Ornithorhynchus_anatinus Locus RABGGTB
snOPY snoRNA Orthological Gene Database
Ornithorhynchus_anatinus RABGGTB
Ornithorhynchus_anatinus
RABGGTB
Contig5910
SNORD45, SNORD45, SNORD45, SNORD45
4498..4578, 5003..5086, 6802..6884, 8726..8807
14671
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGTGGATTCGTTGTTGGGC
AGGGAATGTCTCTATCTGTTGTCGAATTGTAATAATAATAATAATAATGATAATGTTGGT
ATTTGTTAAGCGCTTATATGTGCAGAGCACTGTTCTAAGTGCTGGGGTAGATACAGGGTA
ATCAGGTTGTCCCACTTGAGGCTCACAGTTAATCCCCATTTTACAGGTGAGGTAACTGAG
GCCCAGAGAACTGAAATGACTTGCCGACAGTCACCCAGCTGCCAAGTGGCAGAGCAGGGA
TTCGAACCCATGACCTCTGGCTCCCAAGCCTGGGTTCTTTCCACTGAGCCATGGTGTGCC
TTCCCGAGCGCTTATTTCAGTGCTCTGCCCACAGTCAGGGCTCAGGACAAATGCCGAATT
GTCCATGCTGAGCCTGTAGTCCAGTGCTCTGCACATAGTAAGCGCTCAATCAATACTATT
GAATGAATAAATAAATACGAACGAATGAATGAATAAATAATGTTGGCATTTGTTAAGCGC
TTCCTATGTGCAGAGCACTGTTCTAAGCGCTGGGGGAGATACAGGGTGATCAGGTTGCCC
CACCTGGGCCTCACAGTCTTCACCCCTATTTTACAGATGAGGGAACTGAAGCACAGAGAA
GTGAAGTGAGGTGCCCACGGTCACACAGCTGACAAGTGGCCGAGCAGGGATTTGAACCCA
TGACCTCTGACTCCCAAGCCCAGGCTCTTTCCACTGTGCCACGCTGCTTCTCAATAAATG
AATGAATGAAGGGAGGGAGGAAGGAAGGAATGACTGAACAAATAAAAAATAAATGAAGAA
ATAAATAAATATAGAATGAATGAATGAATGAATGAATGAATGAATGGAGAGCAGACGTCT
CTCTGCGCCTGCGCGGAGTCCAACCTCCCTCCCCTCCTCTTCCCCCCTCCCCCCCCGCCC
CTCGGGGGCCGGGGCCTTGGCGGTTGGGGCGGCGGAGGCCAGTGCGCAGGCGCGCCCCGC
CGTTGCGCATGCGCGGGGTGGTTAAGGACTGGCCGGCCCGGAGGCCTCGCCCTCCTTTTT
GGCGCCGACATGGTAGGTGACGGACGGCGCGGCCCGGGCCCTGGGGGACTGGGGCGGGGG
GCGGGGGGCAACAGCCGGGCCCGCACCCGCGGGATGGCACCCAGATGGGACAGAGATGCA
CCGTCGGGATGCTTGGACCTTGCCCTGCCCTGCTCTGCTTTCTTCTGCCCTGTCCTGTCC
TGTCCTGTCCTGTCCTGCTGGGGTGAGCTCTCGGCCCCTGCAGCGGGCCAGGAGGCGGAG
GGCCCCGCCCGGCCCCATCCGCGCCTCCCCCCTTCCCTTCCTCTCCCCACCGCATTTCTC
CTACAGCTCTATCATTTTCTATTTATATAAATGATCGATGCACATATATATATATAACTT
CTGGGCCTCAGTGACCTCCTTTCTAAAACGGGAATGAAGACTGCGCCCCATGGGGCCTAA
CCTCAGTGCCTTCTGTTCATTCAGTAATATTTTTTGAGCGCTTACTATGCGCAGAGCACT
CGACCTATTAAGATTGAGCCCCATTGAGGACAACTGAGCGCTTACCATGTGCAGAGCAAG
GTGCCGATTATTAAGACTGTGAGCCCCATGGGGGACAATCTCAGTGCCTTCTATTCATTC
AGTAGTATTTACTGAGCGCTTACTATGTGCAGAGCACTCTACCTGTTGAGATTGAGCCCC
ATGGGGGACAACTAAAGTGCCTTCTGTTAATTCAGTAGTATTTACTGAACGCCTACAATG
GGCAGGGCATTCTACCGATTATTAAGACTGTGAGCCCCTTGGGGGGCAACCTCAGTGCCT
TCTATTCATTCAGTAGTATTTTTTGAGCGCTTACTATGTGCAGAGCACTGTATCTATTGA
GACTGAGCCCCATGGGGAACAACTTCAGTGCCGTCTGTTCATGCAGTAGTATTTACTGAA
CGCCTAACCATGTGCAGGGCATTCTACCGATTATTAAGACTGAGCCCCGTGGGGGACAAC
CTCAGTGCCTTCTGTTCATTCAGTAGTATTTACTGAGCGCTTACTATGTGCAGAGCAATG
TACCTATTAAGACTGAGCCCCATGGGGGACAACTTTAGTGCCTTCTGTTAATTCGGTAGT
ATTTATTGAGCGCTTACTATGCAGAACACTCTACCGATTTTATTAAGACTGTGAGCCCCA
TGGGGGACAACCTCAGGGCCTTCTGTTCATTCAGGAGTATTTACTGAGCGTTTACCATGT
GCAGAACACTGCCGATTATTAAGACGCGCTTAGTACAGTGCTCTGCACATAGTAAGCGCT
CAATAAATAACATTGAATGAATGAGCCACGTGGGGGACAACCTCAGTGCCTTCTGTTCAT
TCGATAGTATTTATTGAGTACTTACTATGTGCAGAGCACTATACCGATTTTATTAAGACG
GAGCCCCATGGGGCACAACCACAGTGCCTTCTGTTAAGTAGCATTTGCTGAGCGCTTACC
ATGTGCAGAGCACTTTACCGATTATTAAGACTGAGCCCCATGTGGGACAACCTGATCACG
TTGTGTCCCCCCCACCGGCGCTTAGAACAGTCCTTTGCACATAGTAAGCGCTTAACAAAT
GCCATCATCATTATTAAGACTGAGCCCCATGTGGGACCTTTTATCTCCCCCAGCGCTTAG
AGCACTGCTTGGCATATAGTAAGCGGTTAGCAAATATCATATTAAGACTGAGGCCATGTG
GGACAACCTGATTGCCTCCCCTATCTCCCCCAGCGCTTAAAACAGTGCTTGGCACATAGT
AAGTGCTAAACAAATATCATCATTATTATTAAGACTGTGAGCCCAAGTGGGAGAAGTTCA
TTATCTTGTATCTCCCCCATTGCTTAGAACAGTGCTTGGCCCATAGTAAGCTCTTAAATG
TCATCATAGTTGTTGTTATATCTCTTAATTTTATTTATTGATTTTGATGCCTGTCTTCTC
CCCTCGACTGTGAGTCCGTTGTGGGCAGGGATGGTCTCTCTGTTGGGATTGTGCTTTCCA
AGTGCTTAGTAGAGTGTTCTGCACATAATAAGCCCTTAATAAATACGTCCATGGGGGCCC
TGGCTCCTGCAGCCTCCACAGCCAGGACCGGCGCCAAACGGGTGGGAGCCCGAGCACCAT
GTGTCCTTCGGACTGGCTACCTGCCCGGGTGGTGAAGGCGTTATTTGTTGAGCGCCTACA
ATGTGCCAAGCACTGTTTTAAGCGCTGGGGGAGATAAAAGAGCATCAGGTTGCGCCACGT
GGGGCTCACAGTCGTAATTCTCATTTTACAGATGAGGAAACTGAGGCCCAGAGAAGCGGC
CTGATGCCTATTTGCTTTGACTGAGCCCGTTGTCGGGCAGGGATTGTTTCTGTTGCCCAA
TTGTACATTCCAGACGCTTAGTACAGTGCTCTGCACACAGTGCTCAGTAAAGACGTTTGA
ATGAATGGCTTGGCCAAGGTCCTAGAGCAGAAAAGTGGCATAACCAGGGTTAGAACCCAC
GATTTGTGACTCCCAAGCCCGGGTTCTTTCCACTAAGCCACGCTGCTTCTACGTGAGGTG
AAGAGGCTGCGGGCGGGAGGCCAATCCGGAAAATGGTGGTTTAGTGGCAAAAACCCTGTG
CTTGGTGGTCAGAGGATGTGGATTCTAATTCCGCTTCCGCCATTTGCTGTGTGACCTTGA
GCTAGTCGATTAACTTCTCTGACTCAGCTCATCTGAAAAATGGGAATTAAGACTGCGAGC
CCCACGTGGGATAACCTGATGACCTTGTATCCACCCCAGCGCTTTGAACAGCGCTTGGTA
CGTAGTAAGCGCTTAACAGATAACAAAGCGTTTTATTGTTTATTATGGTATTTTAGCACT
TTGTGCTAGGCACTGTAAGCACTGGAGTGGATTCAAGCAAGACCGCTTGGACTCAGTCCC
TGTCCCACGTGGGGTTAAGTGTCTCCCCATTTTGCAAGTGAGTCTCAGTGAAGTGACTTG
CCCAAGGCCACATAGACAAGTGGGCGGACCCAGGGTTAGAACCCATTCATTCAGTCAGTC
GTCTAGATTTGAGTGCTTACTGTGTGCAGAGCACTGTACTAAGCGCTTGGAAAATACAAT
TCAGCAATAAAACAATCCCATGACCTGAAAGTGCATAATAAATGGCAGTACTATATTAGA
AGAGTTAAATTTCTAAATAATTCTTAATAGGCAGAGCCTCTTTGCTCCTGAGTTCTGAAT
CTTTGCAAGCTTCATTTGATAAGTGTAGAATTCGAGTCTCCTTATCCACAAGAATCACAT
CAGGACATTGATTGTAAGGGCGGTGATATCTGGAGGCAGTGATGGTCAGAGTTTTCTCTG
TCAATGATGAGTTGGCATGTATTCTGAATCTAAAGTTGATGTTTATCACCATTTAGCTCT
AGAATTACTCTGAGGCTTGAGAAAACTTTGCTACTTGAGTCCTCAGTTCTTAAGAAGAAC
ATTAATGCCATAGGGTTTTTGATCAGGACTGTAAGTATCCTGTGATACGCAGAATTTGTC
TGAACAGAATTTTTGGTTTATTGAAAGGGGACGCCCCAGAAGGATGTAATAATCAAATCC
GATGCTCCGAATACACTGTTCCTGGAGAAACATGCTGATTATATCGTGTCATATGGATCG
AAGAAAGATGATTACGTATGTAGCAATATTTCGTTGATGATAATTCACTGTTACAGCTTC
TTGGTTAATTCAAAAGGATTGAGTCCCCCTCATTGGTAACCTTGTCAATAATTTTAATTT
ACTTTTTGAAGTTTTCATTAAATTTATTACTTTCTGCTGGCTCCACTCTAAAGTATTGTG
GGGACCTAGGCAGCGGTTTTCAGGGTCAATGATGTTTTGGCATGTATTACCTGAATCTAA
AGTTGATGCTAATTACCTCTTCAGCTCTAGAATTACTCTGAGACCCTGAAACATTTAATT
AATAGGTGACTGTAGTAAGAACTCCCTTTTGAAACAAGGTACTTAGGAAGATTGAAAAAG
GGGCCCTTCATTGATCTGTGTATTGATCCAAGTATATGTATTTACCCCTTTGGGTAAAGA
TGTGAAATTTGGACTACTGCCTGAGTTTTTTGAGGTATGAGACACCAATTAAATGGTGTC
TGATAATATATTTTTGTCAAAAATATGCCAGTGAGTTACCAAACCCCTCCCTCCACTTCT
GGCCTATCTTCCATCAGCTTACTTAAAGAGGCTTCTTATCCTGTGTAGCTGGTTTGTAAG
AGAGGAGAAAAGAGCACTGTGAAAGGAAAACTGCTTCTGCCCCACACAGAAGAACTGTAT
GACTCTGTCCTCTGTCTTGCTTCCTGGGAAATGGAGTAGTTTGACGTAGTGAAAACAGCT
TCCTAGTCGGGGCACCTAGATTTTGATGCTATTGTGACCACGGGCAAGTCTTTAACTTCT
GCCTCAAGTGTCCTCATCTCTAAAATGGATATTAAATACCTGGTCTTTCCTATGCCCACG
TGGTACAGAGACTTGCTGATTGCATTGCATCTGCCCCAGTATGCTTAGTAAAGTGCTTGG
CGTACAAAGCAAGCCCTTAACAAATACCGCAATTATTAATTCATGGGTCCTCTGGCTGTA
TGTCTAAAAAACGTACAGCTCTCACCAACGACTATTATAGTATAGACGCACTTTTCCCTT
TTGGGCACTAGTAAAATTCTGAAATCTTTTTTGGGATCTCAAGTATGTGCCCAGTAGGAT
TTTCCTTCATTGTAGAACAAGTTCAGTTTCCACTGGCGAAAGAATTAAGCCAGAACTATT
TGAGATTCTGAAATCTTTGGAGGATAAATTTAACCTGAATTTTAAACTTGGGTCAAAAAC
TTGAATTCTATCCCAACTAGAAGGTTTTCAAAAGTAAAAGCTCAAACCTTTCTTACCTGA
TTGCATTCTACTGATTTGGCTTTAAAAAAAGATCTTGAATCCAAATCTGAAGAAATTTAT
TTGCAATATGAACTATTTGCAACTTCATGCAGCTTTTTCGATTCCATGAATTGTGCATTT
TAGGAATATTGTATGTCCGAATACCTAAGGATGAGTGGTGTCTACTGGGGATTGACAGTA
ATGGATCTTATGGGTCAGCTTCATCGGATGAACAAAGAAGAAATTCTTTCATTCATCAAA
TCGTGCCAGCACGAGTCTGGAGGAATAAGTGCTAGCATTGGTCATGACCCCCACCTTTTA
TATACACTGAGTGCTGTCCAGGTAATTGTGAAGAAAATCTTCCTTGAAATGTCTCTACCT
GCCTTGCCGGCAATTGTATTTATTTTATGATGTTGCACTGAAATACTCTTGCCATCTCTT
GCTAAGTCAATTTTAAAATTGCTTTCTGTCCTTGGAAACAGCCTGTTCATTGTCATGTTA
TGGATTGTTTTTTATACAAGTTGAAATAAATCATTTGCTGAATTATTCTCAGGGGGCTCA
ATCCAGCATCTACAGAAAGTTGATCTGTCCATAAAGAAAATCGACGGTTCTTGTTAGGGA
CCTTTAATGGGCATTTCTTGGCTTTTAAAAATCGTTTTTAAAGAGTGATGTGCTCTTTCA
ACGTTACAGAAGTTATATATCGGCACATGGACACTTTCTGGGAGAGAGCACTTAGTTTTT
GGATGCCGGTGGTAGCTCCCAAGGTCAATGATGGTTGGCATGTATTATCTGAATCTAAAG
TTGATGTTTATCACCACATTAGCTCTAGAATTACTCTGAGACCTTGGAAAACAATGTTTT
ATGCTCTTTTACCTCAAAAAAGTCATCTTGTTAGGGTTACTCAAGTTTCTGAGGATGATA
GAGTGGCAGGGCTTTGTGAGTGGATGAGCTGGGTTTTTTTTTTAACTCTGGGAAAGTATC
TTCAAATCCAGTACTTTTTTAATATAGGGAAGACAAAACCCCCATCTACATCTAACCAAG
CATGATTGAGGCCAAGCATCAAGTTTGATTTTTGTGTTGTCTAGCCACAGAAATGGAGGC
CCTTCCTAGTGACCGAGCTGGAACCAGCTGATACTTACCGAAGTGCTCTGCTTTACCATG
GTCTTTACAGGCCCTTGAATTGAATCATCCCTGTAATAAAGTAAGGCAGTGGGAAAGCTT
TGCCTATGTCCTGGGTTCTCGTGGGCAAGGAACATACCAATTATTTTAGTAGTAATAGTA
CTTCAGGGTTCAGCTTGGAGAGAGAGTACAGAGATGGGAATTGGACATAGTTCCTGTTTT
GCACCACAACTATTTGAGTCTGATCCTGTACTTTGAAAACCAAAACCCCAGTTCTTTGTT
TCTGGATGAGCCCCCTGGAAAAAAATTTGCAATTACGTTTCAGAAAAATTAAGACAGAAG
GTTGGTGTCAGGCTCAGAGAAAATATGAAAAGAAGAGTTAAATTAAAAGGGAACAGGAAG
TGGCACAGGAGTAGGAGCAGTGAAGACAGGAGGTTTGGAAGGGAATTGTAAAAAGGTGAA
TCAACAGAAAGATAGAAACAGAGAGGGACAAGTAAGTGTATTCACACCTCTAACTTTGGC
TGAGAATTATGTTGTGTTTGTGAATAGGTTATTGCAGTTCCCACTCACTGCCACTTTCAT
TTCTGTTGAACAACTTAGGCCACCTTATCCTAACATACTTTTTGAATAATTTTATTTCTG
TAAAATGGGGATTAAGTCTGTGAGCCTCAGGTGAGACAATCTGATGACCCTGTATTCATT
CATTCAATAGTATTTATTGAGCGCTTACTATGTACAGAGCACTGTACCAAGCACTTGGGA
TGAACAAGTCGGCAGCAGATAGAGACAGTCCCTGCCGTTTGACGGGCTTACAGTCTAATC
GGGGGAGACGGACAGACAAGAACAATGGCAATAAACAGCAATAAACAGCGTCAAGGGGAA
GAACATCTCGTAAAAACAATGGCAACTGTATCTACCCCAGCACTTAGAACAGTGCTCTGC
ACATAGTAAGTGCTTAACAAATACCAGCATTATTATCTTAAGCCTAATGGTGGTAAACTC
CCGCAAATATTTTTCAAACATTACTATCTACAGCAGTAAAGTTAAGAAACTAAGGACTAA
GCCCAAGCTTCACCACTATGAGTGCTTACAATGTGCAGAGCACTGTACTAAGTGCTCATG
GTGTTGTTGAAATAGGGGAGGCAGAAATGTTCCGTGCCCACAACAAGCACGTTAACAATT
GGCAGACACTACTTTTGCTTCTGACCTTCAGTTTGTAAAACAGAAACATGGTCTGTTTAA
TTTATCATCGGGGGTATGTATTAAGCATCATACCAAGCACTGGGGAGAGTTCAGTACAGT
AGTTGGGGTAGTCATGTGCCCTGCCTATAGCAGGTTTGCATTTTGAGGATTTTAGATTCT
GCCCTATTCAAGACAAACTCAGTAAATTGGCTTTTCTTTTGCAGATCCTTACGCTTTACG
ATAGTCTTCACGTTATTGATGTAGATAAAGTCGTTGAATATGTACAGAGTCTACAGAAGG
AAGATGGTTCATTTGCTGGTGACATATGGGGTAAAATACTTTGCTTTATTTCATTGTTTG
TACCATTGTGCGGTGTTCATTTTCAAGGTCAGTGATGTGTTGGCATGTATTATCTGAATC
TAAAGTTGATGCTTACCATTCCTATAGCTCTAGGATTACTGAGACCTTGAATTATAATGG
AAAGTTTTATATCTGAATTAACTGACAAGTATACATTCAGATGGTCCCAACTGAGTCTAA
TGACTCCTCAGTTTGGGAAATTGGTACCATTTTGGCAACGTCATTTGTGCCCCAAAATAG
CTTTCTTGAAGACTTTAAATGGAGAGATAGCAGAATCTTCTAATGCATTTGATTGCTCTG
TCCAAAGATTGTAGTGATATTTTAAAAAGTCTTAAGCTTTTCATCTTTTCAGGTCCCTCT
AAGTAGCTGATCAGATTGGACATAACTGTCTGCTGGAAGTTGTAGCATGCACTGTAGTTA
TGGGTTCAACATCCCTGAGCCGTGGACCCGAGGGGGTCTAGGAAGCTAAGGTACGTAACT
ATTTTTGTCCCCGATATTTAGTGGCTTTGTAAAGTTTTTTTTAAAAAAATTTGTGCACTT
GGGGATAATGGAAAATAAGACTTTACAAACTTGCTGAATATTTGAGGGGAGGAGAGTGGG
GCGGGCCAAATCTCACCTCCGATGTAGACTGCTTTAGATTGAGCCCTCACCGATACAGTG
CAGGCTGGAGACGCCAGCAGCCGGTTAAAGGTTCAGACAACAGCTGCTTTAAGGGACATG
AAAATAGAAATCTGGAACTCTTATTAAATTGGTGAATAAACAGGCTATTGTAAAAAAAAT
GTTTTAGGGTAGATTTACTGAAATTCCAGGATTAAAATTTCAGCACAGCAGGTTTTCCAT
CACCTTCATGGGAAGATTCAAATTTCGGGGAAGGTGCACTGTAAAATGTGCAGTGGGTAA
TTTCAGTGTGCCTTTTCCCTCCCAGGAGAAATTGACACACGATTCTCTTTCTGTGCCGCA
GCAACGTTGGCCCTATTGGTAAGTTCAGTAGATTTTATGTTAGCTTGCTTGGCGCCTGAT
TATTGGAATTTTAATGAAACCTCTGTTTTCGTTTTCAGGGGAAGTTGGACGTTATTAATA
TGGAAAAGGCTGTAGAATTTGTGTTGTCCTGCATGAACTTTGATGGTGGATTTGGTTGCA
GACCAGGGTCTGAATCCCACGCTGGACAGGTAAATACTTGTTCAAAACAACCCATTGACT
TCCCTTAACACTTGTTTGCTCCCAAGCTCTAAAGACAGTGCCCTTGCATATACAGTAAAT
GTGATCTACTTTGCTATCACTATACTCACTTGCTTCCACCTCCCTGAAATGAGTTTTAGA
GGTTTATTTCGCTGGTTAGATTGTAATCTTCTTGTGAGCAAGGACTTTTACTGAACTCCC
AAATACTTCGTATACTGCTCTGCACACTGTACTCACCAAATACTATTGATTTAAACCAGT
TAAATAAGAAATGGGTGCAAACAAACGGATAATGACTTGCAAGTGCCCCATGCAATTTAT
TGGAATTATATATATATAAAATATATATATGTATTTAGCTAGACTTTAGCAGCCATTTTA
AAGTGAAAATCAACGTTACTGCAAATGACGGTCCCTGAAGCAAATAGGAAATTTGTAGTA
ATGCCAGGTCATTCTAAACATGCGTGATTTTTCAAATGTTTGTTAGTACCCTGTGAGTCT
TCTCTGAAAGTTAATGTTCAAGCATAGTTCTTACGTGCGAACTTTGTAATTTTAGATCTA
TTGTTGCACAGGATTTCTGGCTATCACTGGCCAGTTGCACCAAGTCAATTCTGACCTGCT
GGGGTGGTGGCTTTGCGAACGTCAGCTGCCATCGGGAGGGCTCAACGGACGGCCAGAGAA
GGTATCGACTCCCATGTTTTTTTGTATCATTAACTAACTTAGGTGGTATTGCTCTTACCC
ATTCTTACGGTCAGGTCTGCCTCAAGCTTAAAGGTAAAACCCAAAATTTGCATCCCTCAA
GATTGACAACATTTTTAATAACAATTTCTCCTTTTAAGCAGATGGCCAGACTTTTCAACT
TTTCTTGCAAAGAAGTCCAAAGCAAGTTATCTAGGCTATGGAGCCCCCCTCAAAAGCTCA
CTCCTCACTGAGGCATGCCATTCAAAAGAACATTAATAAGGGAATAATGTAGAGCAAGCT
GTCTTGTAATATTTGTTTATTTCTTATTTTAGTTGCCAGATGTATGTTATTCTTGGTGGG
TGCTGGCATCCTTGAAGATCATCGGAAGGCTTCACTGGATTGATCGAGAGAAACTCTGTT
GCTTTATTTTGGCTTGTCAAGACGAGGAGACGGGGGGCTTTGCAGACAGGCCAGGAGATA
TGGTAAATGACCTAAAATCTATTTTTAGTGAACCTTTCATTTCAGTTGGATTGAATCCAA
TTGGGAATGGGGGAGAGATTGAGGTGAGAGACCCCAGAATGTGAGTTAGTGGTTCATTTG
TTTCACTCAATCTAATTTTCAAATGCCCGGGGTGTTTCTCATGGTATAATTGTACAGCGT
CATTGGCATTCTGCATTTCTGACTATCCTCGCCACCTCGTTTGGGGCTTGGGTATAGCCA
CCTTCCACTGTGAAGTTTGAGAGGTTTTTTGGGTAGTCATTAGCTTTATTCATGAGTAAA
CACTGAGGAAAAATAATCAGAAGCAACATGGGAATAGTGGATAGAGCCTAGCCCTGGGAG
TCAGAAGGTCATGATTTGTAATGCTGGCCCCGCCTCTTGCCTGCTGTGTCTTTGGGCAGG
TCGCTTCACTTGTCTGCCTCAGTTACCTCATCTGTAAAATGGGGATTGAGCCCCATGTGG
AACAGGATCGATGTAACCCAATTTGCTTGTATCTACCCCAGTCCTTAGTACCATGACTGG
TACCTGCTAAGGATTTAACAAATGCCATTATTTGTATTGTGTATCGTGAGAAGCAGCGTG
GCTCACTGGAAAGAGCACGGGCTTTGGAGTCAGAGGTCATGGGTTCAAACCCCAGCTCTG
CCACTTGCCAGCTGTGTGACTTTGGGCAAGTCACTTAACTTCTCGGGGCCTCAGTTCCCT
CATCTGTAAAATGGGGATTAAGACTGTGAGCCCCACGTGGGACAACCTGATTCCCCTGTG
TCTACCCCAGCGCTTAGAACAGTGCTCGGCACATAGTAAGCGCTTAACAAATACCAACAT
TATTATTATTATTATTGTTCTAACCTGGGAAACCTTACTGACCAATTCAGCATCTCCCCG
CTGAGGGCACATTTCCTCCAAGAGGCCTTCCCTTCTCCCGCTCCCTTAGGTGTTGCCCTG
ATTTGCTCCCTTTATTCACCCTCCCTCCCAGCCCCATAGCACTTAGTTTAGAGCTGCAAA
GTTTAGAGCTGCAATAAGCTTGTGGTGGGCAGGGAATAGGTCGACTTATGTTTGTACCCT
CCCAAGTGCTTAGTTCAGTGCTCTGTACACAGTAAGTGCATAATGAATGAATGCTTCCTC
AGTCTCTAAACCTTAATAGCACTCTCCCGGTCTCCTCCCCCAATGGCACATATGTACAGT
TAATCAGTGGTACTGAGCACATACCCCACGCAGAACACTGTACTAAGTATTTGGGGGAGG
GCACAATATAACAGTTGTTGATCCATTCCCTGCCCACAACCGATTGACAGTCCAGAGTTC
ATACCTTTACTAGACTCCCCCTCCTCCTCCCCACCGTTGAGGAGGGTGGGTCTGGGGAGC
AGAGTGGGGGTGATGAGTCCTTCAGACTAGAGTCTCTGACCACCTTTGCTGAAGACACAG
ATCTCTGACCCATTCTGAGACTCCCAGCTCCTGAGTGGTGATCGGGTGGGGTGGGGCACG
GTTGCTTGTCCTACTTGCAATTCATGTCAGCCTCCTGCTAGATCATTGTGACTATCTTGT
TTTTGTCTGTCTGTACCCCCCATTAGACTGTGAGTCTGTCATTGGGCAGGGATGGTCTCT
ATCTGTTCCCAAATTGTACATTCCAAGCACTTGGTATAGTCATCTGCACATAGTAAGCGC
TCAATAAATACTATTGAATTAATTAACTTCCCGAGGGCAGCGACCATATCTGTTAACTCT
CCTCTCCACTGCTTAGGTCAGTGCTAGCACAAGATAACCACCTAACAAACAGCAAAATTA
TTCTTTTTCTTATGTTTGAAATGAGAACCATTTGTCTTTGCTTGTCTTTGTCAACCAGTA
AAGGAGATTCCATTGTGTTTTACCAGGTGGATCCATTTCACACATTGTTTGGAATTGCTG
GCCTATCACTCCTTGGGGAGGAACAAGTAAAGCCGGTGAATCCTGTTTTTTGTATGCCTG
AGGAAGTGTTAAGAAGAATAAACGTTCAGCCCGAACTAGTGAGTTAGACCTGTGAAATGC
AGAAAGCACTGGAACGGCAGTAGCGATATTGCAGTAGCGATATTCCCAACGCGTCTCACT
CACCGCATATGTACTTCATTTCGATGTGATTCCCATTAATAGAGCAACAAAATGATCACT
ATTTAGTGAATCTGTTAATATTTTGTACATGATTTGTCAAGTAGTTTTAAAAATTGTATA
GTCCTATTTATTTAAATTCTATCTATATATAATGTAAAAAGCTAATATATCTTAATGTGA
GCTTTTAGAAGGCTGTTTTTGTCATGCCATTATTTTGATAGTAACAGTAGCAATAGCAGA
TCAGTAGTTCGCATCTGACAAGATCGATCTTAAAAACACTCGACCCTTCTGGCTTGCGTT
AGAATGAGTCATTTTCCGAGGAAAATACTCCATCTCATCTAAGGAATGGGAAAACATTTC
TGTTATTTTGTGCACTTAAAATAGCATTTTAAAAGGTTTGGAATTATTTGGAAAATCAGT
ATTGTTGTGTTACAGTTTTTCTAAACGTTTCGTGCTGTTTTTTTCCTGCTCTTCAAACTT
CTGTTCGAATAAAAGTTTACCGATTTACAAATGGAAAGGAATTCTGAAGTATGTAATCGA
CATGCGTGAGGATCTCGTGATACATAGAGGATGGGAAATCTATGGGATGTGTTGATGAAA
GAGGCATGATCAGTTTAGTGCACGAATGGCTATCATGTTTGGCCGAGCTGCCTGAAGTTT
CATTCAAGAAACTGAATGCTGGGCTGGCTGGGTATAATCTCTGCTGGACTTGGGCGGGGC
GGAGCTATGGGACTATTTTAGGGGGCAGAAAAGCCTTGGTTCAGTAGTGAGGTAGAGCTA
GCCCATCAACAGTTGACAACCCAACTGTTGTCAGGAAGGAAGGGGAGAGGAAGAGAAAGA
GGGGAGGGAGAGGGAGGGGAGATGGGGCATAGAGAGGGAAAGAGGGGAGGGGGAGAGGAA
GAGGGAGAAAAGGAGGTGGGGAGAGTAACACAACTGACTAGCGGCAGACCCGGGATTAGA
ACCCATGACCTGACTCCAAGCCCGTGCTCTTTCCATTGAGCTGGGCTGAGATTTATGGTA
AAGCAGTGAGTGCTTACTGTAATTATAGAAATCAAGAAAAGAGCATCAGAATTTGATGCC
AGACCGAATACAGGGGCAGAAAGAGGGAGGAGTTTCAGGGTAATGCCATAGAGGACAATA
AAATAAAGTTGGTAGCCACTTTTCTGCCCACACANNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGACAATAAAATAA
AGTTGGTAGCCACTTTTCTGCCCACACAAGCT
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1211, 4707..4814, 6183..6380, 8564..8669, 9625..9677, 9758..9868, 10435..10560, 10892..11041, 12926..13671
1209..1211, 4707..4814, 6183..6380, 8564..8669, 9625..9677, 9758..9868, 10435..10560, 10892..11041, 12926..13066
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved