTGATCGTGGCTGGAGCTTTCGGTAT
GGGTACAGAAGAACACCACATCAAAGCTTGCTCGCAGAGTGTTTGAGGAGCCAATTGTTT
TATCTTATAATGTGGGTGAAGTTTTTTTAGTAGGGTCTTGCCTCTTTTACATGGTGGTGG
TGGGGGATGTGGGAGAGAGAGAGTGAGTGAGTCACCTCATCAGTAATGAAGCAATTCTCT
CAACCAAGACAGCTCCGCTGGCCAGAACATGTGAGGAGAATGGATAACAAGAGAAATAAA
AGGGGACACACACACAAGCCCAGAGGGCATTTCTCTCTCTCTGTAAATGATACAAAGACA
CCGAAGCCCCGTATCAAACAATGCAACGTAGCCCTGCAGCTGGCAAACCGGTCCTAGTGG
GCAGCGATCGGGAGAGGATTGTTGTGTGAGCAAAGGCTTCACTAAGAAGTGGATACCAAG
AGACATACTCAAAAACGGAGGTAATCTGTGCACTGGGCAATCCCATTAGCACAGGAAAGA
TTTATCCTTGTTAACAGCACAGGAGGGAATATCATTTCCACATCAGACCTTTCAGAGAGT
GTATTTTGCCTGGATAGGATCTCACTGTCTATAGCGTCATCTTCAGAAATGAAGGACGTC
TATATATTTTGTCTATTTCTCCGTACACACAGGCACGTATATTATACCCAGAGCTGGAGG
GAACTCTTTTCTACTTTTAGGTTATGCTCCCAAGTACATACTACATTGCTCCAGCAATTG
GAGACGCTCATAAAATACTACTAAAGACACACGCATACACACACACACTATATATATACA
CACACACACACACATATGTGCATGTATATGTATATATATATGAATTAAACATAGTTCATA
AGTTATAAAACTCTCTTTGTATTTGAAGATGACCCCATTGATGGGTAGACATATAAAGCC
CATAAAGCTAGACTCAGTGCCCCTCTAATTGTCTTTCTGCTGACTAAATGTTACAAGTGG
TGCAGAATTATTATCATCTGGAGCAATAAAATGATATCTCAGACTGAATTTAAATTTGAT
TTAATGCAGACACTTACAAATATACTTACAGCAACAATGAATAATGAAGAAAGCAATTCT
GATCTCATGGTAGTTTAATAAGTTAGAAAAGTGCAGCATTGACTACCCAATAACATTGGT
AATTTTAATATTTAATTTACAGAATTAAACAATTAATTTTAAAGCAATGAATATTCAAGT
AGTATGTAATTTCTGTTAAGAGCCTGGCATTCTGGGTAGTAGATATTGGTGCAATTTGAC
TGCAATGTCATTTTAGCAAGAATCCTTTCCAGTTGGGTGTTTCCATGCTAATCAGAAATC
CGTATGTTCATTAATGGGCATTGGAATTTGACTCGAAACTGTCTGCTGACTGATGGATTA
GCTCTCAAGGCTGAAATGACAGACAACCAGAGCTGGTGATGCGGGTCAATATATCTGTCT
CTAGTTCCCTGTCCTGCTATGAACTGAAGAACGGTGCCTTGAAGGGTGGAATTAAGGGCT
GGAGAGAACTAGCGGCCAGTTCTGAGCGAGGAAGTTTCCTGAACTGGTGGAGTTGGAGAG
GACTGGGCGTGCAGGAGAGGTTGAATATCAACTCGAGTGGTGGTGGTTGCTGGTTGTTTT
TAGGGTATTTACTATAATGTTGGTATTTGTTAAGCGCTTACTATGTGCACAGCACTGTTC
TAAGCGCTGGGGTAGAATCAGGGTAATCAGGTTGTCCCACGTGAGGCTCACAGTCTTCAT
CCCCATTTTACAGAAGAGGTAGCTGAGGCACCGAGAAGTTAAGTAACTTGCCCACAGTCT
CACAGCTGACAAGTGGCAGATCCGGGATTCGAACCCATGACCTCTGACTCCCAAGCCTGG
ATTCTTTCCACTGAGCCACGCTGCTTCTCTATAATGTCGGTATTTGTTGAGCATTAAGTG
CTTGCTATGTGTCAAGCACTGCCCTAAGCACTGGGCTAGATACAAGTTAATCAGGGTGGA
CACAGTCCCTGTCCCACAGGGGACTCGCAGTCTAAGTAGGAGGGCGAACAGTCATTGACT
CCCCATTTTACAGATGTGGAAATTGAGGCACAGAGAAGCTAAGTGACTTGCTCAGGGTCA
CACAGCAGAGAAGTGGCAGAGCTGAGGTGAGAATCCAGGTTCTATAACTCTCAAGCCAGT
GCTCTTTTCACTAGGCCACAATGCTCCTTGTTGTGTACTTTAGCAAAACAAAAATCACTA
CTCTTTTTAGTACAACGTCCTAGGAATAAGTAACTTAAAGGTCTACCTTATCTGACTGTA
CTGATTTACTTAAAGCATGGTTTAGAGTTCTTCTTGGCTGTGCATCTTGGGTCCCTTTAT
CTCTTTCAGAAATTAATCACAGGGATCTCTTACCAATAATACATGTAAGTTACTAATCAT
AAACAGAATCCTCCTGCCAGTGCTAGAAACAGGGCTTTTTGTGTGAACTTCCATTTCTCA
CAGGTAAATTGATATGCAGCTTTCTGTGGGGAAACAATGGGTCCGTGCCTTAAGTAGCCA
ACTTTCATCGACAGAGCTCTGGTGATTTGTTTCTTCTTTTGGTCAGGAGAGGCGCACAGT
AAATGCTCAATAAATGTGATTGAATGAATAAATGAATGAGGGGTATGAACACCTGCTTGT
CAGGTTTCAATACAAATTATTCTCTTCTGTTTAAATGCATGATTTTAATTCACCAGTTAA
AACTTGGAGGAAAGTATTTTCTTCTTGAAAATGGTATATTGAAGTTCATCCTTTCAAATA
ATAGCATCTCTTTGGTCGTGGTGAATGATACTAACCTCTATTGCAAAAGAGCCTAGCGTA
GTGGGAGCACAAGCCTGAACGTCAGAAGGCTGTGGGTTCTAATCCCAGATCTACCAGTTG
TCAGCTGTGTGGTCTTAGGCAAGTCACTTTGCTTCTCTGGGCCTCATTTCCCTCATCTGT
AAAAGGGGGATTGAAACTGTGAGCTCCAAGTGGGACAGGGACTGTGTCCAACCCGATTTG
CTTGAATCCACCCAGTGCTTAGTACAGTGCCTGGCACATAGTAAGCACTTAATAAATACC
ACAGTTATTATTAGAGAAGCAGCGTGGCTAAGTGGAAAGAGCCCGGGTTTGGGAGTCAGA
GGTCATGGGTTCGAATCCCAGCTCTGCCACTTGTCAGCTGTGAGACTGTGGGCAAGTCAC
TTAACTTCTCAGTGCCTTAGTTACCTCTTCTGTAAAATGGGGATGAAGATGTGAGCCTCA
TGTGGGACAACCTGATTACCCTGTATCTACCCCAGCGCTTAGAGCAGTGCTCTGCACATA
GTAAGCACTTAACAAATACCAACATTATTATTATTATTATTATTATTATTATTATGAGAT
TCAAAGGAACGGGAGTCACATAATCGGGTAGATCTTTGACAACTTTTCTTCCCTCCGGTA
AGCCGTCCACAATCAGTTAATTACCAGACACTTCAGAGCTTCCAGAACTGTGAACTTTCT
TGCTGACAATGATGCTGCACAAATCAGAAGGAAGCAAACCCAACTCGATGTGGGTATTTC
TGCTCCATTAGAAATTGAAGGAGAAACCCCGTTGTTCGCCAAGCTGGAGAAAGTGATATA
GAAAAGATGGGTTGGTTTCTAGTTTCCGAGAGGGTAGCCCGAAAAAAATGTGGAAAAGAA
TATGAACTATGAAGTTCATAGCATTGAATCAATCCAGTCCCTCGAGTGTAAAGAAATGTA
GAAAGTTGGCTGCAAGTCTGTGAGCCGGCCAGAGCCGGGGAACGGCATTGCTCAGCGATC
CTTATCGCTCTTTGCACCCTGTACAATCCTGGCGATCGGTGCAGCTCTCTGTGTACAACA
CAGGTTTGTGGTCATACTGAGCAGGAGTAGGGCTAGACCGTACAGGGTAAAGTCTAGTCA
CTGACTATTTTCAGCGTGAAAATTCTGCACACCATTAAAATTCTAAGTAAAAGAAATGCA
CATGGAAGGGAAATGCATGAAAAGTTGTTTGTAGAATGTGAGGAAGAGTCATTGTTGATC
CTATTCTGCAAATTCTATAGTGGCTTTCCATAAAAATGATCTGGAACCAGAAAGAGTTAA
AATCATTTCTTAGTTATCGATCCTTCCATCAAGGGTATTTATTGAGCGCTCACCGTATGC
AGAGCATTCTATTATTAATATAAAGTTCTTGATACCACACTGAACCATCACTTTTTGGTG
TTTATCATCAGCTGTAATTCATGCCAAAATGTAAATGAAGACTAAAGTGACTTTTCTTTT
TTTTTTTTTTTTACAAATCAAAACTTTTTTTGGATTTTAACTGCCAGTGACTTTACAGCT
CTGAAATCTTGTCAAATCATTTGAATAAAACCTTGGCTGTTGTTACCCAGGACAAGCAGT
TTTTTGGGAGTGGAATTTTCAGTACAAAATTTCTCTTGTACAGAGCTCATCTCACATCTA
GCCCCTCCTAGCACTTGTGGAAGAGCTGCGTGAAGACGGGAGTGTTTCTGAACATTACCA
CTAATCTGCCCCAGAGGCCTGCCTTCGGAACTAGGACATTGGCATCATAATTGTCAACAA
TGGCATTTGTCAAGCAGTTCTTTTTTAATGGTATTTTAGTGCTTACTGCCGGGCACTGTA
CTAATCACTGGGATAGATATAAGATACTCAGTTTGGTTAAAGTCCACATACCACATGGGG
TTCACAGTCTTAATCCCCATTTTACAGATGAGGTGACTGAGGCACAGAGAAGTTAAGTGC
CTTGACCAAGATCGCAGAGAAGACATAGTGGAGGTTGGGATTAGAACCAGGTCCTTTGAT
TTCCAAGCCTGTGCTCTTTCCATGGGCCACGCTGCGTCTCACTTGTTATTTTGTACTAAG
AGCGTGGGGCCATAGTAAAAAGTAAAGATACAGTCCCTGACCGATTGATAATGGAATTTA
TAAAGTGCCCACTGTATACAGAGAACCGTACTCAGTTCTGGGAAAACAGTTCCTGTTCCT
CAAGGGATTCACGATCCAAGTGACCTAGTAAGGAACATACAGTTCCGAAATGAAGAGATT
ACATGGAAAAAGAGTCTGCGAGAGGGGATCTTTAGTATCTGCAGTGGACTGTGGCTCGGC
CAGCTGGGGGAATTTTCGCTGCTTCTAGCGCTACTTCTCCCGCAGTGCGTAGGACACCTG
CAGAGGTCCATGAAAACCATATCGGGTCTTGGTCATGTCACCATCAGAGCTGCAATCTGC
CAGGACCTCCCGCCCTCCCTCGCTACCAGCTGAGACTGCCGACGCCTTGAAGCCCGTAGA
TGATTCCCTCCCCGTCACCACCTCTCAGGGTGCTTCCAGGATCTGGACTGTATGCTCGCT
GCGGTCAGGGAAAGGCTTTATTATATTGTTGTTTGTACTCTCTCAACTATTTAGCACGGT
GCCCTGCACATCATGAGCTCTCAATAATACCACCAGATATTGATTTATCTGGCTCTCTTC
CTTGCCATCAGAGCTATGAACTGCCAGGACCTCTCTCGCTCCCCTGCCCCCAGATTTGGG
TTCTGCCTGATCCCCGGGAGCCCTTGGAGTATCCCTCTCCCAAATGTCTTTATGTTTGGT
TTCTTCTCCCGGCTTTCTTTTTGTGTCTGTCTTCCCTGCCAAGTTTTTTGATTGTCATTT
ATTGAGGGCTTACTGTGTGCAGAGTACTGTACTAAACGCTTGGGAAAGTTCACTGTCTCA
GAGTTGGCAGACACAGTCCCGGCCCACAACGAGCTTACAAACCGTAAACTCAGTGAGGGC
AGGGATTGTGTCTACTAACTCTGTGATACTCTCCCAAGTGCTTAGTTCAGTGATCTGGAC
AGAGCAAGCGTTCAGTAAATAGTATTGATTACCTGGCCGCTATGGGGCTTCCTTCATAAC
TTTGGATTCATTCAGTTGTATTTATTGAGCGCTTACTATGTGCAAAGCACTGTTCCAAGG
GCTTGGGAGAGTACAGTAGAACAATAGACACATTCCCTGCCCACAACGAGCTCACAGAGG
TTGAGAAGCCACAGTCACCCACTTAGTACAGAGCCTGGCACATAGTAAGCATTTAACAGA
TACCATAAAAATAATCTGGGACTTCACCATCCCCCGCTGTGCTGCCGTTTTTGACCGTTG
GAGTCCTTGTCACCAGAAGCCTAAAACTCTGCTCTTCTAGTCATAGCACAGTATTGTTCT
TATTGTATTTATCTTTCGACCTTGTCTTTTATTTCTCTTGTTTTATATTCCCTTTTGTGT
ATCTCCAAACCTTCTCTCCTTTGCCCCTTTTATTTTGAGCCTGTGAGTCCTCAGGGTCCG
TGACTAATTCTCACTTCGTGTCACTTTTTCCCCTGGTGCTTAGTATAGTGTTTTGCTCCC
AGTACTGCTATTTACTAATGTCCCTGCAGTGGTGGTTGAGAGAGCGCGGGGGCCGCTGTG
TAAAGAGAGCATCCCCCGCTGGGTTCTGGAGCAGCTAGCAGATGTTGATGTGGTTCCATG
CACATGTGATTCTTTCATTTTAAGGGGTTACGGTAAAATAAGGGAAATAGTTAAGGGTGT
TAGGGAGTATTTCTATAGAGCAGGCAAACTGCTCCATATCTTGTGGGCCCCATGTTCTGA
ACCAGGAGAGCGGTGTGCGTAGTCCTGTGCCCTTTGGGAAAAATGGTTCTCTTGGGATTC
TTTAGGAGAGCACGGGGGACGTGCCAAAGCAAAGGAGTCAGCTGTTAAAAGAATAAAGTA
CATTACCCTATTTATTTTGTTAATGAAATGTGCATCTATTGATTCTATTTATTTGCTATT
GTTTTAATGAGATGTTCATCCCTTTGATTCTATTTATTGCTATTGTTCCTATCTGTCCGT
CTCCCCCGATTAGCCTGTAAGCCCGTCAAAGGGCGGGGACGGTCTCTATTGGTTACCGAT
TTGTACATTCCAAGCGCTTAGTACAGTGCTCTGCACATAGTAAGCGCTCAATAAATACTG
TTGAATGAATAGTATCCAAATGAAGCTTCAATCTCGTCATTAATTGCCAAAGNNNNNNNN
NNGGGCAGATTAGTGGTAATGTCAGAAACACTCCTGTTTTTCACGCAGCTCTTCCACAAG
TGCTAGGAGGGGCTAGATGTGAGATGAGCTCAGTACAAGAGAAATTTTGTACTGAAAATT
CCACTCCCAAAAAAAATGCTTGTCTTGGGTAACAACAGCCAAGGTTTTATTCAATTGATT
TGACAAGATTTCAGAGCTGTAAAGTCACTGGCAGTTAATATCCAAAAAAAGTTATGATAT
TCAAAAAAAAAAAAAAAAGAAAAGTCACTTTAGTCTTCATTTACATTTAGGCATGAATTA
CAGCTGACGATAAACACCAAAAAGTGAGCGCTTGGAATGTACAATTCGGCAACAGATAGA
GACCATCCCTACCCAATAACGGGCTCACCGTCTAAATGGGGGAGAAATATTTCTGGGGAG
GACAGAAAGTAATCAGGTTGTCCCACGTGGGGCTCCCAGTCTTCATCCCCATTTTTCAGA
TGAGGGAACTGAGGCCCAGAGAAGTGAAGCGACTTGCCCGAGGTCACCCATGGAGGTCAT
TCATGGAGTGGTACCCTGCCCACTGAGTTTCCTGCCATGACAAGACTAAGAGGGGAGGAG
GGGGATTGGAGATATGGTGACACACCCTCTGCAGCCAGGTTTGGGGGTGCCAAGATTAAA
GTCCCTCCTCTTCTTCCTGGGCCCCCCCTCTTTACCCAAGCTCCGAGCTCTACCTTGAGC
TCATATATGCCACATCACCTCCCACTGCTCTTAAATCACTGCTGAAGGCCCATCTCCTCA
ACAAAACTTTTTTTCTGATTTTCCACTCACCCACCTCCTTCCAGCTCAGTTTTAAAATTA
TTTAATCTCTAGGAGTGCATTTGTATTGATTGAATGAAGGCCTGCTTCTCTTTTCCTATT
AGATTATCAACTCCTGGAGTGCCTGAACGATGTCTATTCTTTAGTACCCAGGACAGTTTT
AGGCATCTTAAGGGTGCTCAGCAAATGCTAGTCGCTTGATTAGGATAAGGCTATTTCACA
TAATATGATTAGTTGTTTTAGCCAGATATTGCTGAGGTCTCTTCCAAAGAAAATAACTGT
TGACCTCTGCAGAATGTAGTGGGTCAAAAATGTTTTAAATTTAAACATTTTCATGTTTTG
TTTTGTTTTTGCATTTTAAGTGAGGGCCGTAGTACAGTTGACATCAGTTTATCGGTGGTA
TTTATTGGGCGCTTTACTGAATACCCAACACTGTCCTAAGTGCTTGGGAGAGTAATCATC
AGTCAGTAAGTGGTATTTATTGAGTGCTTACTACGTGCAGAGCACTGTACTAAGCACTTG
GGAGAGTAGAGTATAACAGAATTAGCAGACATGTTCTCTGCCCATAACGACCTTACAGTC
TAGAGGGGAGGACAGACATTAATAAGTAGGAATAAATAATTCATAATAATTTAAAGATAC
GTACACAAGTCAAATGTCCAAAGGTCACAGTTCCGAGTTCATAGACAATAAAGAAGGGAG
GGCGAGCTGGGGAAGAGAGAGTTTAATCAGGGAAGNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGTAGGAAGGGGGCAAGGTGATGGAG
AGCTTGAAGTCAAGAGTGAGAGTTTTTGTTTTGCAAAGGTTGTTAGGCAACCATTGGAGG
TTTTTGAGGAGCGGAGTGACATGCCCAGGGCGTTTCTGTAGGAAGATGAGCCGGGCAGCG
GAATGAAGAATAGACTGGAGTTGGGAGAGACAGGAGGAAGGGAGATCTGAGAGGAGGCTG
ACACAATAATCCAGTCGGGATATTATGAGAGCTTGTACCAGCACGATAGCAGTTTGGATG
GAGAGGAAAGGGTGGTGTTGTGTGACCTTGGGTAAATTACTTTGTCTCTATGCCTCAGTT
GCCTCATCTGTAAATTGGATATTCAGTTGTCCGTCCTCCCTCCCTCTTAATCTGTGAGCT
CCCTGTGGGACAGGAACTGGGTCCAATCTGATTAACTCGTGTCTGCCCCAGACATATTAC
AGGGCTTGCCATAGAGTAAACAGTTTAACAAATACCACTGTTATTGTTATTATTGGAGGC
GGTTGGGAGGATAGTTATCTCAGACTGTGAGAATTACTGCAAAACTCTCAACACAGATTT
AAAGGGTCATTTGCCTGGAATTGGGGGGATGTAAATTATTTATATTAATGACCGTCTCCT
CCTCTAAACTGTACGATCACTGTGGGCAAGGAGTATGACTACCAACTCTGGGCACTTTCC
CTTGGTTTCTCAAATAGAAAACCCAAATGCTTACAACAGTGCTGTGCACACAGTAAGCAC
TCAATAAATATGATTGATTGGCAGGAGAAGGGAGGAGGGATTTGCCATTAGAAAAATGAC
TTATTGGCACATAGGTTCTAGAAATTGGTCAGAATTTTTGTTAGGGCATTAAGCTCCTTC
TCACAGTAGTGAATTCAACAAAGAACACAGTGAAGCCACGATCTCCCTAATTGTGTGACA
AGGTCTTTTTCTTCCCGATCAGAAGGCCGAGAGTCCTTTCGGGAGAGAGAGAATAGGTCG
GTCGCCGTACCAAGGTAGTCATTCATCTCTGTAGAGATTGCCAACTGTGGTGCCAGAGAA
GGGGCTTTTGTTTGTTTGTTTATCAGTTTTAGTGTCACATCACATCAGGACATCTGTCAG
TTAGAAAGTGAACTGAGACTACGTTCTTAACTGCTGCCAGGCTTGGTTGTATTCAGATAA
GTAACCTAGAGAAAGATTCCCTATCTCATTCCAAATCCAATCCTCTTGTTCCCATTATCT
TTGAAAAATGTTAAAGCAAATGAGCATAGCATCTCTGCATTATCCATATAAAATCATGCT
TCTCTGAAGCCTGCCCAATTTTGATCATAAAAAATTACACTCTGACACCATTCCGGAGCG
TTATTAAAATTGGATACAGAAAACGAGTGATCTAAATAAAAAGATTAAACGCTGAGTTTG
GTAGACAAGGCAGGATTTATTGTTATGAAAACTTTCGACAAGATCTTGGACTTTGCATCC
CCTTTGAAATAGGAATACCGAATTTTATGTTTCTCAGGACTTGTGTGTGGTTGTTCAGCG
AGTTTCTCTTTTTTCCCCTTTGTTNNNNNNNNNNGGTCATTTGCCTGGAATTGGGGGGAT
GTAAATTATTTATATTAATGACCGTCTCCTCCTCTAAACTGTACGATCACTGTGGGCAAG
GAGTATGACTACCAACTCTGGGCACTTTCCCTTGGTTTCTCAAATAGAAAACCCAAATGC
TTACAACAGTGCTGTGCACACAGTAAGCACTCAATAAATATGATTGATTGGCAGGAGAAG
GGAGGAGGGATTTGCCATTAGAAAAATGACTTATTGGCACATAGGTTCTAGAAATTGGTC
AGAATTTTTGTTAGGGCATTAAGCTCCTTCTCACAGTAGTGAATTCAACAAAGAACACAG
TGAAGCCACGATCTCCCTAATTGTGTGACAAGGTCTTTTTCTTCCCGATCAGAAGGCCGA
GAGTCCTTTCGGGAGAGAGAGAATAGGTCGGTCGCCGTACCAAGGTAGTCATTCATCTCT
GTAGAGATTGCCAACTGTGGTGCCAGAGAAGGGGCTTTTGTTTGTTTGTTTATCAGTTTT
AGTGTCACATCACATCAGGACATCTGTCAGTTAGAAAGTGAACTGAGACTACGTTCTTAT
TTCATACTAACTGCTGCCAGGCTTGGTTGTATTCAGATAAGTAACCTAGAGAAAGATTCC
CTATCTCATTCCAAATCCAATCCTCTTGTTCCCATTATCTTTGAAAAATGTTAAAGCAAA
TGAGCATAGCATCTCTGCATTATCCATATAAAATCATGCTTCTCTGAAGCCTGCCCAATT
TTGATCATAAAAAATTACACTCTGACACCATTCCGGAGCGTTATTAAAATTGGATACAGA
AAACGAGTGATCTAAATAAAAAGATTTAAACGCTGAGTTTGGTAGACAAGGCAGGATTTA
TTGTTATGAAAACTTTCGACAAGATCTTGGACTTTGCATCCCTTTGAAATAGAATACCGA
ATTTATGTTTCTCAGGGCTTGTGTGTGGTTGTTCAAGCGAGTTTCTCTTTTTCCCTTTGT
TACAATAGCTTATGTCATTACGTTTCAAATACTGTCTAGTTTGTGTCTTCTCAGTTTAAT
AATAAAGTAATTGGATACCCAGAAGCATGCAATTTTGGCAGATAATTATGATGTCGTGAT
CTTATTTGTATTCATGTATTATGCTTTATTTAATATAGATGACTGCAATGTTCTTGACTC
TGTTGTCCTTATTTCAGGCAAAATGAAATTTTTTTGGTATATGTTCCTTGCAGGTAGCTC
TCTAAAACAATAACGTTCTTTCAGCTTCTTCTCCTCAGTGTGCTTAATTTCTGAAACTCA
AGCTGTTTTCCCGAGTTGAACCTGGATGACTGCTATTGTTGAAATTCGGTGTCTTGTTTT
TCTCTCTATCTTCTATTTGAGAAACGAAAGGAAATTGCCCATTTTGAGAGTATCTTAATG
AGCAGCTTACCTGTGAGAGCACCCTGAATTGTCCACTTGAAGAACTTAAAAGGTTACTCA
TCACATTCTGTATGGCCTTGAGCCGGGGTGTCTGACACACAGTCCAAGGGTTGGATTTTC
CTGGCGGGGGTTGGCCACGTGCCGCAGGGATCATTATTATTTTCTTAACCTAATTATAAG
TAATAGCCGTGGTGCATCTCTCCCTGAAGGCTGTGCACATGCACAGGTAGTTGAAAAGAA
GGGTGGGGAGAGGAAGGGAAGGGGCCACCGAGGCCTCGGGCTGGGGCGGTGGGTGCAGTG
ACGTGTGATCTAGGATGCAGGGACTTGTCAGTGCCCAGGGTTGGGGCAGCAAGGCCTGCT
GATCTTCCATAGCAGGAAACCCTGCTGGGACCCTGGAAGGGTCCAGGAGGGCAGATGGAG
TGGGCACAGCTGGAAACCATGAAACCATGACACTTCCTCACCCCCTTTTGGGACCATGGA
AGCGTCCAGGTGTGTGGATAGGGTGTCTAGAGCTGAAATCCCTGGACCCCCACCTTTTGA
GTCCGTGGAAGGGTCCTGGTGTGCTGATGAGGTAGCTACAACAGGAAATGCCCGATCCTC
CCCTTTTGGGACTATGGAAGCATCCAGGTATGTGGATGGAGTGGGAACTACCGACAGTAT
TGGAAGGACTTGGAGGAGACCTGGTTTCCCTACCACCTTGCAGATGCCAGATCCCAAAGT
GGAGATGGTAGAGTACTGGAAACTCTCCAGGTGCGCCCCTGAGCTGGGAGGGGGTCGGGG
ACGTGTAACTACTACAACCAAGTTATTGCCGAAGGCAAGTGCTCAATCAGAGAAGAAACA
ATGTGTAGCTGAATTTTAAAATGAGAGGACACATGATGACATTTCATACCCATAATTGTT
TTTAACCATGTTTATCTGGAACAACATAACCTCCCTCTTTAAAAAAAAATAATAATGTTG
GTATTTGTTAAGCGCTTACTATGTGCAGAGCACTGTTCTAAGTGCTGGGGTAGATACAGG
GGAATCAGGTTGTCCCACATGGCGCTCACAGTCTTAATCCCCATTTTACAGATGAGGGAA
CTGAGGCACAGAGAAGTGAAGTGACTTGCCCACAGTCACACAGCTGACAAGTGGCGGAGC
TGGGATTCGAACTCGTTAAAAAAACATTAAGCACATATCTCTAATCAAAACAAAGGGGGG
TTGGCAACCCAGTTAATTTTGTTTTAACATTTTGGAATTGATAGAAAACTTTGAACCCTT
ACTGAGACGGAATTTTGGATTTGAAGTTCTGAACCTGAGCCGGCTTGCTGATTGGCCTGA
AAGTCCACTTGATTGACATTTGCTGCTCTGGAGGGCTATGGAGACTAATAATAATAATAA
CAATAATAGTACTTGTTAAACACTCGCTGTGTCCCAAGCACCATTCAAAGCACTGGGGTA
GATACAAGTTAATCAGGTTGGACACAGTCCCTGTCCCACATGGGACTCACAGACTTAATC
TCCATTTTACAGATGAGGTAACCGAGGCCCAGAGAAGTTAAGTGACTTGCCCAAGGTCAC
GTAGCAGACAAGTGGCGGAGCCGGAATTAGAACCCAGGTCCTTCTGACTCACAGACCCCT
GCTCTATCCATTAAGCTACACTGCTTCTCTAACTGTATCATTGCCAACCTGAAGGAATCT
CTGAGGAATGCAAAGAGATTTCCAAGAGTGATAAAGGAATTGAAAAAATCTGAATTGCTA
TCTGTGGTTCCCTGTGGGGATTTCTAGGTCAGGTCTTGTGGAATATGGCATCCCAAATAT
TTCTTGTGCCTGCTCACTGCTGTCCATTTGAATATTTATTGGGTATTAAGTTTTTGATTC
GCTTTTGAGAGATTCTGATCCTATCTAAAAATTTTAGAAATCCTTTTCTAAAATATTCCT
TGCATAACACACCTATTATCTGTTTCAATTTTTGATGGGCTTGGAAGTAACATTACTGTT
TACTTTTATCTATGGCTTACTAACTTTTTAAAGGAGTTGAAATAATAAACAAAACAAATT
AAATGCATATCAATAGCAACACAAATGTGAGCTTATCAAATATACATTACTGCTACACAT
GGATGGATACTTACTAGTAACCCTTGCTTATCTTTATTTAGCTTTAGTGTAAAATGTTAT
TTTCAAATGTAGAAATTCACCAGTGTCTCATCATTGATCTATTCCTGATGAAAATCCTCT
AAGAAAGTGACTGTCGGCATCTTCAGTTCTTATTATTGCTAAATCTGAGAGCACGCTCGT
TTAGGATATCCTGCTTTTAACTTCAACCCCTCATGCGCAAATTAAGTCCATTTCTCCTTG
ATCTTTAGTTGGTGGAAATAGAAGATAGCTGGTCACCGTCTTTCAGACAGTAGCTCTTCT
GTGCTTGAAATTTGTAATTAAATACGTTTTCTAGAATTTAGGGTCTAGGCTGAATCATCC
AAATCCCTTTCACTTTTTCACACACATGCTAAACTCCACAATGATGCATGTTTTCACTGT
GGGTTTTGGCTTAGCGTTGTTAGGGATTTAGGGAACATCGGTCTGTTAATCGAGCCCGGT
TGAACACATCTTGATGCAGTGTGGAAGAAATGTCTTGTGCACATATGTGGAAACGTGAAG
CATTAGAGTGGGAGAGTTCTCCAACACAAGTTCTCATTTTGCAGTAATATAGCCCCCATG
TTATAGAAGAACTGGATGTGCTCGAAATTATAAACTTTTATCATCTCCCTTTGATTCCAC
TCTAATTTCCATGCATTCTTCTTAAATTATGACAGTCATCCCAGAATTTTATTTATATTA
AAGAAGAGGAAAAGTCCAGTGTAATTTGGGAAACATAAGTAGGTAGTGGATATAAATCTA
GATGCATCAGTAGCCCAGAGACATTAAATGAACAGTGATCTGCAGATAAAACTCATTCCC
TCTTCCAACTGGGTAGATATAACTTTTTTTTAACCTTCATTAAAATAACCCTGCTTGGAA
ATTAAATATCTAGATACATAGGTATTGTATGGTATACATGCCATTATTCCAGGTATCGGA
AATGTTAAAATTCCCAGATAACTTCATAGATGTTGATGTAGTCAGACGAATGCTTCCTTG
TTGATCCTGATAGATGTCCTGTGATAATGGTAACACATGGGAAAATGTGTGTGTGTGTTT
TTTATCTTTTCTCTATTTGCCTTTCCTTTTTATCTGTGTATCTTTCCTTTTGGAGAAAGA
ATTCAATAGCAGCAACTATTGATTGATACAGTTCTGGTGATTTCGATGTTTTCTTCTTTA
GTTTTCTTCTTTCGTTCCCTGAAGAATGTAAGCTCTCCAGAGAAAAGCCATATGTAAGCT
TAGATATTGACCGACTTAGTGCATGCTCTCCCTCTCTCCTTTTTCCTTCTCTCCCTCTCT
CCTGTTCATATTTAAACTTTCAATTCTAAAATGGTCTAGTTTGACTACTCACCTTCTACT
CTTCACTTGCCTCCTTGAACCAGGGGACTTAATAATAATAATGATAATAATAGCAATAAT
AAAAAATGGTATTTGTTAACTGCTTTACACTGGGATAAATAGAAGATAATCAGGTTGGAC
ATAGTCCCTGTCCCATGTGAGGCTCTAGTCTAAGAAGGAGGGAGAACTGATATTAAATTC
CCATTTTACAGATGTGGAAACTGAGGGACAGGAAGTTAATTGCCTGCACAAGGCACTGCA
TCACACTGCAAGTGCCCATGCTCTTTACCCTTCCCTAATAATAAAGTATAATGATGATAC
ATCAAATTCGCTTAATACACTTTTTCCCAAGAACTCAAAGTGCTACCTCATGCATATCTT
ATTTTCGTTTACACCTTCCTAATGGAAACAGAGAAAAGAGGCCCCAAGATCTTGTGCCTC
AAAATCCCACAGTACGTTGATGACCGATACTAGGTAGAAAGTTGGGCCCTGGTTTCCAGT
TATGTGGAAATCAGCTATTATGTGGTGTTTCGCCTAGTGATCGCTGAATCCAAATGGTTG
AATTCCCAAGATCTTTAATGTGCCCCTGGCTTCCAAAATGTTATTGCAGTATTTTTTATT
AGAACAGGAAAAATATGTTCCCATATTTCATATGGCTCTGCTCATGTTTAATTGCAGTAC
CATTCATTATCTATTGATGTCTATGATTAATTTATTATTTTAAGAAGGACTGGTACATTG
GTTGAGTTGGGAATTGAAATCTCTAGTAGAAGTTTTGATCAATTAAAAAAGAGTGAGGAT
TCATTTGTAAAGGAACCAATATTATAAATTAGATTGGCCCTCCTTATCTTTTTTTTATTA
TACTAGTACTGCTTTTGGTATAGCGCTTTAAAACATCTGCTCCAGTATCCCTTATAATAG
CACAAGAGTGCTTTTACATGAATGCAATGCAGTAACAGATGCTTCTTAATGACAACTAAC
CAATTCTTTTTGGAAAAAGGTCAGTTCCAGGTTTCGTAATGTGGGAGCTCTGCAACCAAA
TGATTCTGAAGAGGCTAAAATTGACAAATCAAGTTGCACTGTGAAATTTTTCATGGTGAT
AGAACTTAATTGAAAACCATATTTAATAAGACATGAATAAAATTAGTTTCTTTTCTTACT
GGTGAAATAATTCGCTGCTATTCTAAGTACCAAAAAGAAATCCATGAATTAAGCATCACA
TACCTACCTGTCTTTGTTTATATCTTCAGGAACTTATCTTGAATGATGACATGTCATCGG
GCTAACAGCCTGGTTCGGGAATAAACAGAGCAGAGCGGTGTGGACACCTAGCAAGTGGGG
TTCCACAATCCAATCAATTTTGAAGTCTGTTTCCTCAGAGACTTGTATGGTATTTTTGCA
GAGCAGGGTGATGATGGTGATGTGGAGGAGGAGGAGGGAGAAGCACGGGTCTGGGAGTCA
GAAGACTGGATTCTAATCCAGTCTCTCTCACTGGTCTCCTGGGTGACCTCGGGCAAGTCA
CTTTAGTTTTGTGGACCTCAATTCCTTCATATGCAGTATGGAGATTGAATACCTGTTTTC
CCTCTTACTTAGACCACGAGTCCCAAGTGGGACCTGATTATCATGTATCTGCCCCATGGC
TTAGTAAAGTACTTGACTCTGTAAGTACTTAACAAATACCACCGTTATTAATATTATGAT
GATGGTGAGGACCTAGTGTCACCAGCTTTCTACGCCATGACAGTTTAAAAAGAAGAGTGT
TGTCTAGGTCTTTTTTGATTTGCACAGTAATAATAATAATAAAAAATGGTATTTGTAAAG
CACTTATTATATGCCAATAAGTGCTTATTATATGCCAATAAGTATATATATCACTGTTCT
AACTAAGCTCTGGGGTAGATACAAGTTAACCAGGTTGGATGCAATCCCTATCCCACAGAG
GCTCATAGGCTGAGTAGGAGGAAGACCTGATAATGAATCCCCATTTTACAGAAGAGGAAA
GTGAGGCACAGAGAATTTAAGTGAATTTCCCAAGGTCACACAGCAGGCAAGCGGCAGAGC
TGGGATTAGAACTCAGGACCTCCAACTTCCTCTGCCACTGCTCTTTCCAGTAGGTCACAC
TGCTTTTTAATCAAACGAGAATTAGGCAAACATCAACGAGTGTCCTTCATTTAGAATGTG
AAGGAGAAAACATCATCCGTAGACTAATAGTAGCTGTTATAAACCACGTTAGGGTTGACA
TTCATCTGTATTGCCATGTCAATTTAATGTTTGTTGATGGGAGGCATTTGATGCTTAATC
ATAAAGTGTTTGCGTGTTCTTTGTTTTGCTGTAGTTATTGCGGTCAATCATATTTATTGA
GCGTTTGCTGAGTGCAGAACACTGTTCTAAGCGCGTGGGAGAGTACAATATAATAGAGTG
GGTAGGCATGTTCCCTGCCCACAGTGAGCTTAAAATTTCATAGCCTTCTCCTACCCTGTT
GGAAGATGGAAGATTCTTTGTAAGATTGGTCCTTCCCAGCCCAGGTAAATACTACTTTAT
ATATTTTAATCACTGTTTTCAGAAGTTTGCAACCCCTTGACATATCTCTTATAAAGCTAC
AATATTTAGACTATCTCTCAACATCCGTGTCAGTTTCTTCCTCCGTATTTAGTCTGTGGA
TCTATCCCGTCCACTCATGACCTGATTTAAACCCTCTTNNNNNNNNNNCCTCAATTCCTT
CATATGCAGTATGGAGATTGAATACCTGTTTTCCCTCTTACTTAGACCACGAGTCCCAAG
TGGGACCTGATTATCATGTATCTGCCCCATGGCTTAGTAAAGTACTTGACTCTGTAAGTA
CTTAACAAATACCACCGTTATTAATATTATGATGATGGTGAGGACCTAGTGTCACTAGCT
TTCTACGCCATGACAGTTTAAAAAGAAGAGTGTTGTCTAGGTCTTTTTTGATTTGCACAG
TAATAATAATAATAAAAAATGGTATTTGTAAAGCACTTATTATATGCCAATAAGTGCTTA
TTATATGCCAATAAGTATATATATCACTGTTCTAACTAAGCTCTGGGGTAGATACAAGTT
AACCAGGTTGGATGCAATCCCTATCCCACAGAGGCTCATAGGCTGAGTAGGAGGAAGACC
TGATAATGAATCCCCATTTTACAGAAGAGGAAAGTGAGGCACAGAGAATTTAAGTGAATT
TCCCAAGGTCACACAGCAGGCAAGCGGCAGAGCTGGGATTAGAACTCAGGACCTCCAACT
TCCTCTGCCACTGCTCTTTGCAGTAGGTCACACTGCTTTTTAATCAAACGAGAATTAGGC
AAACATCAACGAGTGTCCTTCATTTAGAATGTGAAGGAGAAAACGTAGACTAATAGTAGC
TGTTATAAACCACGTTAGGGTTGACATTCATCTGTATTGCCATGTCAATTTAATGTTTGT
TGATGGGAGGCATTTGATGCTTAATCATAAAGTGTTTGCGTGTTCTTTGTTTTGCTGTAG
TTATTGCGGTCAATCATATTTATTGAGCGTTTGCTGAGTGCAGAACACTGTTCTAAGCGC
GTGGGAGAGTACAATATAATAGAGTGGGTAGGCATGTTCCCTGCCCACAGTGAGCTTAAA
ATTTCATAGCCTTCTCCTACCCTGTTGGAAGATGGAAGATTCTTTGTAAGATTGGTCCTT
CCCAGCCCAGGTAAATACTACTTTATATATTTTAATCACTGTTTCAGAAGTTTGCAACCC
TTGACATATCTCTTATAAAGCTACAATATTTAGACTATCTCCAACTCCTGTCAGTTCTTC
CTCCGTATTTAGTCTGTGGATCTATCCCGTCCACTCATGACCTGATTTAAACCCTCTTCA
CTGCCTACGTGGAGTACCGTGACTGCTTCCTTCTGGTCTCCCCGACCTCCAGCCCTTCCT
CAGTTGAGACAGTCCTGCAAATATTAGTGCTGCAAATATTACCTTTTTAAAATGCCATTC
AGAGCCCGCTTTTCTCATCAATCAATCAGTCATATTTATCGAGGGCTTACCGTGTGCAGG
GCACTGGCTTACAGGCCGAGCTTACAGTCCAGAGAGGGAGGTTCTTGTATCCTCCAAAAT
CTACCCATTTCTTTTTGCATAAAATGAAAATTCCAAAGGGCATTTTTTAAAATGGTATAT
CTTCAGCGCTTACTATGTGTCAGACACTGTTCTAAGTGCTGGAACAGGTACAAGTTAATT
AGGTCAGACACAGTCATTCATTCAATAGTATTTATTGAGTGCTTACTATGTGCAGAGCAC
TGTACTAAGAGCTTGGAATGTACAATTTGGCAACAGATAGAGACAATCCCTGCCCAATGA
CGGGCTCACAGTCTAATTGGGGGAGACAGATGGCAGAGCAAAACAGAAGGAAACAAACCC
TTTCCCACATGGGGCTTTCAGTCTAAGTAGGAGGGTATTGAATCCTCATTTTACAGTTAA
GGAATCTGAGACATAGAGAAGGTAGGTGATTTGCCCAAAGTTACCCAGGAAGCAACTGGC
AGAGCTGGGATTAGAACCCACGTCCTGTGACTTCCAGGCCCAAGCTCTTTCCACTTAGCC
ACGCTGCTTCAAAATTCTCCATCAGCTATCTCCCTCTTACCTCCATCCACTTCCTCCTCA
CATTACATTACATTGCCTTTCTTTACATCTCCCAAGCTAGTATTCTAGTTGTACTCCTTT
GTAAATACACTATCTCTCTGCCCACCAAATCGGATTCCTCCTAATTGAGTCACCTCTTCC
AAGAGGTGCTACGTGACACATCTTCCACTTTCCTGACATGCTAGCCCATCTGCCATTTTC
ACCCTGTTTATTATTTATTAGTAATTGACATTGTTCATCTGTTGCCTACTCTGTTGCTTA
TTTTAGTTTTTTGTCTCTTATACCTATGCTCTTACTCTTGTACTTGTAATATGTTTGACG
GTTTTGTTCTCTTGCCTCTTTTCCCAGTAGATTCTAAACTCCCGAATGGGTGGGGGCCCA
AATTTCCTTTTAATGGGTGTTTCCATGTGTTTCAAACATTATTCTGCACACACAAGAAAC
TCAAATGCTGCCGCTGATGTTGGCTGAGGTATTTGTTGCTGAATGGTACTTTCCAAGTGC
TTAGTACAGTGCTCTGCACACAGTAAGCGCTCAATAAATACGATTGAAAGAATGAATGGA
TGACGGTGATGATGATGGTGATGGTGATAGGTGAGAGCTCACCTCCTCCAGGAGGCATTC
CCAGACCGAGCACCCCCTTTCCCTCTGCGCCTCCCCCCAGCTTTCCCCCAATCCCTACCT
CTGCTCTTCTCCCTTCCCCTCCCCTCAGCACTGTGCATACTTGTATATATTATTTATTAC
CCTATTTATTTTGTTAATGAGGTGCATATCTCCGTGATTTTATTTATCTTGATGATGATG
TTTTGTTTTGTTCTGTTTTGCTTTGCTGTCTGTCTCCCCCATTTAGACGCTGAGCCCGTT
ATTAGGTAGGGAATGTCTCTATCTGATGTCGAATTGTACATTCTAAGTGCACATAGTAAG
CGCTCAATAAATACTAATGAGTGAATGAATGATGACAATGACGATTCGAAGCCCAGAGAG
AAGCCCTAAAGGGGCCAAAGGTGCTCCAAGGTCCAGGCACTCCGCAACTTGGCCCGTGAG
ATTGCAAACTCCTTGAGGGCAGCGATCTCATTTCCCCACTCTACTGATGTACTCTCTCCC
AAGTGCTTAGTACAGAGCTCTGCACCCAGTGAGTGCTCAGTAAGTACTATTGATTAATTA
ATGACCCTAATTATAGGAGTTGTCTGACCCTCTGCCCAGTTCAGTGGATTGTCGATCCAA
TCCAAATCCAGAACGGGGTTAGAATTCTGGTTTGGTTCCCTTTGTGACTCCTATTTTAGA
ATGCCTCTCTACCCTATTCAGGCAGCCTTTAGTTATATAAACAAAACCACAGCTTGGAGC
TCTGCAGCTCTGGTTTTTGCACCCACCTTGCACCAGACATACTGGTGTGAGAGAAGTGTT
TACATTTGGGGGGCAGATGTGAAGAAATGAAAGTACATGGAGCTGTTTACGGTTCAGTCT
GCTAAAATGGTGCTCTCTTGAATTTCCTGTCTTCATTTGGTTCCAAAATCATGATGAGAA
GATAGTTTATGATTCACAGCTGTTTTGAAAGTTTTTTGTACTGCCAATAGTCTTTTGCTC
TATATTTTATAGATCTCACAAGTTTCACTTTTTTGGACCGAGACTCATTTTGGGGTTTAA
GTACAGAACTCTGTTCTCATGATGAAGGATTCTGTACTATGTTCAAGACATTTGAAATCT
CACTTGCTTAAATTAGTGTAGCTCTATGTCTTGTTTTATAAAAAGACTTCCTTCAGCCAA
ACCTCATCCCGTTGGGATTCAGTTATCATCATCTTTTTAGCTTCAAAATTTATTATCCCC
TTGGGAAAATCTCATGCAGCATCCTTATTTTCAGAAGAAAAGAAAAGAAAGAAACGAGTC
GTGAAGTGACAGAAGGCATTTATAAGACACCAGCGTGTCACCACTTTTCATCTAAGCACA
ATGTAATTAGAAAGACTTCCGTGTGATCAATAATTATTATTATTAATAATATTTACAAAT
AACCGTGGAAAGGAGAAGGCAGGGAAGAAAGTTAATGACAAAATGAATAGGGTTCTAGGT
GGACAAGACAAACTGCAACATGAGTAATATAGGGTGGACTTCGGAACGATTTCCGGAGGA
TCGAGCGCTGGAGAGCAATGAGGTCTCACATTAGTTTCCTCAGTCAGTTCCCTCCTCATT
CTCCGTGCAGCTAATGGTAATGGTGGCGTCTTCAAAATCCTGGGCCATTTCCCCCGAGTT
CTATAAATTGACGAGTAAAGCAGCATCGTATGGCGATTCCCATTTCATTCAGCCTCTTTT
ACGTAATTATGTTTGAGAATGCAAAATGGGGCCTAGAAACTGGTGTTGAAATACGCTGCC
AGGCCTCCGAGTGGCTTCCAACTCAACAGTTTTAGAACATCATCCAAACCCTCAAGTCAG
TCATCCCGGAGCTGCTTCGTGCCTGTGGGTGTGCTCTGTAACCACACATGCAAGGAGAGA
GGAAAATTATTATGAGCTACTTTACCACTTTGCGACATTACAAACTCTCGCGGTTGATCC
CCTACTCAAGCTCTCCCTCCTCCATGTAAGTCCCTCCTCCTTCACATCTGGCAGGCAAAT
ACACGCCCCATCTTCAGATCCTTACCCAAATCACATCTCCCATGGGACGTCTTTCCTCAC
TCATCTCACCCTATTTGTCTCCTTACTGCATCACCAATACAGTTGTGTTCTTACCCCACT
AGGCACTTAGGTACTTTACCTTGGATCTCCCCCAGTGCTTAGAACAGTGCTTGGCATGTA
GCAAGTGCTCAACAAATACCATTATGATTATTTATTATTACTATTTTAGCACCACCCTCA
GCACTCATGTACATATCTTTATAATACTAATAATAATGTTGGTATTTGTTAAGCGCTTAC
TAGGTGCAGAGCACTGTTCTAAGCACTGGGGTAGATTCAGGTTGTCCCACTTGAGGCTTA
CAGTCTTAATCCCCATTTTACAGATGAGGTAGCTGAGGCCCAGAGAAGTGAAGTGACTTG
CCCACAGTCACATGGCTGACACGTGGCAGAGCCGGGATTCGAACCCATGACCTCTGCCCC
CCAAGCCTGGGCTCTTTCCACTGAGCCACACTGCTTCTATATTCTTTATACTCTGCTTCC
CTTACTTTTAATTTATTTTAGTGCCTCTCCTCCCCCTGCTAGATCGCAAGCTTCTCAGAG
GCAGAGATCGTGTCTTCTAATCCTTTTGTGCTCTCCGCAGTGCAGAGTTCAGTGCTCTGC
ACAGTGTAAACACTCAAGACTATTGATTGTTGGATTACAGGATCAGTGAATCGTTGTCAT
GAGTATGAAGAGTGAAGTTTTAGTGTGATGCCAAGATGTTGGCAGGCTTCACCTAATGTT
TTCAGAAGCTTCACTGGCATCACGTAGAAACCTTAGTCACGTGATGTTGCAGAACAGGAT
TGAAATAGAGTGGTCCTTGAAATTGGGCAATCTGTTAAGATTGCTTGTTGCAACATATTA
TTATTATTATTATATTTATGGTATTTGTTATTTATCCCCTTGGACACTGTTCTAAGCGCT
GGGGTGCATAGAAGCAAATTCGGGTTGGACACAGTCCCCATCCAACCTGGGGCTCACAGT
CTCCCCATTTTCCAGGTGAGGGAACTGAGGCACAGAGAAGTGAAGTGATTTGCCCAAAGC
CACACAGCTGACATGCGGCAGAGCTGGGATTAGAATCCATGACCTTCTGACTCCCAGGCC
CGTCTTCTAGCCACTACATCATGCTGGTTAGTTTTGTCATGCTGGGTGTAAATGAAGAAT
TGTCGGGGGCAGAATCTTCACCTGCTGCCTTGTGATCTTAAGTGGTGAAAATGAAAGTGC
AGGAAACATAAATACATTAAGCACAGTGAAGAACTTCCAAGTGCTTAGTACGGTGTTCTG
CACATAGTAAACGCTCAGTAAAAACTACTGATTGATTCAGATTTGAGTGTCTCCAATCTA
TGTGTTTGGCCCATAAAGAAGCGCTTAAGATATATCTTAACTGCCTTCAAATAGGGGGGC
ATAGAGGCAGATTTGGAAAAGGCAGCAGATGGTGGACAAACTCCCCGGGGCCTTGCGCAT
GCAAAACTGAGATAACTCTGCTTGTGCAAAGGCTTTGGACAGACCAAATGTCAAAGAGGC
AAGAACCGAAAACCACACCGACTCTTTCGGTAACATTTTCAGCCACAAATCAAAGGAAAA
TATTGATGTGTGACCAATGTGGGATTACCAGGTGAGTCTCATTTCAGACACAATCACACA
TGTAGTGTTTCACGGTGTCATCCTTGAATCTAAAGGGTAGACCCCCACACACACAGCGAG
CTGGAACATAATCTGACATTTTCCCTTTTAAATGGTTTTGTAGTTAGTGGAGAATACTGA
TCAGTAAACTCCTTACATCTAGGATCAGTAGGGTTGTTCGTCAGTCAGATTTATTAAGAG
CCCATTATTAAGTGCTTTGTCGTTTGGGAAATGCAACAAAAGTTAGAAGAATAATGGTAA
TGTTGGTATTTGTTAAGGGCTTACTGTGTGCAAAGCACTGTTCTAAGTGCTGGGGTAGAT
ACAGGGTAATCAGGTTGTCCCACGTGGGGCTCACAGTTAATCCCCATTTTACAGATGAGG
TAACTGAGGCACAGAGAAGTGAAGTGACTTGCCCACAGTCACACAGCTGACAAGTGGCAG
AGCCGGGATAGTCACCGCCCTCAAGAATAAGAATTCACACTCTGGCTTCCTTGATAGAGA
GTAGTGTTATTGGGGTGCTTTTGACATGGGTAGGTAGGCAAGCAACTCAACTGAATGATA
GGACACCACCACATCCTATTGTTCCTCTGGGGTTTGGCCAGTGACCTGATGAGGTTGGTT
GGGGGTTAGCACTATCATCCTGTCATCCCATTCAATTGATCAATTATACTTACTGAGTGC
TTACTCTGTGCAGAGCACTGTACTTCGGACAGTGTAGTATAAGAGAGTTGGGAGTCACTT
CCCTGCCCACACCGAGCTTGCTATTCCCAGACCAGATCAGTCAGGGGGATAAAAAGTCGT
GAGAAAAAACCACCCAGGAAAGCTTAATGTCAATCTGGAAGCGAAAAGGAGTCAGAAAGA
ATGCCAGGACGCATGAATGAAGTGAGCCGAGCAAACCATCCAGTTTAATCAGCCCGAACA
AATGTAGGTAATGGTCTTGTCTTATGCCGAGTCGTCTGCCACCCGTAGCGACGCCGAGGA
CACCTCTCTCCCAGAATGCCCCCACCTCCATCCGCAAACGTTCTGGTAGTGTATCCATAG
AGTTTTCTTGGTAAAAATCCAGAAGTGGTTTCCTATTGCCTCCTTCCGCTCAGTCAGCCT
GAGTCTCCACCCTCAACATTCTCCCATGCTGCTGCTGCTCAGCGCAGTTGAGTTTTGACT
TGTAGTAGATTGTCTTCCACTCGCTAGCCCTGCCCAAGCTAGGAATGGAATGGAGATGCC
TCTGCCTCACCCTCCCTCTTAAAGTCCAGACTGGTAGAGTGCTGGAGACTCNNNNNNNNN
NAATTCAAAGGGAAAAATATTGATGTGTGACCAATGTGGGATTACAGGTGAGTCTCATTT
CAGACACAATCACACATGTAGTGTTTCACGGTGTCATCCTTGAATCTAAAGGGTAGACCC
CCACACACACAGCGAGCTGGAACATAATCTGACATTTTCCCTTTTAAATGGTTTTGTAGT
TAGTGGAGAATACTGATCAGTAAACTCCTTACATCTAGGATCAGTAGGGTTGTTCGTCAG
TCAGATTTATTAAGAGCCCATTATTAAGTGCTTTGTCGTTTGGGAAATGCAACAAAAGTT
AGAAGAATAATGGTAATGTTGGTATTTGTTAAGGGCTTACTGTGTGCAAAGCACTGTTCT
AAGTGCTGGGGTAGATACAGGGTAATCAGGTTGTCCCACGTGGGGCTCACAGTTAATCCC
CATTTTACAGATGAGGTAACTGAGGCACAGAGAAGTGAAGTGACTTGCCCACAGTCACAC
AGCTGACAAGTGGCAGAGCCGGGATAGTCACCGCCCTCAAGAATAAGAATTCACACTCTG
GCTTCCTTGATAGAGAGTAGTGTTATTGGGGTGCTTTTGACATGGGTAGGTAGGCAAGCA
ACTCAACTGAATGATAGGACACCACCACATCCTATTGTTCCTCTGGGGTTTGGCCAGTGA
CCTGATGAGGTTGGTTGGGGGTTAGCACTATCATCCTGTCATCCCATTCAATTGATCAAT
TATACTTACTGAGTGCTTACTCTGTGCAGAGCACTGTACTAAGGACTTCGGACAGTGTAG
TATAAGAGAGTTGGGAGTCACTTCCCTGCCCACACCGAGCTTGCTATTCCCAGACCAGAT
CAGTCAGGGGGATAAAAAGTCGTGAGAAAAAACCACCCAGGAAAGCTTAATGTCAATCTG
GAAGCGAAAAGGAGTCAGAAAGAATGCCAGGACGCATGAATGAAGTGAGCCGAGCAAACC
ATCCAGTTTAATCAGCCCGAACAAACGTAGGTAATGGTCTTGTCTTATGCCGAGTCGTCT
GCCACCCGTAGCGACGCCGAGGACACCTCTCTCCCAGAATGCCCCCACCTCCATCCGCAA
ACGTTCTGGTAGTGTATCCATAGAGTTTTCTTGGTAAAAATCCAGAAGTGGTTTCCTATT
GCCTCCTTCCGCTCAGTCAGCCTGAGTCTCCACCCTCAACATTCTCCCATGCCGCTGCTG
CTCAGCGCAGTTGAGTTTTGACTTGTAGTAGATTGCCTTCCACTCGCTAGCCCTGCCCAA
GCTAGGAATGGAATGGAGATGCCTCTGCCTCACCCTCCCTCCTATAGTCGAGACTGGTAG
AGTACTGGAGACTCTCCAGGCGATCCTGAGAGGGGAGGTAATGGTAAGAAAACATATATG
AATAGGAAAAAATAAAATGTTTGGCCATCAGAATGTAACCACTCCTACTGAATATTGGTC
GGTTGCCTTGACTGCTCACTGCCTGGAGAATCTTATAAAGTCCAGGTTCTTCTTCAGACT
ACCAAGCCTTTCTGCATATTGTTATAAAGCATCATAATACTAATGATAATATCTGTTACA
CTATGTGCTAAGCACTGTATTAAGTGCTGGGGTAGATACAAGTTTATCAGGTTGAACATA
GTCCCTGTCCCAAATGGGGCTTACGGTGTAGGGGACGGCAATCAATAGTGTTTATTTTTT
TCTGTCCATAGTGTACTTGAGTAAGCACTTTAGTAAGCCTCACTGCCTTCAAGAAACTTG
AATCTAGCTAGGGGAGACATACTCCCAAATAAATTACAGGTAGGAGGAAATAGTGAAGTA
TTAAGATATTTACGAAAGTGCTAAGTCAAGGTATGAGTGACCTGGAAGTGCTGAAGTGGC
AATTAGAGGAGAATATAGGGTGGACAGATGAGAAATTAATCAGGGAAGGCCTCCTGGCGA
GCTGTGATTTCAAAAATCTTTTCCCTTCTCAGGGTCACCCTAGAGTACGTTAGTACTTTA
GTACTCCAGTCCTCTACCAGTCTCGACTACAGGAGGGAGAGTCAGACAGAGGAATATCCA
TTCCATTCCAAGCTTGGGTAGTGGTGAGTGAGTGGAAGGCAATCTGCTACAAGTCAAAAC
TCACCCGTGCTGGGCAGCAGTGGCATGGGAGAGAATAAAGGGTGAAGACTCAAGTTTACT
GGGTGGAAGGAGGCAATAATAAACCATTTATGTATTTATTTTTATGAAGAACACTCTGTG
GATACCCTACCAGAACTATTGCAGATGGAGGTGGGACATTCTGGGAGAGATATGGCGTCG
TTGTGGGTCAGAGAACACTTGATAGCATATGTCAAGACAATGATCTTTTTAGAACAGCAC
CCTGTAATCTCCCAAGCATCTAGTACGGTGCTCTGAACATAGTAAGTGTGCAGTAAATAT
GATTGATTGATTAACCATTTTAAGTCCCTCTTCAGCCTCTTTCCATCTCAAGATTTGGGT
AAGACATAGCTATGAGGGGATTTAATGTTACTGCCATCATAGTGCTGAGCTGGCCCACCA
AGGGGGGCACCTATCAATCAATCCATCATCAGTCAGTCATTGGTGTTAATTGAGCACATA
CTCTGTGAAGTTACTGTACCAATTGCTCGAGTTTACTGTGTGGAAGGTGGCAAAGCTAAA
CCACTTCCGTATTTTTACCAAGAAAACTATGGATACACTACCAGAACGATTGCAGATGGA
GAGCGGGACGTTCTGGGAGAGATGTGTCCTTGGTGTCGCTATGGGGCAGAAACAACTCGA
CGGCAATCATTCCTTTGGAACTGGTACCGTCTTAGCACCTCCATCCTGTCCAGCCTCTTC
CCCCACCAGTGGGAAAGCAAAAAGCAACCGCTGCATGAGGCTTCCTCAAAGCCTCCTCAA
ACCCTCTTGACTGTAAGAGCAGGGGCAGGGAATATGTCTGCTGTACTGTTGTGTCGTATT
CTCCCAAGCCCTTAAGTGCTCTAAGCACAGTAATTTCTCAATAAATGTGACTGGATGGAG
GCTGGCGGAGTGGTATTACGGATGGCGTGACTATTACGAGTTTACCTTGGACTCTGAGCC
ACACTCCCCCCCTTAATTCTTAGATTGGGAGCCCCCGAGTGACAGGGACCATGTCCAGTT
CCCAGCTCTGTATTCTTTCCCAGTGCTTAGAACAGTGCTCTGCACACAGTAAATGCTTGG
TAAATCTTATTACTACTACTATTAGGTCTCCTGACTCCCAATCTTGGGCTTTTTCCACAA
GGCCAGGCTGGGATGGGGATGGGGGGAATAACCAGGCTGGGATGGGGATGGGGGGAATAT
TTAGGTGCTGCGAAGGTGAGGGTGATGTCAGTAGGGAAGGAAATTGGGAGGAGAGATGAG
TCCGGGAAATCTTCCTGGAAGGGATGTGATTTTAGTAGGACTTTGCCGAGCAGTGGTCCG
ACCATATCGGAGAGCCACATCTGGTATTATGAAGAGCCAGATTTGACTGTCAAACCATAG
ATTCCTGCCCCTGGACTTAATCGTCTGGGCTAACAAAAACCAGCACCTCACCTTTCCATT
TGGATTCCAAAGCAAGATGATTAAACAGCAGGCAAATACCTAGTAAAACCAGTCATGCCT
ACATTTGGAAAAGCCTACATTGCTAGGCTTTGAAACTTTGAAAGCTTTTTCTTAGTCTTC
TTCATTCTCCCCATCAGCTTCACCGTTAAAGAGCTGTCACAGAAAATATGGGTTTTGAAT
GGAAGAACATATGGTCTGGCTGAGTAATGGATAAACACATCTCAAGTCTTTTTCCTCGAA
GAGTCTTTTACATGGTATTGGCTCCCTATCTCTAGATCTTTGCTTTGCCCAAGCTAGCCT
TCTTATTGTACCTCACTCTTGTCTCCTGTCTCCAAACCCATCGCACACACCTTTCCCTTG
TCTAAAACTCTGTTCCACCTCAAATCCACCAGGCCTTGTTCCTCCCCTCTTTCAATGCCC
TCCTGAAATTATTCTCCAGAGGCATTCTCCAACTACTAAGACCCCGGTCTTGTCATCCCA
ACAGCTCCCCTTGGCACTTATGTATGTTTACCATTCCATTAATTGTTTATTCATTTTTCC
CATGATCTCATTTTTGCCAGCTATAACTATAGGTTTCCTTCTGTTCCTTCTGTAGGGACA
CATTTTATGTCCACCCATCTGCCACATTAGAATGCTTTTATTGTATTCTCCCAAGTGCTT
AGGCTCTGCACACCGTAGGGACTCAAAAAATGCTATTGATTACTAATGATATACAGGAGT
GGTACCGATGGCTTACTGAGGCTGTGGATTTGGTTTTATAGCTTGCAATTGGGCTTGTTT
TCCATGGCGTGTTTTCCTTACAATGTTATAATAGGATTCGGTTTTCTAGGGCAACCTAGC
AAGGAGAAGATTTTCTAGTTATTGTCAGCCTTAATGTTGCTCATGGAATTAAATAAGATT
AAGGTTCTTATGTTTGGGTAGAATCTCTTAATCCTTGCAGTATTTGAATAGGCCCATTTT
GAATGTTTTAAAATTCTGACTAAAAGTATATGAAATTTTATTTTGTTTAAAAATTTTCGG
CTTTTCTCAGTATTTTGCTTTCTGGCGTTTGAAACTTTATTCTGTCTCATCTAGAGTACT
CATTGATTTTAGTAGATAAAACCAACTACTATAAATTGATTATCCTGTTGAGAATTCTCA
ATTCCAATGCCCACCTGATAAATCAGTTTTGGGTGAGGAACGAGAAGTAATGAGCTTCAA
ACCTGTTTTGATTCTATTTTTCTCATTGGAAACTGGATCCTAGATGGAAAACAGATATTG
AAATTTTCCTTTGTACATTTTCATTTTCTCTTTGTGGGCGGGTGGTGATGGTGGTGGAGG
GGAACGTTAGAGAAAGACGACAAGCCTGGGATTTGTTTCCCACCTCACTTCATTCCTTTC
AGAGGGAGTTATTCAGCTCAGTGAGTGGAATATTTTAGTGAAAGATTACCCGACCCTAGG
ATGTCCAAGTTATCAACTCCAGAAGCTGAAAGGTGAACTCAGAAATGGTGGAAAAAATAG
TTCTGACAGTCAGGTAAGGTGAGTAGCCAGTCAGAGAGTGTTGGTTGAATGCTCACATGA
TGCCACATAACCAACACTTTTCCATTAAATATAAAACCCAATCTCTGTTGGCCACTGAAG
CTTCACTGTCAAGGTCAAGTCTGGTTGTGTAAATGAGGGGGATTGTCATCACAGGCAAAC
AGATTCGTCTGTGTTCAGAAGTGTTCCTAACAAACTGAAATTGCAAAATAAGTTTCTCAT
TGGAAGTGGAACTGGGAATTGTTATAAATGCAGTGAATCATGCCTTGGCAAGCATATGAG
GGTCTTTAGGGATGTTTCACAGTCTCGTGCCCAACTGGTAGGATGTTTTTATCTGTAACA
GGTAAGGAAGTTGATCATTTCTGTTGCTATCGTACTATTAGTATTATTCCATAAACATAT
TCAGAATTGATGATGAAATCATTTATTTTCCCCGCTTCTTTATACAATGCTGCGGCTTCT
CTCCAAAGGAATCTGGAATTGGTTCCTGCTAACGCTTCCCGATTTTACCATTTCCCAAGC
TCAGATGTTAAATATTAAGAAGAATGCCCCTTTCCTTATGTCATCACCCTAAACTTATTA
GTTGTTTTTACAGGGGGTGGGGGGAAGTACTTTCCTCTTTCTCCACTACATCAGTATGCT
TTTTCCTGACACACATTTCTCCCTTTGTCTTTTTGGTTTAGGAAGTCCTGGAAATGCCCC
CAGATGATTCTCAAGTGGCTGGGATTGCTGCAGCATCAGAAGTGATTCGCTATGAATATC
ATGTCGTATACTCCTGCAGCTATCAAGCACCTGTGCTTTACTTTAGGGCAAGCTTTTTAG
GTAAGACCATCGAGGGAGAGAGAGGGAGAGAAAAAGAGAGAGAGAGAGAGAGAGCGCATG
CACATTCATTTGTCATATTCAGGCAGGAAAAAAATGTTTTGAGAAGATTCATTTGGTCAA
AAAATGAGTATCGTTGCATCCAAAGGGAGTGGAAAGGAAGAAAAGGTGGGCCGGGTTATA
CCAGTAAATTTTCTCATCTTCAGATAGAGTGAACATCAGGACTTTTGAGTAGATGATATC
ATCCCAGCCTGAAGAAGCCTGATCTTTAGACTCCTGGCATCGTGCCTGTGGTTGACTAAG
CCTCATGGTGATTTTTCTTTTTTCTTCTTTAAACAAGTAGAAAGAATTTAAAGCTGCATT
GCTTAGGTCCAACTTTGCAGTAAAAGTAAGCAGTTTGCTTTAGGTTTCTTTCACCATCAG
ACAGCTCCACAAGACTCAGAAATCCCCAAAAACAACAACACGTGATTTATATCACCGATT
TCAAGGGCTTGTTTATGGGTTCGTTCAAACCCTCTTCCAGTTTCTTCCACGTTTCCCTCC
CTGCCCTACCTTCATCCTGTTATCTACCTTTCTGGTAGCCCTGTTTGTGCCCAGCGACCT
CCGCTATCACTTTTTCTCTTGTTCTCCTGCCAGGAAGTTGGGATGAACACGCCGCCTCTT
CCGCAGCCTCCGCCGATAAGGCTTATTTAATCAGCGGCCATGGAGTGTTTGGGCTGCAGT
TCAGTTGCCTTCACCCCTCTTCACTCCTTGGCGTTCATAAAGCATCTGGCTGAGGGAGTG
GGGCATTTCTCGTGGTCTCCTCCCAGCTGGTAGCAAGAAGCTGCCTTTTCAACCAGCCTC
TAACTTTATCTAGGCGGCCAAGACATCCAAATGTAGCCTGTGATATTTTATTTTTAATTA
AAAAGTAGCTTAAGCTGCTATGAATGTGTGTTTGGTAGATTTAATCACTTGCTGCCTTAT
ATTGCTTAATGGTCTCCAATTTTGCAGCGTTGGCATTTTAACAGGCATTTAGGATTTAAA
ACCCACAAACAA
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1233, 11810..11932, 26745..26855, 103061..103231
11822..11932, 26745..26855, 103061..103231
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved