Ornithorhynchus_anatinus Locus ENSOANG00000006596
snOPY snoRNA Orthological Gene Database
Ornithorhynchus_anatinus ENSOANG00000006596
Ornithorhynchus_anatinus
ENSOANG00000006596
Ultra258
SNORA49
1983..2117
41926
GGATTGTACTTCCTTTCGCAAGTAAGGAATTTTATTTTTCTTCTAATTTAATCATTTGG
ATTCCGTTAGCATGATTTTCATTGCCAGGAAAAAGTGGGAAAAGGGGGAAAAATGAATTG
GCTTTGTGTTACTTAAAAATATTCTACTCAACTCTCATTTTCAATAAACCTGTATTAATA
TTCTTTCTCGAATCCTAGCAAAAATGACCTTGACTTTTTGATACATTACTTTTCTCAGGA
GTTAATTTTTAAAGTCGGCGTGGGGAAGTTAGTCTTATACACCAATTAATTTAGATTATA
AATGCTTCATGGGGAGGAGCCATTTTGGTGTATATTGATTTGCACAGCGTGCCACACAGC
CTCATATGCCCGTGAACTCTTCAGAAATTGTATTCGATTTGTCTAACATTTTATTTCTTG
CCTCTCAGTTAAAACCGAGTCACCAAAATACATCAGTAACAAGGTTCTCCGTTTCTTTTT
TTAATAAAGGAGGAAAAGGCCAGACTTCTGAAGGAGCGCCTGGACCGAATATATTTTGGC
AACGAACGCCGCTGTACCCGAGTTCCGGTCTATGGCCGAGATTTGTTAGGAATTTTTTCT
TTGTTTGGTGAAAAAAAGATGCCTCAGCCTGGATATTCCAGCAAAAATAAATGGAGGTGG
GCTGGATTGGTGAACTGTTGCCTCTCAGCATTAAGAAGCCCAAATGATCCCTTGCGGTGT
CTAATTTTGACATCAGAGCAACGAAAAGAATCCCTCCAGGATGCTATGAATAGGTATTTG
ACTTGTCCGAAGACACTGATCTATTCACACCTTAATAGTTTCCGTCCCTCTTCGAAATCT
GGGACCGACATGTCTACTAAAATGGGCATTTCTAAGGTATCATTAGCCAACCTAATGAGA
TAATATCTTCATTTTTCAGGGTGGGTTGCGTGCTTCCTGCAGTAGTAGCTGCACCGCCTC
ATATGAGTGTAGCCAAACCTCCGGCTTCGTACAGCCACAGAATGAAACTTTTCAGGCATC
GCCTGAAAGAACAAGCCACTCCGTATTTACAACAGTTACGGCAGATAACGGCTCTGCGTT
TGTTGCAGTTTCCTGACCTCAGACTGGTGCAATACGATTCAGGTATAAAAGGCGAAAGTT
GGATGGGGAGTAGGCCAAGTTCAGGGCGTCGGTGGTAGTAGATGGTTTGGATTTTACTGA
ACACATTTTACTCCCCTTAAAATAGGAAAGTTGGAAGCTCTGGCCGTGTTGCTTCAGAAG
CTGAAATCTGAGGGACGCCGGGTGCTGATTTTATCACAGATGATGCTAATGTTAGACATT
TTAGAGATGTTCTTAAACTTCCATTATCTCACCTATATCAGAGTGGATGAAAACGCTAAC
AGTGAACAGCGCTTGGTAAGCCACGTTTTTATCTCTATCATGGATATTAGCAAGAGGGCC
CAGCATGGTGGTCAACAACTGATTCCGAGGAGTCTAAGCTCCATAGTTGTAGTTACGAAG
TGTAATAAGTGCTTAAATGTCAAGCACTGCACTGAGCATTGGGTTTGTTCCAAAATATTT
AGATCAGACAGCCCCTGTCCCACATAGGACTCATAATCAGAGGAAAGGAGAGAAATGTCG
TATTCTCCCATTTTACAATTAAGGGCGATCTGATGCTGAGAAGTTTAAGTGACTTGCCCA
AGGATACCCAGCGGGGTTGTGGCAGAGCTGACATTGGAACCCGGGTTTTATGATACTTAG
TCACTCGCTCTTTCCATTAGGATTGTGCCTTTTAGTTCTATTGCATATTCCCAAGTGTCC
AGCACAAGTGTCCAGCGTGTAGAAGCTAACTAAACGATACTGAAATTCATACAATTCGTG
AGTTTACTGGGGTCTGTTCTGTAACCAATGTTAATGTATTTTGATTGGGATCATTTAGTT
GTCCTTCCTGAGGGTTTTTTAATTATTATTATTATTATTTTATTTAATTTTTGGTAGCTT
CCTCTTCCTCAGCCTTACTCCAGGGGCTTTCTTGCTCATAGAGTGCCCTGGCATTGCCTG
AGGATAAATCAAAAAGCCCATATCCCTCCCCAGTAGGAGCCTGATTTTCCTTTGGGGCCT
ACAGTTTGGGCTGACACAGATCACCCTTTTTACCATCCTGCCTAAAGACCTGGTTAAAAT
ATGAACAACACTAAAAGGCCTTTTTCATTTTTCGTATGAAAATCAGAAAAGATTTAGGGA
GAATTATTCAAAGGTTGTGAATATTTTTCATGCAAAGAGAATAAATCAGACCATGCCTAA
AAAAATCATGCAACTTTTGGACGAATGTAATACTTAGAGATGACAAATTGTTGTTAAGAT
ATGGGCGTTAGTGTCAAGTTTCTCAACTTTTAATTGTTTGGGATTATTGCAAGCATTTTA
TTTCCAATTTAGGAATTGATGAAGAGTTTCAATAGAGATAAAAGGATATTTTGTGCCATC
ATTTCTACGCACAGCCGTTCTACTGGTGTAAATCTTGTAGAAGCGGATACGGTTGTATTT
TATGACAATGATTTAAATCCAGTGATGGATGCAAAGGCTCAAGAGTGGTGTGAGAGAATT
GGGAGATGCAAGGACATTCACATCTACAGGTGACGATTGTAGCAAAAATTTTAAAGTTGC
TCCCAGGGAGAGACAGAGCTATAAGGTTCTTGAGGGCAAGGAGCGTGTATCATTTCTGTT
TTATGTTCCCAACTGCCTAGTATGTGGTCAGTAAATGATCAAAAGAAGATGATGATGAGA
GAAATATTCCTCATGCTTTAAAAAGCTACAGAGCTTAAGCGTGACTTTTTTTTTACCAGA
AAGATTATGGTTGAGGAAATTCAGCCTTTAGGAATAGTGCTGCTTTTATCTATCTTCTTT
GTAGCTCACATTTTATACTTATATTTTGCTAATTGATTTTTTTTGGTCTCCACTTTTCTT
TAGCTCTCTCAGAAGACTTCTTAATAAATTATACATTTTTACCAATGTGTGGGGTTGTGG
GATTTTAAATTGTTTTAAAGTCAGCTAGGCCTATCAACGTTTTTACAAAAAGGATAGACT
CCTTTTTGCCTTCAAAAACAAAGTATAAAATGGATTAAAGTCTTGAAATTATACTGATTA
AAGTTTTGGAGGCCTGGCTTTTTTAAACAAAGCAGCCCCAGAAAACCCTCTACAGAGATT
TATATTTTGACCCTGTCGGAACGATTGGTTCCATTTAAACTTGACTATTTTTACTCAGTA
ACAAGCGAGTGTGTATTGCTATAGTGGGCTTTATAGGAAGAAAAATAACATAGTTACTTT
CTTTTGTTGAAGAGCATTATTAACATAACTTCTGCACATCTTAGTTAAAGTTAAACTAAG
GGCCTTTTATTTTCAGATACTATTTCTCTTTGGTCACTGCTGTTAATGTTTCTTCCAATT
AGCATGTTTTTTTAGTGAAATGCAGGGTGATGGAATGGGCATGCTTTTGTTTTACAGGCT
AGTGAGTGGCAATTCTATAGAAGAGAAACTGTTGAAAAATGGAACGAAGGATCTGATAAG
AGAAGTAGCTGCTCAGGGAAATGATTATTCCATGGCATTTCTAACACAGGTATTTTTAAA
GTATGAATTATCCCTGAGTTGTATTTTATGGAATCCAGGGTTGTTTGGATATACAGGCGT
TAAGATATACTAATCAATTGATTTGCTATTCAGGATTCATTTTGGGCTGAATTTTAGGTC
GGGTATGAAGACGCTATGTCTGCCTATTTACCGTGTATCTGCCCCAATGCTTAGCACATA
GGATGCACTTAACAGACGCCATGATTATTATTATTTAATGTGGTAAGACAAAATATGCAA
TTTGATTTTTCAGCAAACAATTCAAGAGCTTTTTGAGGTTTATTCCCCTTTGGAGGATTC
TGGATTTCGTGTGAAAGCTGAGGAATTTGTGGTACTTTCTCAGGAGCCCTCCCCTGCAGA
AACCATTGCACCCAGGATCGCAAGACCTTTTATAGAGGTAGGAATGGGAATTAAGCTTAG
CCAAAGGGTTAATGGGAAAAATATTTTGGGGGTCTGGGTCGTCATTTCAGGGACTAGCAG
TGACTTTGCATTGCCTATTCTACAATGGAAAAATAAGGTTTTGGAGCAGATTTTTCTCAT
GGTATTTTTAATGTTACTGAAATTTTCTTTTATGAATTTCTCAAGGCTCTAAACAGCATT
GAATCTCTGGAGGATGATCCACAAAACTATTCAGAGGAGGCAATGACTGAGTCGCCTCCT
GATATCTTATCTTCCAACGTAGATGATTCAAAAGTTAAAGAAGAACCTTCACAGTTAGAT
GAATTTGCCGACTTTATGGAACAGGTAGAGTGGTTTCTTTAAGATGGCTGTGATGTTTTT
CCATTTTTAGAAGGGAGGATCTTTGGCGCTCCTTCCTTAGGGATCAACACCCCTCAGCTC
TGGGAACTGGATTCCCAGTCTTGCTCATTCCGCATTTGATGACACTTGAGAGTTTCGCAC
AAAAATATCCAACGTGCCAGCTTTCTGACTTGTTCTCTGAACCCTTTTGCTCCCCAGCTC
AAAATGAAAGGTTGGCCCCTATGGATAGGGTAGTGAAGATTTCAATAGTTTTATTATTTG
AAGTGCGTGCCCATGTACTTTATAGAAGGGGGTGATCTTCTCTTGGGGAAAGACTTAGAT
CAGTAATGGTCAGTATCCTACTACAGGAAAGCAGCAGAGCCGGGGAAAGAGCACAGACCT
GGGAGTCAGAGGGACCTGGTTTTAATCCTGGCTCTGCCACTTGTCTTCTGTGTGACCTTG
GGCAAGTCACTTAATTTCTCTGTGCCTCAGTTTCCTCATCTTTAAAATGAGAATTAAGAC
TGTGAGCCCTATGAGGGACAGGACTGTGTCCAACATGATTATCTTGTATCTACCCCAGTG
CTTAGTACTGTGCCCAACAGGTGTAATAAGCGCTTAACAAGTATTAGTATTATTATTATT
TTAATGTTATTATTATTCCTTGAAATGTTTGAAAATGGTTTTCTCCAACAGCTCACACCG
ATTGAGAAATATGCTCTGAATTACCTGGAATTATTTCATACTTCTCTTGATCAGGAAAAA
CAGAGAGATGCTGAGGTAAGAAAATAAAGTTTTGCTATAAATTTCTTAACCATTTAACAA
ATAAATGTCCAACACTTTTACCAGACCTCTAAATTTTCCCATCTGTTTTTATTCAAATTG
AATGACAGAAGAAGGCAGAAAATGCGGGAAGCCTTGCAAGCTTTGCTTAGTGATTTAATT
GCATATTTCAGTGTTGTTCAAAAGGATATGAAATGAGACATTTTTGCATAATTTCTAGAA
TAAAACTTTTCAAGGTGATCGCTCACGAGCCAAATAGTAAACATCAAGTGATGTGGCAAA
ATTTAAAAACAAACTGCTGAAACTCAGTTCACCAGCATCGAGGACATGCTCACTGCAATG
CAGCTTAACTCGATAGGACCCAAGGGGAATTGGTGATAGCAGGACCATGAGAGAGCTAAG
GAAGAGTGGGTGAAATGGGGTCTACGCAAGCAGAGATGGACAAAAAAACTGTTTTTGAAA
ATCGAGTGTCAAGCAGTGTGGCTTTAGATCATTGTGGAGAAGAATTTCAGGAGCAGACCA
CCAGCAGCAGGGGGTTGGTTTCCTTGACTAGGGACTCTAGGAAAGTTGGGACACAAGCCA
GAGTCACAAATGACAAAAGACTCTAATAGCAAATACCTCAGCACAGGACATAGACTAGAA
TGGGTTATCGACTGTGCAGAGATTTTTCACCCGCCCCCTTGGATAACATCTCACCTTGAG
TAACAACACTAATACCTACAGAGCAGTTTTGTTAAAGCAGATTCTTTGAAGGAGTGTGCA
CTCTATGTCACCCTCAGGTTCCTATTAGAAAACTTTTTTTGTCCTGTCCCTCCAGTTTTA
TCAGGGAATATAATTCATCGATATACTTTGTGTAATTTCTGTCAGATTTTTCAATTTGAG
GCCATGATTTTAAAGATTCTTTTTTCCCGGTTGAATTCTCTTTGTAGGAAGTAGCAAAGG
TGTCCAAGGAATGGGAATCAAAAAATGCCAAGATGCTCAAAGAAAGGGAAGTCAAAATGC
TTGTGGAAGAGGAGGAAGAATTGTTGACCTATACCAGAGAAGATGCATATAATATGGTAA
TTTATGGTGGTTTGGAGTAAAAGTCCTGTGAAAGCGCAAAGACTTTTGGTGATGATTATT
GGAATTGTTAATAATCTGCAGGCCAATAGTCCTTAAGGCACATTGGCGAAAAAGTAGCCA
TTCAGTGTCTGATAGAGAAACCATAATTTTAATCTGTTCTCTAGGGCACTTTTCATAAGT
TCTGAGAACTGCACAAGTTGACTGTGCCGTAAACTCGTGGAGGGTAGAAACACTATCTTC
TCTTTTTATTCTAGACTCCCAATTGTTCTTCATTCAGCAGGCACTCAGTAAATACTAGTG
ATGGTGATACTGATGTCTGAATTCTGGGAAAATGTGCATCCAGTTACTGAGGCTAATTCT
CCACTCAGCCTGAGGTAGCACATTTTCTTGACAGCCAGCATGGGGAGAGCTGGCGGGGGT
GTGGGAAGGAGGACCTGTAGGGTGAAGCGGTCGTGCAGCTAGGCGGACAATGAATGCTGT
AATCACGAGAGTTTCTCTGGTTGTCTCTGCCTGTTCAGNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNGACAAACTTTTCTCTCTCTCAGACCATGGTTACTT
TTTGGTGTTTTTTCTGGACTTGTTTCTTTGGCCCTGGAGGAGTGAGAGACCTGGTGGCCG
AAGAACGCATTAAGTCGTTAGCAAAAGCTGAGTGAGTTGTTCACTGAACTATTACTGTTT
TCCATTCAGCAGCTTTTCAGTGTATGGTTATACTCTCACATCTTCTACCTGTTGATCTCC
AGAACTTTATATAGGCCTGTTAGGGGTACAGCCAGGTTCTGCTGCTGAGAGAGCGCACTA
AAGTGTTCTGTTCCATGAGCACAGGCCACGTGGGGTTTTTTGAGGAAGACCCCCAGCGAC
TGGTACAGTGGATATGTCCCAACAGTGGGTTACAGAATGGATGAGGACCTTGGGTCTGTC
ACATTCACTGTTCTGTGGCCACCGATCACACCCACCCGTAAGCTAACCAGCCATCTTGCA
AGGTGTGCCGTGGCTTCAGAGGACTGGGGAGAAGAGTGCGGATGGTTCAGTGCAAAACAT
CACTGCCAATGCTAAACAATTCCAGTTCAAATCCTGCTGAAGGTGGGATACCTCCATACC
TGTTTTCAAAGAAAAGTCCTACATAGTAGACGGTCTGGCGTCTTGGTCTCTGAAGAGGCA
GCCTTGCCCCTTGGCAGCATCCTGCATGGTTGAACAGCCCCGTTTAGCAGTGTACTGCCC
ACCCCCAATGGGGAAGGGACTAGCAGAGGTGTCCCTAAAACATCTCCTGCCTCATCCAAA
CCTGGCTCATCAGTAAGTAGAGATTGGTGAGCTGTATATCTCCGGTGGCCAAACAATCAG
GAAGAAGACAACTTGTGAAAATAACCATCAAATTACGGAATATCAGGATGCCGGATGGTG
AAATGATCATCGGCCTATAAGAAGAACAGCTTTAGTAATGCATGAATTGGCCAGGGGTGG
TATCGATATCGGAATACTAAGTAAAAGGAGATTTGTAAAAGGAGGACAGATCACAGAGGT
AGCCCTGGATGCATCACCTTTTGTAGGTACCCTCCCTCTTCAGGATGACACTTAGTGGGG
TTGGGTTTGCAGTCAGACAACAACTAATATTGGGCCTCTCAGATCTGCTCCAGATGTAGA
AACCTGATGTCAGTATGCCTGCCCCTGAAACAAACTACCATTATATGCACTTATGCCCCC
ACGGGGTCAAACTGCAATGAAGATAAAGTTCTCTGAAGATTTAGACAGACAGCGCAATGT
AGACCAACAGGAGTAATAATATCTTGTAAATGAATTGTAATGGGTGGTTTCATTGCTTGA
GTAGGAAGTAATGGCCACCCATACAGGGAGGTCATCAGGCTGCCTGGGCTTGGTAACTCA
GCAGAAGAGGTGTACTTTTATTGAGAGAGTAAATCAAATGCTGCTGCACAATCACAGCCA
TCGTCTTTACACCTGCAAACAAAAGAAAGACCTCCTGGATGCATCCATATTCTAAACAGT
GGCATCTTATTGATCTCAAAGGTATACAGATCCTAGCTAATACGTGTGAAGCAGAATGGC
ATAAGCTCATAGCTAATATTGTTCATAAACCACTGCTCAAAAACTGGCCTCCAAGTCACT
GAAACACCTGAACGTCAAGCTCCTGGAGAATGAAAACACCAGCAAGCAATTCTGCAGCAA
GATCGCCTCAGCCTTGCTTAAAAAACAAAACAAAAAAACAAACCACAATCGCCATCATAT
GCGGTGAATGGGCACGTAAATGTGATACATAGTTTTACTCTGTGCCTAACACTGTACTAA
ACTCTGGGGAAGATAGAAGATAATTAGGTCAGCACTGTTCCTGCTCCACATGGGGCTCAA
AGTCTAAAGGGGAGGGAGAACAGGTATTGAAGCCCCACTGTAATGATGTAAAAACTGAGG
CTCAGAGAAGTTAAGAGACTCACCCAAGTCACACAGCAGGCAAGTGGCAGAACCAGGAAT
AGAACCCAGGTCTCTTGGCTCCCAGGCCTGTGCCCTTTCCATTTGGCCATGCTGCTTTTG
CCCTTTTGGCTTCATGTGCTCATGTACTTGTGCGATGGGGCACTGTTGACAGAAATGCAG
GCACCAGGCTGTTATCATTAATCTGAAATTTATCCTCACCTGCTATAACTGCTCTCTTCC
TGCTTCTCCCTCGATTCCTTTGTCCACCTGCCCACAGCAAGTATTCAAGACTTTTNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCTGCTGGTGGATTCGAGCG
CTTACTAAGTGAAGAAAAACGGACCAAACGCTTGGGACGGACGGTCGGGCAACGGATGGA
GACGATCCTGGCATAGATAAGCCTCAGAGCATATTTTGCTTAAAAAATGAATTTTTCCCT
GGGCTTACTGTTTTCTGAAAGACTGATAGTCTCCTGTTTTGTAAGATGTATACATTTGGG
AAAATGGGATTTGGTGAGTTTAAGGTATTGTAATTTAGAGTACAGGGATAATTGTAATTG
CAGTTGGCAGTTTTGTAAAGCACAATTTACATGCCCTTCAAAATATGAAGGTCTTTATTT
ACTACATCATGATTTGGTTTTTAAATAGTATGCTGTGTGTTCACTGGGAATTCCATCCCT
TCCATCTGTGCTTCCAACCCCATCACTTGCCTTATCCCTTTTTCCTTCCTTGCCCACCAC
TGTCAACCACTCTCTCTTCAATGGCTCCTTTCTCTCTGCTTTCAAACACGTTCACGAATC
CCCATCCTAATGAAAACCCCCAAACCCTCCCTTATCGCCACTGCACGCTCCAGTTATCGC
TCTATCTCCCTCCTACCATTCCTTTCCAAATTTCTCACATGAATAGCTCACACCTGCCGT
CTCCACTTCCTCTCCCCCAGCAATCTGACTTCTGCCCCCTCCATTCCAGTTTCACTCATG
ACCTCCTCCTTGCCTCCAAATCCAATGGCTTTTTCTCCATCCTAATCCTCCTAGATTGCT
CGGCTGCCTTCCACACTGGACCCCCTCGTCCTCTTTGACTAACCTGGATTTCACTGACAT
ATTTTTTTAAATTTTCCTCTCCCTCTCTGCGTGCTCCTTTTCACTCTCTTTCTCTGACTT
GTCTGATTCCCATCCCCTAACTGTGGGGATGTCCCTGAGGCTCCCCCTTTTATTCTCCAT
TTTCACCCATTCCCTTGGAGAACTCATTTGCTCCAACAGCTTCAACTACCATCCCTATGT
GGATGACTCCCAGATCTTCCTCTCCACCCCCAACTTCTCCCCTGTGCAGTCTCACATTTC
TGCTTCCCTTCTGGACATCTCAACTTGGATGTACTACTGACAGCTCAACATGTTCAAAAC
AGAACCCTTTTTTCCTCACTCTAACCCCTCCTCCAACTTTCCCATCACTGTTGACAACAC
CACTGTCCTTTCTGTCTGGCAAGCCTGCAATGTGGGCATTGTCCTCAACTCATCTATCTC
ATTCAGCCCACGTAGTCAGTCACCAAATCCTATCGGGGCACCAAATCAGCCCATTCTGCT
ATATCCAAACTGCCGCCCAGCTGATCCAAACACTTGACAAATCCTGCTTCAACTACTGCA
TCAGTTTCTCCTTTCAAATCTGTACTTCATTCTGCTGCCCAGACCGTTTTTCTAAAACAT
TATTCTGCACACGTCTCCTTATTCCTCAGAAACCTCCGTTGATTGCCCGTTCATCTCCAC
ATCAAACGTAAACTCCTCTTCATTGGCTCTGAGGCACTCTTTGACATAGCCCAAACACTT
TGCTCCGCTGACACCAGCCTACTCACCTTGTCTCATCTTTCTACCTATTGACCTCTTGGC
TTATACCCTCCCTCCTGTCTGAAACTCCCTTCACAGTCAGTCACATTTATTGAGCGCTTA
CAGAGTGCAGAGCACTGTACTAAGCACTTGGGAGAGTACAATACAGCAATATAAGACACA
TTCCTGTCCCACAACGAACATACAGTCTAGAGGGTCTCTGGTAGCTGACAGACCACCACT
CTCTCCATCTTCACAGCCCTACTGAAATCATATCTCCTCCAGGAAGCCTTTCCTGATGGA
CATTGTATCACCTCACCCTGTTTTCCCTTCCTTCTGCCTCATTCATGCCCATAAGTCCAT
TCCCCCTAAGCACTTTAATACCCTCCCCTCTCTCACCACCTGAACAATTATGTATGTATT
CTGTAGACTGTAAGCTCGATGTGGCCAGGGAACGTATCTACCAACTCTGTTGTATCGTAC
TTTCCCAATCGCTTAGAACAGTGCTGTACAGAGAGTAAGCTCTCAGTATGATTGATTGAT
GTTCTTATACGCTGTTGATTTCCCCCCCATCAGTAACGTATTTTAATTCCTATCTCCCCC
ACTAGATTGTAAGCTCCTTGAGGGCAAGGATCGTGTCTAGCAACTGGATTATACTCTGTC
AAGCATTTAGTACAGTGTTCTGCCCTCAGTAAGTGCACGGTAAATAAAATCCATTGTGTT
TTTTCTATTTTAATTTCAAACTTTGAAAATTTCCTGTCTTCTTTTAGGAATATGTCTACG
AAGATCCAGATGGACAGACAGAAATAATGCCAGTAAGTCCATTAATTTAATGACTGTAAT
TTGAAGTTTCTTATCCATTTCCAAACCTAATAGAAATTCTGTTTTTTGTATAGCTTTGGA
CTCCACCAACTCCACCTCAGGACGATAATGATATCTACATCGATTCTGTTATGTGTTTGA
TGTATGAAAATATCCCTGTTCCAGAATCTAAACTGCCTCCTGTGTATGTGAGGAAGGAGC
GAAAGCGACACAAAACAGATCCCTCTGGTAAATACTGTTGCCAGCAAGTTTTGAGACATT
GGGGGTTTTTTTTGGTTTTGTTTTGTTAGCTTTGATGGTTCGGGTTATGATGAATCCTCT
TTTTATTGTTCCCGAATTGTACTTTCCAAGTGCTTAGTATAGTGCTCTGCACACAATAAG
TGCTCAGTAAATACGATTGAATGAATGAATGAATGAGATAATCCCGTAGGTGTTTTACAA
TTTAGGAAAACCAGCAAAATTATGCTGCCTTTATCATATCCATCACATGACTTTGTGACT
TGATTTCAAAATTGAACTTGTTAATGGTTCATGTTATGGTTGTATGTAATGGTGGAGAAG
ATTTATTTGTCCTGAGGACCATTTAAAAAGCCTCTACCAATTGTAGATGCTCTGAAATCT
GAAGCCCTCAGTACCTCACTTGGACAGAAAATTTTCCATACTCATGCTTCCCTTTTTAGC
CCAACAATGTTCCCTTACTGTGCCTTTTTGATTTTCCTTTAAGTTTCTCCTGTCTTGACA
AGATACCCTCTTTTTACTGTCACACTGAAGACAGCCCCCCTGTTCTAGCTTCAGGTAGGA
AGAAGAAGCAGCGGCACGGGGAGGTGGTCATCCCTCCTCGATCGTTGTTTGACCGGGCGA
CTCCGGGGATGCTGAAGATGCGCCGCGAGGGCAAAGAGCAGAAGAAGAACATCCTGCTGA
AACAGCAAACCCAATTCGCCAAGCCTTTGCCAACGTTTGTCAAGCCGACCACAGAGACCG
GTCAGGACAACCCGGAGTGGCTCATTAGTGAAGACTGGGCATTGCTACAGGTAAAAGGAG
ATTTTTTTCCCCCATTAAGACTTCTTGTGGAAATGGTCAGCTATCCATGCGACCATGTCT
CCTTTTGGATCTGTCTCCCCTGATTAGACTGTGAGACTGTCATTGGGCAGGGATTGTCTC
TCTCTGTTGCTGAATTGTACATTCCAAGTGCTTAGTACAGTGCTCTGCACATAGTAAGCG
CTCAACATGAATGAATGGATCAGAAGTCCTGTGACGTGTAAGCTCATCATGGGCAGGGAA
CATGCCGGTCAACTCTGTTACACTGTACTCTCCTAAGTGCAGTGGTCTGCACACGGTAAG
CACTCAATGAATATGACCGATTGATCGGATACGCTTGTCTCTTCCCTAGGCCGTGAAGCA
GTTGCTTGAGCTTCCTTTAAATCTCGCCGTCATGTCACCGGCGCACACCCCCAACTGGGA
TCTCGTTAGCGACGTCGTTAATTCTTGCAGCCGCGTTTACCGCTCTTCCAAGCAGTGCCG
AAACCGATACGAAAACGTCATCATTCCAAGGGAAGAAGGAAAGGTGAGTTTCAGCTTCAT
TCTGCCTTCCCATGGAAGACTGGAATCACCGGTACATTAGTCTTCATTATTTAGATGACC
GCTCCACTGCAACAGTTCTCCATCGCACCAACGCATTCCGTCCAGCAACCGAGTTTTATG
CCAGCATTGTCACCGGGCACACATTATGCAAGCTCGTCACTCTTCAAATCGTTGTGCCGT
TATCCTCATTTCACTTTAAAGCTAAAGTGCTGGCCTAAGAATAGATGGCGTAGGGCATTT
CTGCTTGGCACTGAAATTAGTCAAAGAACAGCTCGTTTCTTGCTGTTCTACTGCTCGATC
CTTGAGCTCCTGCTGGGCGACAGAGGTTCAAAAGGCAATGTGGCAAAATGGTTTTTATTT
TAGAATTTACTATAAACACTGAAATGATTGGCGTTTAAATGAAGCACAGCAAATGAATAG
GTTTCATTCAAAAGCAAACCGCAGAATAGTAGCAGTTGCACAAAGCCCGAAAAAGGGACA
GACTTTATGTCTATAAACTTTGAAGATGAGGAAAAAATTGCAACATCCCATATTTAGATT
ACTTTCCCTTAAGTTTTTCTTCTTGGAACACGTATCTTTGTCTCTCTTATGTTGGTCTGG
CTTTCTTCTTGCAAGTGCCTCTCTCTTGCTGCATGACTATTTGACTCTCCTTGGAAAACC
TGAAACTACCAATCCTCCAAAGCTTCTATTTGGGTTTATCCAAGTCACCACGGGGCATTT
TGGTAAGGGCATTCCTCTTTTGAGGTTCAGCTTCTACCTGGAACAAATTCTCTATTGTTC
CGGAATGTATTTACAAAGGCAAAGTGCCTCAGCAATTACAAATAGATGGCAGATTTACAT
CCATTCTAATGGCCCCCTTGAATTCCTGTCTGAGTGTGAACACCATGATGATTACATCTT
TCCATCAGTAACAATCGGTGTAAAAGGCAGGCATCTTCAGGCTCCATAATTTCAGATCCC
AAATTAGTCATTTGGAAAATTAGGATTTGGTGTTTTCTTGGGAAAATTACAAAATTTCTT
TCTCCAGTAGCTGCGGCAAAATAGCATTCACTCTAAGTCATTAATTTCCATTTTTCTCAC
AATGAAAAACTGGTGAGTTTGAAGCATTTGTTTGCTTACCACAAACTGACCTGTCATCAT
AATACCATTTTGTGGTATCTTCACCAACAAGACTTCCTGAAATGCTTTATGTCTGTATGT
TTTTGGAAGCATTAATGGTAATTAGCCATAAACTTAATATGGAAAAAAAAATAAAGCTAA
AATCTTTTCTTCTTTTATAGCTGCTTTATGAAGCTAATCCAAAGAAAAAGGCAAAAAATA
TTTATAAGGTATGAAGGTGATGTTCTGAATAAAATTGGAAAACCTTGTTTTAGAGCTGAT
GCAGAGAAGCACACAGGGAAAGACTCAATATAGCATGATTTGGTAGCCCACCGGAGCTCG
AAAATTCAGAATTTGCTACAGTGTCTTTCGTGCCTATGTTTAAAGGATTTGCTTCTTGGC
AATAGAGAACCAAATCATGACCCGTTCATTGGCAGCAATAGGGAATTTCCTGCAGCTCCA
AACCCCGTTTCACCGTGAGACTTAGATTCCCCGTCGTCCTGGTGTGGGGAAATGTAGCCT
GCTGGCACCAGGGTATCAGAATGAAATTCACACTCAACTTTAAACCAAAAAGAGATGTTT
CAATAGGAATTCCTGTACCTCTCAGCCTTCCCTCACTTTTTTTCTCAGTAAACTGAATGA
TCTGGTGTTTTATAGAGTCACAGTCTCTTTCTTGCTCTCCCTCTTTTCCTCTGCTGAATT
CAATACAGGAATGCTACGAATACAAGACTGTAGAACAGTAATTGGTGCTTGTTATACTCT
GACTCTTCGCTTTGCATGTTTATTTTCTAGTCCTAACTCTTCTCAGATGTTGCTTGCTTT
TTGTGAAATTTCAGTCAGTAATTAAGGAGTAGATTCCCATATATTATGGTAATGAACAAA
TGAACAGCTAGAGGAGGTTCTTAGGGGTGAGCACTTGATATGAAATTAGAGTCCGTCTGG
CCAGAATTCGTGGGGAGGAAAGTCTGCCTCACCCAGAAAACTGAAATCTTTCCTCAGTAT
ATATTTTGGTTTACTACTGAAATTATGTTGTTATTCTTCTAAGTGGTCAAAAGAAATTAA
TTTCCACTGCTGGATTCCATGATGTATATGTATTAACAATTCAATCAGTGGTGTTTATTG
AGCGCTTACTCTGTGCAGAGCAAATTTTTTCTGAGTTTGTGCCTTTCCTACTGAAATGGT
AGGAATAAAGGAAGCTTGATGTGTTAAATGATAGGGAGTTGAAGTAAAATGTTCATCAGA
TCCAGATCAACACACCTGTTCTTGGTATCTGAGGTAACTGAAGATCCAGGTTGATGTTTT
TATTTTTATTCTGTCGTGCATTTTTTTTTCCAGAGTAAAAATAATCGCCCTCTGCGTACC
AGCCAGATCTATGCCCAAGATGAGAATGCAACACACACTCAGCTGTACACAAATCACTTT
GACTTAATGAAAATGACTGCCGGAAAGCGAAGTCCCCCAATCAAGCCCTTGTATGTTTAA
TGTTCATGTTCATTTTCTGTCAAGTGGATTTCTTGGTAGAATAATTTGTGGTTTTAGTGG
GAAAGGGGATTAATGGGGTTCCTCTCCATAGGTCAGACTTTGTTTTATAGAATTATTCTG
TGTGTTTCACCTCGGTTTCATAACAGCTTTTAATTTCGACCCCTCTTAGACTTGGCATGA
ACCCTTTCCAGAAGAACCCAAAACATGCTTCGGTGCTAGCAGAAAGGTGGGTTGCCGGAA
ATTATCATTCTGTTGTTCATCAGTGTGTCGGGGAGGCTCTCTGGGCTCGTGGTGGCTTAT
GGTGACTTTGGTTAGCAACTGCCATCAATTTTAGTAGTATGCTGTTCAAAGTTCTAGTCC
CAAATAACCCGTTTGAAATTATGGCACGGAATAAGGTTAGCCATTCCCTTATGTTTAGAG
ATTGGGTAGCTCATTCCCGCTAAACTGGAAGGTTGGGAAATTATGCCTTGTTTTAAGATA
CCTGGAATAAGGACTTAACTCAGTGTGGTGTTTCACTTCTTACTTTTATTTTCAGTGGAA
TCAACTATGACAAGCCCCTGCCTCCGATTCAGGTTGCATCCCTGCGTGCAGAACGAATTG
CAAAAGAGAAAAAGGTACAGTGATGACCCCGTATTTCAACTACGTTCATTCTGATCTCAT
AGAAAGCATCTCCAGGCGACAGCTTTCTGTTTAATAATGGTAGAGGCTTGAAAGCTAGCT
TCTTGGTGACAGTTATATTTCCACTGGATTGTCACTAGAATGGGACATGATAGTGGAGGC
AGGGGGGGACTCAACACATGCTCGATGCCTGCACACACCACACCTGATTTTCCCAGCAAG
GAGTCCAGTGGTTGGTACAGTGGATGTGAGCGTTGCACTCAGCCCTGATGTTTAAGCTGG
ATGAGGGTAGTGTGAAAAGTAGCATGTGCTAGTGGGAAGAGCACAGGCCAGGGAGTCAGA
GGCCCTGGGTTCTTATCCCAGCTCCTCCATCGTCTGGCCTTCAGCAAGTCTCAACTTCTC
GGTGCCTCACTTCCCTCACTTTCACACAGTAAGCACTCGATAAATATGATAGAGTGAATG
AATCTGCAAAATGGGGATTCAATACCTCTTCCCCTTCCTCCTTAGACAGAGCCCCATGTG
GGGTCTGATAATCTTGAATCTACCTCAGTGCTTCGTACGGTGCTCGGTAAGCGCTTGACA
AATACTACAGTTATTATGAGGGCACAGGCAGGTCTGCTGCCAGAGGAGCGCACTGACCTC
ACTGTTTCAGGGCCACTGACTCTGTTCCTCCCCTCACCAGCCACCTGGCAGTGAATCCTG
ATGGCTACAGGGGGACACATCCCCACTAAGGAAAAATGACTCATGCTCATGTCTAACTGT
TGTTACCTCTTACCTTGCGGTCCAAGTCCCGACCTCTTATTACAAAGGAAAAGCATCCCT
AATGTAGTTTCCATCACAACAGTGGCTTCTCATCAATTACCTCGCAGCACGGCGGAAGAC
TCAGCTGCCGTGTGCGGAGGAGGGTTGCTGGTTGGACTGGTATCTGATATGCTCCAATCA
CACCCTTCAAAGGCCTGTTGAAGGCACATCTCCTCCAACAGGCCTTCCCTGACAAGCCCT
CTTTCCTCTTCTCCCACTCCCTTCTGCGTCACCCTGATTTAATCCCTTTATTCATCTCCC
CATCCCCGCCCCACAGCACTTTTGTACATAACCGTAATTGACTTATTTATATTGGTGTCC
GTCTCCCCCTCTGGACTCTAAGCTCGTTGTGGGCAGGGCATGTGTTTGTTTGTTGTTATA
TTTTTACTCTCCCAAGCATTTAGTACAGTGCTCTGCACACAGAAAGCGCTCAGCAAATAC
GACGGACTGACACACCGATGTCATATCCATTGTGTTGAAAAACGGTCTTCAAACCGACCA
CTTAGCTATAAGTGTATTTCTCTACAGCCTTGGAAACAATAATAAGCCTGAATGGCCATC
CCCAACGTAGACAATGAACAGGCAGTTCTCCACAATCCTGTAGAGCAGGCAGCCGCCATC
AGGACATTGGGTGGGCCCCAGCAAAGTCACCGACATTTGTTTGATGTGGTAACTCAGAGA
TGAATCTTCTTGCAGCAAAGCAATTACTGCACCAATGACAAAAATAAAGTGTACAGAAAT
ACATCATGGACATGGAGGTGAAGTGAAAGGACATGCATGACAGGTGACGGGAGGTCAAAG
CAGAGGCGATCCAGAGATATTTAGACTGTTGCAGCGTAGCGTAGTGGATAGAGCAAGGCC
TGGGAGTCAGGAGGACCTGGGTTTGAATCCTGACCCTCAATAATTATTATTATTAGTGTT
ATGGTACTTGTTAAGTGCTTACTATGTGCCAAGAACTGTTCTAAGCTCTGGGGTAGATAC
AGGGTACTTAAGTGCTGTGTGACCTTCGACAAGTCACTTCACTTCTCTGTGCTTCAGTTA
CCTTGTCTGTAAAATGGGGATTGAGACTGTGAACCCCACGTGGGACAGGGACTGTGTCCA
CCCGATTTGCTCTTATCCGCCCCAGGATTTAGAGCAGTGCCTGATACATAGTAAGCGCTT
AACAAATAGCATAATATTACTGTTATTATGATTATTGTCACAAAGTCCAGAACTGTAAAG
GCATTATGTGGCACGTTTGAAGAGTGAACATAGCTAACAGAGCAGGAGAGAATCTTGAAT
GGAAGGGATATTCTCCTCAGCACACCTCCTACTATTGAAAATCATCCTCAACACACCTCC
TACTGTTGAAAGTCAGGCCCTTCCAATGTGCAAATAGTAATGTTAATAATGTTGGTATTA
AGCGCTTACTATGTGCAAAGCACTGTTCTAAGTGCTGGGGGGGATACAAGGTTGTCCCAC
GTGGGCCTCACAGTCTTAATCCCCATTTTACAGATGAGGGAACTGAGGCACAGAGAAGGG
AAGTGACTTGCCCAAAGTCACAGCTGACAAGCGGCGGAGGCGGGATTAGAACCCATGACC
TCTGACTCCCAAGCCTGGGCTTTTTCCACTGAGCCACGCCTATCGCAACTGCTGAAGAAG
TTCAGTGCCAGGAAAAATAATAAAGCACTTGGATCCAGTGGCACCTGAGATAAAATTTAC
AAGCACGGAGAGGAAATTTTCCTTAAACACTTAAGGGAGCTCTTTCTCAGCATATGGAAC
ACTGAGACAATCTCACAGGATGGCGAAGATGCCACCAGGCGTCACCACTGTTAAGGAAAA
CGGAAGATCAGATTGAGACACATCATTTCTTCCCATTGCCAGTGAGATTGGTGTGGGCAG
GGAAAGTACTCTCCCAAGCGCTTATGTGTGCTTTGCACACAGTAAGCACTCAAGAAATAC
AATCGACCGAATGAAGATCCTAGTCGGGATACTTCTGGATTGGCTATTGAAATGAATTGT
CAACTGAAAGATACCAGAGTGACAGTGCGGCTTGAGGTCACAGAGTGGCACAGTGATCCC
GGTCTGTTCAGCGGGTCAGATAGAGATAAGCAGGGAGTAGCACTGAGATCTGAATATGAA
AGCACTTGACCCCCATTAGGAGATCTGGTCTCTGGAAACTGCTCAGTAAGTTTGGCTGGC
TGAGACAGAGCCAGGTTGCCCTTTCTGATTCATTCCCCAACTCTACAGGGGGGGAAAGGA
GAGAGATGTATAGTTGGGCTCAGCTCTGTCACATTTCTTCTATGCCACCCTGCTGGAAGA
GGCACCAAGAGCCTTGGGTGCAGATGATACCATATGGTTTTGCTTCTCTGGGAAACTCTA
TTTTAACTCATCGGACTTGGAACCACATGCAAAATTCTAGAAACAGTTAGTCAAGAATTT
CTAGTTGCCGATCCGTGGCCCACGTCCTACCTCTGACCTGGAATGCCCTCCCTCCTCACC
TCCACCAAACTAACTCTCTTCCCCTCTTCAAAGCCCTACTGAGAGCTCACTTTCTCTGGG
AGGCCTTCCCACACTGAGCCCTCCCTTTCCCGAATCCACCACANNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNAGCACTGTTCTAAGCGCTGGGGAGGATACAAGGTGATCA
GGTTGTCCCACATGGGGCTCACAGTCTTAATCCCCATTTTACAAATGAGGTAACTAAGGC
ACAGAGAAGTTAAGTGACTTGCCCAAAGTTACACAGCTGACAGGTAGCAGAGCTGGGATT
TGAACCCGTGAACTCTGACTCCCCAGCCCATGCTGTTTCCACTGAGCCACGCTGCTACTC
TATAATAATTACAGCATTTGTTAAGTGCTTACTCTGTGCAAAACACTGTTCTAAGCGCTG
GGGAGGATACAAGGTGATCAGGTTGTCCCACGTGGGGCTCACAGTCTTAATCCCCATTTT
TACAGATGAGGTAACTGAGGCATAGAGAAGTGACTTGCCCAGAGTCACACAGCTGACAAG
CGGCTGAACTGGGATTTGAACCCATGACCTCCGACTCCCAAGCCCGTATCTATTTTGATG
GTAGTGATGCCTGACTGCTTGTTTTGTTTTGTTGTCTGTCTCCCCCTTTTAGACTGTGAG
CCCGTTGTTGGGCAGGAATCGTCTCTGTTGCCGAATTGTACTTTCCAAGCGCTTAGTACA
GTGCTCTGCACACATTAAGTGCTCAATAAATATGATTGAATGAATGAATGAATGAACACA
TCCAAGATGAAGTTGAAGCATGTATGTAAACTGCTCTATGAGCTTGCAGTGAGTGCCGGG
GGGGGATTGCTGGGTGTGACTGAAAGGTCTAATGAGGCATAATAAGGTTGGGTGGAAAAC
AGATGGCAACCAGAGCTTTTGGTTTTGGTGGCTCGCTTTTTCTAAGTCTGTAGAATTCCT
AGCAGTTTAATAATAGATCGAAGGTTTACAGGTATTTTCCTGTGGTTTTCTTTTCCTTGT
AAAATTTCACAAGACGTTTTTATTTTAGAAAACTCCAGAAAAATTGCGAAGATTTTCTTT
TTTTCTCCTGTCTTTCAAAGTTCAATTTATTGGTCTACTTCTCTGCATGTCCTTAAATTC
CGAGAACAGCGTCTGCCTTGGATTGGTTCTTGGAAACCCAAAAAATCAGGTTAATTTAAA
ACCCAGCCGAGGCTACCTCAGGTAGGCATTTCGTGAACGCTCTGATGATTTTAATTCTTC
GACTTGTAGACGGTTTCCCCCGACTCTTTTTTACATATATTTCAGGGCAGTCTTCAGAAG
GGAACCACAGGATGTCCACGGCGGTGTCAGAACTCGACAGGATTAGATTAATGTGCTCCA
ACACAAGGATTTCTCCCTGCGCAGTCTTTGGACCTCCTCCTCACAGTTGTTTGTTTTCTG
CTGTGTCTCCAGGCTTTGGCTGAACAGCAGAGAGCACAGCAGCAGACGGGCCCACAGCCT
CCCCAGCAACAGACAGGGCAGCAACCAGCAGGGCAGCCAGCCGCCCAACCTCAACCCCCA
GCCCAACCTCAAGTGGTGCAGCCGCAGCAGCAGCAGCAGCAGCCGAAGGTGCAGACTGCG
ATAAGCCCTGTGGCCAGCACTGCAGTACTGGTGAGATGAGGACTCTGTGTCTGTTGGTTG
GTCGGTTTCTTCGTATTCATTCATTCGCTCGACCGTATTGATTGAGCGCTTACCGCGTGC
AGAGCCCTTGGAAAGTACAGTTCGTCAACATAGAGACGATCCCTACTCAACGACGGGCCC
ACAGTCTAGAAGGGGGAGACAGACGACAAAACAAAACAAAGTAATAATAATAATGTTGNN
NNNNNNNNCAGTCTTTGGACCTCCTCCTCACAGTTGTTTGTTTTCTGCTGTGTCTCCAGG
CTTTGGCTGAACAGCAGAGAGCACAGCAGCAGACGGGCCCACAGCCTCCCCAGCAACAGA
CAGGGCAGCAACCAGCAGGGCAGCCAGCCGCCCAACCTCAACCCCCAGCCCAACCTCAAG
TGGTGCAGCCGCAGCAGCAGCAGCAGCAGCAGCAGCCGAAGGTGCAGACTGCGATAAGCC
CTGTGGCCAGCACTGCAGTACTGGTGAGATGAGGACTCTGTGTCTGTTGGTTGGTCGGTT
TCTTCGTATTCATTCATTCGCTCGACCGTATTGATTGAGCGCTTACCGCGTGCAGAGCCC
TTGGAAAGTACAGTTCGTCAACATAGAGACGATCCCTACTCAACGACGGGCCCACAGTCT
AGAAGGGGGAGACAGACGACAAAACAAAACAAGTAATAATAATAATGTTGGTATTTGTTA
AGCGCTTACTGTGTGCAGAGCACTGTTCTAAACCCTGGGGTAGATACAGGGTAATGAGGT
TGTCCCAAGTGAGGCTCACAGTCTTAATCCCCATTTTACAGATGAGGTGACTGAGGCACA
GAGAAGTTAAATGACTTGCCCACAGTCACACAGCTGACATGTGGCAGAGCTGGGATAGAC
AGGTACCAGTAGCATCAAAATAGATAAAGAGAATTACAGATATAGACACATCATTAATAA
AATAGAATGATAAATAGGTACAGATGTACACAGTGCTGTGGGGCGGGAAATGGGGTAGAG
CAGAGGGAGGGAGTCGGGGCGATGGGGAGGGGAGGGGAGGAGGAGCAGAGAAAAAGAGGG
GCTCAGTCTGGGAAGGCCTCCTGGGAGAGGTGAGCCAGTGACCCAGGATGCATATTCTGT
AAAAGGAACCAACCAAGAACTGTCCTTTTTCTTTTTTTCTCTTTCCTCAATTTTTGTATT
TGTGGCCCTCAGAGTTGGAAAAACCTGGCTTCTAATCCCGGCTCCCCCACTTGTCTGCTG
TGTGACCTTGGGCAAGTCACTGAGCTTTTCTCTGCCTCAGTTCCCTCATCTGTAAATTGG
GGATTAAGACAGTGGGCCTTCTGTGGGACAGGGACGGTATCCATCCTGATTATCTTGTAT
CTAATCCAGCGCTTAGAACAGTGCCTGGAATATAGTAAACACTTAACAAATACCACAGTT
GTTATTATAAGAAGAGACAATATGGTGTAAACAACTTTCTTTTGACCCACCTGTGTCGTT
TAGGAATTCATATATCATTAAATAACTGGGGAATTAACTTTTTTTTCAGGCAGTTTGATA
TGGTTGCAGAGGGGATTGTTCTTAAGTAGCCTGGGAAATAGAAAAATTGTTGAACTGCTT
GCTCTGCTTGAGGCTTTTAGATTTCATATGGTCCAAATGATTTATAATGCATATGCTGTG
ATATAAAGAATCAAAATGGATATTGAGTGCACGGTCTTCATAACAAGACAGGAGATATCC
TGTTAAGGGGTAACTTAGATTTGGTAAAGGCAGAGATGCAGTGGGAAAACCAGTTCATCA
TTGCGGTCTTGATTTAAGCATTCACTCTATGCCAACTTCTAGGTTTTCAGCTTTTTGGTC
TTTTTTGGCAGCCTCTAACTCAAACTTTCAACGCTGTTGTCCATAGCACAGCTTATGTAC
AATGAATAATGTACAATGAGTACAATGAGCAGGGAAGCAGCGTGGCTCAGTGGAAAGAGC
CTGGGCTTGGGAGTCAGAGGTCATGGGTTCGAATCCCGACTCTGCCACTTGTCAGCTGGG
TGACTGTGGGCAAGCCACTTAACTTCTCTGTGCCTCAGTTAACTCATCTGTAAAATTGGA
TGAAGACTGTGAGCCTCACGTGGGACAATCTGATTACCCTGTGTCTACCCCAGCGCTTAG
AACAGTGCTCTGCACATAGCGCTTAACAAATACCAACATTATTATTATTATTAATACAAG
GTTCAGAAGTTACATCAAACCAAATTCTGCTCCATTTTTTGAGGGGGTGTCAGGTTGAAC
TCTTTTCAGTTAAAGTAGAAATGTAAAGCTTTTACATAGGTTTAGTGATGTAGAATATAA
TTATTTTGTCATAGATAGGAATTTCGTTAAGTATCGCATGAATTTATTATTCTGAACTAA
TTAAAAAGATTCCGAAAACTTGAGTTTTATGAACTGTAAATAAGTAATAGTCTACTCACC
CAAGTCTTTTTTCCCCAAACAGGCTGGTACAATTAAGCCATCAGTTACTGGAACAAGCAT
ACCAACTGGTAAGAAGGCTAAGGAAAGCTATTTGAGGAAATAAGAAATGCCACTTAATTA
TTTTTAATTCTCTTGCCTTAAATATTGTCTTTGCAGGTACAGTTAGTGGCAACGTTATAG
TGAATACAATAGCTGGCGTCCCCGCTGCTACCTTTCAGTCTATTAACAAACGTCTCGCTT
CACCTGTAGTGCCTGGAACCTTGACAGTGAGTTATCTGTATTTCTCATTAAAATATTTCC
ATTTCATGGGTGGAAAGAACAGGAGCCTGGGAGTCAGAGGACCTGAGTTCTCATCCTGCC
TGCTGTGTGACCTTGAGCAAGTCCCTTCACTTCTCTGTGCCTCAGCTACCTCATCTGTAA
AATGGGGATCAAGACTGTGAGACACAGACGGTTGTGGGAATCACAGGATGAGGGTTCTAG
TCCCGGCTCTACCACTTGTCTGCTGTGTGTCCTTGGGCAAGCAGCTTCACTTCTCTGTGC
CTCAGTTACCTTAGCTGTAAAATGGGGATTAAGACTGTGAGCCTCACGTGGGGCAACATG
ATTACCTTGTAACTACCCTAGCGCTTAGAACGGTGTGTAGCACCTGATAAGCACTTAAAT
ACCATAATCATAAACATAACAAATACCATAAAAAAACCCCAATAATCAGTCTACCCTGCC
TGCATGTCATATGTATGGCCTTCCCCTCTGCTCCCAACCCTAAACATGTCGTTCCCACCG
TGTTACCTTGCTGAGGGCGAATCAGCAGTACCATTGGACGGCACCCCAAGTTGGCTGTAT
GTTTCTCCTTGATCGAGCAGTCAACTCAATTGATAAAGGACCAGAAAAGGTGCACTACTC
TCTTTCAAAGGGCAGGGATAGAACCGTGTCAGTGAGAGAAGACATACTGTTGCATTCTCA
CAGTCGGTAATGTCTTCTTTGAAAACAGAAGACAACGGCGTGTGTATAGAGAGAACCCTG
GCCTAGTGGAAAGGGGACGGCCTGGGAGTCAGAGGCCCTGGATTCTAATCCCGGCTCTGC
CAATTTCTCTGTCAATTTCTAGCTGTAGGGTCTTGGGCAAATCTCCTAACTTCTTAGGGC
CTCAATTTCCTCAGCTGTAAAATGGGGATTCAGTACCTGTTCTCCCTCCCTGTACAGACG
ATGAGCCCCATGCTGGATAGGGACCGTATTCGACCTGATTGACTTCTGTCTACCCCAGCG
TTTAGAACAGTGTTTGACACATAGAGAAGCAGCGTGGCTCAGTGGAAAGAGCCTCCACTT
GGGAGTTAGAGGTCATGGGTTCGAATCCTGGCTCTGCCATTTGTCAGCTGTGTGACTGTG
GGCAAGTCACTGCACTTCTCTGTGCCTCAGTTACCTCATCTGTAAAATGGGGATGAAGAC
TGTGAGCCCCACGTGGGACAAACTGATTACCCTGTATCTACCCTAGTGCTTAGAACAGTG
CTCTGCACATAGTAAGCGCATAACAAATACCAACATAGTGCGTAACAAGTACCGTGAAGA
AAGAAAAAACATGTGAAACAAGGGATTGAAGTACTTGGTTCATCTCCATTAAACGCAGAT
TTAGAATATGTGTCCTGGAATAATTTTCAAGCTATATTTTTTTCTCTTTAAAATAGTATT
GTGCTTTTTTAAAAATTCCTCTGAGACACACTGCTGATTATGTTTCCGTGCTTTCTTGTA
GACTTCAGGAGGGGCTGCCCCGGCCCAGGTGGTCCACCCCCAGCAGCGAACGGTTACCAC
TCCCGCCGCCTCCACCGAACTGGTGCCGATAGCATCCACCCAGGGGGTCCGAGCCGTCAC
CTCGGCCCCCGCCCCAGCGGTCGTGACCACCAACCTCACCCCTGTCCAGACCCAGACGAG
GTCTCTTGTGACTCAGGTGACTCAAGGTAAAGCTCGATCTCCCTCTCGCTTTATGCTTAG
GAACATCAGTCCGGCTACTTTTAAAGTTCTGTTTGGCGTGGGAAGGAAGTGTGGGAGAAC
CGGATGTGAGAAAGGGCAATCCAGTCATCTAATCCCAAAGAATGAATTTCTTTTCAGCGA
CGGGAGTTCAGCTTCCTGGCAAGACCATCAGCCCTGCCCACTTCCAGCTTCTCAGGCAGC
AACAGCAACAGCAGCAGCAGCAGCAACAGGCCACTCAGGTGCAAGTCCCACAGCTCCAGG
GCCAGGCCCAGTCTCCCGCCCAGATCAAAGCCGTGGGGAAGTTAACGCAGGTAAGAAGCG
CTTTTTCAAGTATTTTAGGAGGGAGTATCAGGTGGTTTAAAAGTGCAGGATTAAGGGGTG
GACACCGGTCTGCTCTGCTGTCATCAACATTTAGCAAGATAATTAGTGGGTTTCCAAATG
TCGCATTGTCAGAGAATCATTCGCCTTAGTGGGTAACCATGCCTGTTAGCTCCTTTAACT
GGCTGATCACAGCCCATCAATGGGTGGGGATTGTCTCTATCTGTTGCCGAATTGTACATT
CCAAGCGCTTAGTACAGTGCTCTGCACATAGCGCTCAATAAATACTATTGAATGAATGAA
TGATCTCCACCAAATCCCGCTCTCTCTTGAGATGCTTTGATCATCCAGTTGATCAGTGGT
ATTTGAGTGCATAGACTTATGGTATTTAAGTGCTTATTACATGCCAAGCGCTATTCTAAA
CTCTGGGGTAGGTACAAGGTGATGAGGTTGTCCCATGTGGGGCTCACAGTCTTCATCCCC
ATTTGACAGATGAGGGAACTGAGGCCTAGAGAAGTGAAGTGACTTGCCTAAGGTCACATG
GCAGACAAGGGGCGGACCCGGGATTAGGACCCAGGACCTCTGACCCCCAAGCCCGTGCTC
GTGCCACTGGGCTAGGCCGCTTACTATGCAGAGCACTGTATTAAGCCCTTGGGAGAGTAC
AGTACAACAGAATTAGTAGACACATCCCCTGCCCCTAATGAGTTTACAGCCTAGACAGAC
ATTAATATGAATAAGTAATTTATAAAATACAATTTAAAGATATGTACATAAGTGTTGTGG
GAATGGAGATGAGGCAGATATAAAATTCATTCATTTGGGTTCATTGAGCACTTACTGTGT
GCAAAGGACCATACTAAGCATTTGGGAGAGTACAATATAATAAACAATAAACATCCAAAG
TTCAGAGATCCAAGTGCATTGTGATCGGGTCGGTCATATGATTATGCCTTATATTGCTCT
TTTCTCGATGTGAGAAGGAATGGAGAGAGGGGCATACTAAGAATATATTTTAGATTGCAG
TTTTTGAAATGATTCATCCAGAGGAGATACATGGTAGTAGGGATGTTAGCAGTTTCCACT
CAAGCTGTTCTAATGCTCAAGCATAGAGGAATGAGGTGTGAGGGCTGGGTTGGAATTGGA
GAATGACGAGATGAGGTAGGAGGGAGCAAGGCGATTGACTGCTTTAAAGCCAATGGTGAG
CTGTTCGTGTTTGATGCGGAGGTGTTTAGCCAAAAGATATCTTGTGTGAAAACACTAGAA
ATCTGTCATTATCTTATGGTAATACAGACCTAATAGCTACTGAAGTGGGCTTGAATCTCT
CTCATTTCAAGTCAGGCAAAGTGTTTCAGAGGTTGAGAGGGAGAGGCAGGGAACTGTTTG
AGCCAAGGTGTGCCAGTCCAGAACCTTATCTCCAAGTAGGAGACCTGTAAGAAATACCAG
TATTATAAAGGGGGATCCCTGCATTGGTGAGAGCTTGAGACATATGCTCTTAGAGGAGCT
CAAATAGTTTTGCTCTCCAGTTTACCTCTAGACTGTAAGCTCGTTGTGGACAGGGAACAC
GTCTACCAATGATATTGTATTGTATTCTCCCATTCACTTATTGCACACAGCAATCACTCG
GTAAATCCCACTGATGATGATGTACCATTCATTAATGTGGATTCCTTCTTTACAAGTGAT
TTAAGACTAAGCAAATAGATGCTTAAGTTTTTGGAAAGGTCATGTAAAGTTGTGTTAGAT
GGGCCACGGACACAGACAATATCCATTTATCAGTGGTATTGAGTACTTACCGCATGCAGA
GCACTGTAATAAATGGGTGGGGGAATACCATTCAACAGAGTTGGTAGACGCGTTCCCTGC
TTGCATTGAGAGGGGGAGGCAGACGTTAACATAAATAAATTCATTCATTCAGTCGTATTT
ATTGAACGCTTACTGGGTGCAAAGCAGTGTTCTGAGTGCTTGGGAGAGTACAATATAACA
GAGAGTAAATAAGTTAATGTGTATAAAGCTACTTGAGGGGCTGAGGGTGGGATGAATACA
AAGTGCCTAAAGGGTAAAGATTCAAGCGAGTGGACAGTGCTCTGCACACAGTAAGCAATC
ACTAAATACAAATGACTGATGAGGCAGAAGGGAGCGGGAATTGGGGAAACGAGGGCTTAA
TTAGGGAAGGCCTCTTGGAGGAGATGTGACCTTCGTAAGGCTTTGAAGGTAGGGAGATCT
AAGTCGTCTTTAAAGTCTCGAACTGGTGATTCCAAATATGCGTAAATAACACACTTAGTG
TAGATTGAAAGGAAAGATTAGGTCATCTCTTATGCCTTTAGGAGCAGCTGATCAAATTGC
AGAAGCAGAAACTGCAGCTCCCCCAGCAGCAAGCACCTCAACAGCAGACTCAGCCAGCCA
CCCAACAACAAGCAACACAAGTTCAAGTGCAACAACAGCAACAACAGCAGCAGCAGCAGC
CACAGCCGCAGCAGCAAACCCAACAACTCACTGCCGTCACGGCCCCCAGGCCTGGAGCTC
TCCTCACAGGCACCACCGTTACTAATCTCCAGGTTGCTCGTCTGGTAAGTTGGAGTCGGG
TCTTACTTGGGGCAGGGAGGGAGGGAAGACCGCACATTTCAAATTCATTTCCCAGTTTGG
TTCCGGCACGTTCTCGCTTAATGAAGACCGGAAAGGGGGGTTGGGTGGTCCGAGCTCGTA
TTAAAATAACCCCTGGTTTCTCTTGTGTAGACTCGTGTTCCTACTTCCCAGCTGCAAGCA
CAAGGGCAGATCCAGGCCCAAACGACTCAGACTGCTCAGGTTGCTCTGGCAAAGCCTCCG
GTTGTGTCCGTTCCAGCAGCCGTCGTGTCATCGGCTGGTGTCACTACACTCCCCATGAAT
GTCGCTGGCATCAGTGTTGCAATTGGGCAGCCCCAGAAAGCAGCAGGTATGGCTGGCAGG
AGTCATCCCACAAGAATCGTCAAGAAATCACTTTTCATTCAGTCAGCCGATCAGTGGTAT
TTATTTATTGTGTGTTTAGTGTGTGCAGAGCACCATACCAAGCACTTGGGAAAGTACGGT
ATAACCAAGTCTGTGGACACCTATTTGTTTATATTAATGTCGGTCCTCCCCCTTTACTGT
AAGCTCATTGTGGGTAAGGAATGTCTGTTCATTATATTGTACTCTCCCAAGCACTTAGTC
TAATACTTTGCACGCAGTAAACACTCAATAAATACGGTTGAGTGAACACATTCCCTACCC
ACAACGAGCTTACGTTCTAGAGGGGGCACTTAAGTTCTTAGGTCAAAGCCAGTCTGTTAA
TTCAGTGTTCAATTTGTTACTGAAAAATTTTCCCATGTTCCAGCATTCCTAATTGAAAAA
ACATTTTTCATCATTATTTCTGTGACTCAGATGGGTAGAATTGTTAATAATTCATATTTA
GGGGCACCTGAGTAGTTTTCTAATTCTTCTTTTCCATCTGACAATGAACTTGAGACTTTT
GTGTCATTGGAGTGAGAATTCTACTCAGTTTTTGAAATGCAATTCATCAGTATATACTCT
GATCCTTGCTGGTATCCCTTCTTCTAGGACTATATGTACTGAGCTGTAGGGGAAGCAGTA
TGGTGTAGTGGATAGAGCACGGGCCTGGGAGTCAGAAGGTCATGGTTTCTAATCCTTGCC
CCCCCACTTGTCTCCGCTCTGTGACGTAGGGCAAGTCACTTCACCTATCTGTGCCCCAGT
TACCTCATCTATAGGAATTGAGATTGTGAGCTAATTGGAATTAGCTTGTGTCCACCCCAG
CGCCTAATTCAGTGCCTGGCACATAGTAAGCGCTTAACAAATACCATAATAATAATAATA
ATAATGCTGTAGTACTAGTCCATAATGTCGTGTGGGTCATTTTTCCGGAATGACCTGCCT
CTATCACTCCACTCCCAAAAAACATCCAAATGGTTATTTGTTTCTCTGAGCCCCGAGCAA
AAACTCATGACCCCTGGCTTAAGCTAGTCCATCTGTTCTCTCCCTTTTACTTACCCATTC
TGTTCTGCCCCCAGCTCACACTCTCGGATCTTCCCAAGCTATTCTCTTCACTATTTGTCT
CTCTTGTTTCTCTTCCCTTCAGACCCCTTAGATGGTGAGTTTCGTGTGGATTAGGGATTG
GGTCTGACCTGATTATCTTTTAACTACTCCAGGCCTTAGTAAATTGCTTGGCATGTGGTG
CTTAACCATGCCACTATTATTATGATGATTATTTTCATATAATTCTTTTCTTTTCTGTGA
GTAAACTGTGTCTTTCTCATGAGCTCTTTGAGGGTAAGGATCACGTCCATTGCACTCTCT
TCCATGTGCTTAGTAAAGTGCTCCACACACAGAAGACGCTCAGTAAATACCACCAATTGA
GTTGGTTATTTGAGAGTGCTTCCTTTGGCATTATTTGAGAGAGATAGGATGCGGTAAAAA
TTTAAATCCTAAGACATGAATATAACGGTATGTAGTAAAATAGATTTTTTTGTAATAAGC
CCTTATTATGTACCCACCACATTCAAGATAACCAGGTCGGACACAGTTCCCCTCTCACAA
AGGGCCTAACATTATATTTAGGTGAGAAAATAGATATTTAATCCCCATTCTATAGGTGAA
GAAATTGAGGCACAGAAAAATTGGGTGACTTGCCCAAGTTCCCACAGCAGCAGGCAGGTG
ACAGAACCAGGTCCTGGTAGAATAAGAAAATGAAGTATAATTCTCAGGGTCACACAGCAG
CGGGTAGGTAGCCAAGCTGGGATTGAGAAGGCCTGGGAGTCTGAAGGACCTGGTTTCTAA
TCCCAGTCCTACCACTTGTCTGCTGAGTGACATTGGGCAAGGCACTTGGCTTCTCTGGGC
CTCAGGTCCCTCATCTGTAAAATGGGGATTAAAGCTGTGAGCCCCATGTGGGACATGGAT
TGTGTCCAATCCGATTAGCTTGTATTTACCCTAGCGCCTAGTCCAGTTCCTGACCATAGT
AAGTGCTTAACAAATACCATAAACACCCTCCCCGCCAAAAAACAATAACAACGAAAAAAC
TAGGTAGAATAAGAAAATGAAGCCTAATTCACCAGGAAGCCTAATTCACCATTCCCGGGC
GACCCCATTTGAATGTGAAATGGTGAATGTGAATGCGATATGGTTTGTGGTGATTTTTGC
AGGACAGACAGTGGTAGCCCAGCCCCTGCACGTCCAGCAGCTTTTGAAACTCAAACAACA
AGCCGTTCAGCAGAAAGCCATCCAGCCCCAAGTGGCTCAAGGTCAAGCTACAGTGCAACC
AAAGGTATTTGACACGTTACGTGTTCCTCATACACATCGTGACCCAGATTACTTCATCAG
ATTTGTGGTGCTCTTTTTTTTTTTGAGCCTCTGTATTGGATGCTTTGTTTCTGAAGGCAG
ATCTTTTTTGATTTGTTAAGTTTGTATTTTAAGTGACATCCTTCTTTTTATGTTTAGATA
AGCTTCGTGTCTGGGCTGTTAATGCTCATTGTTATCTTTCATTCCAGATCACTGCACAAC
AAGTCACTGCCCAAGGCCAACAACAGAAAGTAACATATGCTACCCAACCAGCTATAAAAA
CTCAGTTTCTTACCACACCCATCTCTCAGGCTCAGAAACTGGCGGGAACACAGCAAGTGC
AGACACAAATACAAGTAAGTGTTTGTTCGAAGCAAACCCACACTTTCATTTTGCCGCACG
TGTATGTGTACAGGCACTTTGGTTGTAGAGTTGTGTCCTCCACCTCGAGGACTGGAGTTT
TGTTGGGATTGCCTTGCAACTTTGACTTCTAAATGTATTATTAAAATTTTTCGCTCCCTG
GTCTCAGTTATCTGGCTTCCTTTTCCTATCTGCTCTTTAACTTATGTTCTATCTTGACTA
TTCTGTTTGTGACCCATTATGAGAAGCAGCATGATGTAGTGGATAGAGCAGGGGCCTGGG
AGTCAGAAGGTCACGGGTTCTAATCCCAGATCCACCACTTGGCTGTTGTGACCTTGGGCA
AGTCACTTTACTTCTCTGGGCCTCAGTTACCTCACCTGTAAAATGCGGATTGAGACTGTG
AGCCCCATGTGGGACTGTGTCCAATCTTGATTTGCTTGTTTCCACCCTAGAGCTTAGGAC
AGTGCCTGGCATATAGTAAGCACTTAACAAATACCATGATCTTTATTATTTTTTATCCTT
TTCCATCTCCTGAAATGCCCTCCTCACCTCAGCTTCTCCAAGCCATTTCTGACCCTTCCT
CCTTAGTTCTTCTCAAGAGCCGTCTTATCTGGTACACATCTTTCTAGTCCTAGCGTGCCT
TTGGTAGCCTCAATTCGTATATGTTTATATTACTTCCTCCTTTTCATCATTTCCAGCATC
AGCCTTTTTTTTTTCCCATCCCAAAAAACACCATGGTTTGACTACTGCATCTTTCTCCTT
GCTGAGTTCCCTGCATCCAGTCTCCCCTTTCCAGTCCATATTTTACTCTGCTACCTGGAT
GGCTTTTAAAATATCTTTCTACACTACTCTCTAAAACTTCTGGTGGTTGCCCATTCCTTT
CAACTGCCTCTTCCACTCCTTCTTATTTATTCACTCTCATCTCCCATTCTATCATTCAGT
CATATTGAGCGTTTACTGTGTGCAGAGTACTGTACTAAAGCGCTTGGGAGAGTACAGTAT
AACAGATCTGGTAAATACGTTCCCTGCCCACAATAAGCTTACAGTTTAGCAGGGGTGGGG
GTGATTAGAAATTAACTTAAATAAATTACAGATATGTACATAAGTGCTATCGGGCTGAAG
GAGGGGTGAATAAAAGGAGCAAATTCAAGTGTAAGGTGATGCAGAAGGGAGTGGGAGAAG
AGGAAATGAGGGCTCTGTCAGGTAAGGCCTCGTGAAGGAGGAGTTGTGCTATTAATCAGG
CTTTGCAGGTCGGGAGAGTGATCGTCTGTCGGATATAAAGGGGGAGGCGGGACGTGGGTG
AGGGTTCAGGGGTGAGATAGACAAGATGGAGGTGCAGAGAGTAGGTTGATGTCAGAGGAA
CAAAGTGTGCGGGCTGGGTTGTGGTAAGAAATCAGAAAGGTTAGGTGAACACTCTTCAGT
CCTCTTGAGACAACCTACTCATTTGGCCTTGTTCTTGTTTCTCCCACTGCTAGCTTGTAG
CTGCTTCCACCTTCAAATTAACAGACCACAGCTCTTCCCATTTTCCAAGACTTTCTGAAA
TCATGTGTCCTCTGGGCCATCCCCAATTAATTTTTAATTGTCCCTCATGTATATTCTTGG
TACTGCATCTTCAGCCCTTCTATACCACAGAAACACTAAAGTAACACAGCTTCCAATAGC
ACTTTTGTACATATCTTAGATGCACGGATTCCTATACCCATCCCCTTTTCAGCTTCCTTC
CTCTTTGTTATTAATTTTAGAGTCATTTCTCCCCATCTGAGGGAGTAGGGATTATGTCTA
CTAACGTGATTGTATTCTTCCAAGCACCTTTCTTTCTGGTTTAGAGTGTTTAGCTTCAAG
GGCAGGAACCATATCTCACACTTTTGAATGTCTTTCAAGTGCTTCAAAAAATGTTTCACG
CAGTGAACAAAAATTGTTATAAGGATGAGGTTATGTTTTTTTCACAAAGAACAAAGAAGA
TGATCTAAAGAAACAAATTAGATTCTGTGAAAATCATAATTATGTATTTGGACTTTTTTG
TTTTACCTAAGGTTGCAAAGCTTCCCCAAGTAGTCCAACAGCAAACAACTGTAGCCAGTA
TTCAGCAAGTGGCCTCTGCTTCTCAACAGGTAGAATCTGAAGAAAATGAATAATCTAGAA
AATGTATCTTTTGCTGGGTATAGGTACTGATCAATTGTCATTCAGTTAATGATATACAGA
AAATTTCCAGAAGTAATTTGTCACACTGTGCAGTAATTCTGTGCTGTGTAAGTCCCTCGT
TAAAAAAAAATTTGTCTTTGTGCCCAATTCATTGTGTGGTTTTCACTCTAAAATGCTTCT
TACACGAACTGACATTTGGAAGCTAATATTTTCATAGCTGAGTGCCAGAGAAGGGCAATA
AAATTGCAAATCTATTTCGGTCTTAAAATTTGACTCTTGCTTCTCCCCTATTTTGAAAGG
CAAAATTCAGTTTTGCTGGCTACTCTGGAACAAAAGTGTTCGAAACTCGTGTAAATCACT
ACTGAATCCTTTATCTGTGATAACCTCTTTTCAGTGCAGTCTCACTGCATTTTTATGTGG
AATTAACATAAACAGTGTAGAAACAAGCATATTCTTTGTCAAGAATTAACTGTCAGAATT
GAGGCTCTTCATTGCTGGTTTAGTGCCACAAAACGTTACCATTGCAGAGTTTGGGAAGGC
TTTCTGGCCTGGTAGAAACAGCCATTTTTCAGTGTATGTATGCACACATGTGACATATAT
TAGCATTTAATATTTTAAATTTAGCATTTAATGTTTTTCAGGTTTTGATAGTAAAATCCA
TGCCTATTTAGTTGTTTTCCCCAAGCCCCCCAGTCCCAAATCTCTCTGCTTCAATTTTGG
GTTGTGGGATTGCTTATTCTCACATGTTGTCCGATTTTTTGGATTTAGGCTTCACCACAG
ACTGTGACACTCTCCCAGGCAACAGCTGCTGGTCAGCAAGTGCAGATGATCCCCGCAGTG
ACTGCTACAGCTCAGGTGGTTCAACAGAAACTCATCCAACAGCAAGTTGTAACCACAGCA
GCACCACAACTGCAGATTCCAGGTGTTCCGAATCCAGCACAGGTGTCAGCAAACTCTGAT
GCTCAAAATCAGGCTAAACTGCAAATGAGGATGCCAGCTGTCCGATTAAAGGCGCCCACG
AAACCCAGTTGAGCCACTGATTAAATTCAAAAGGCAGAGGGACAAGCTTCTCATTTTGTC
AAGCTCTGCCAGCGAAATCGGCATATCCTTTACATTTCGTGGTCGAAAGACAGAAAACTA
CCTTCACTGAAGAAACGGTATTTATTCCTGCTACCCGGAACAGTAGCTTACAAACCACTC
AGCATTTGGAAAGTTATAACTGAAATAAAGCAGTGTAACAGTTTATTAAAGTAAAATGCA
TCTTACTCTGAAAGAAGTGATCCTTATTGTGCTAAATGTCTCTCTTTTTAAGTTGAATGA
CTAGTTGAAACAATGACAGTGGTAATCAGAACTCTTCATAAATCATTTCAGTGTTGTCTC
CAGAGCAATAGGACTTGCTTAGATAGCCATGTAGTAGAATTTCACTTGATTTGAATAGAA
TTTCACATATTTCATTTGCAAATTGAAATGTGCAGTCAGTCCCAAAATAGGAATGTCTTT
TTAAAGTTTGAAAAAACCTTGATGAAGTCTGACAGTTTAGTTCTTTCTACTTAGAAAGAC
CACCGTCCTTATCTGAAAAGGGAATATGTCACGTGAACCAACTGTAATCGAATTTTCATT
CCAAAGAATACCAACGTGAATTCGTTTTTCTCTTGATACGTGATTTGTTTTTAAAGAAAA
AAGAATTGTTTTCAAAGAAATGTTTATCAGTGATATACATCTAAGCACACAATGGATGTG
TTCCCTTGTTTTTGAATAATGTCTTCTGGCAGATTAAATGCAGGGTGTTCAATATGGGAG
TCACCTGATCTTCGTTACCCTTTTAACCATCAGACTGATTTAAGATAGGAACATTATGCA
AGTGGGAGTTTGGTTGCACTTTCCTTCTTCCTGGGTATAATTTACAGGTAAAGTAGCATC
TTTAATAAATAGAGAGAGAGAGAGAGATGAGAGAATGAAAGAGCATACTTGGCTTGCACA
GATCCTATATCTGTGGTCCGTGTTTTGAGGAATTGAAAGATGTGTTGCATAAAATAGTCA
ATCTGGGGATGAATGTGAACCACAGAGATGTTCCAAATAAACTGTTAATTGAAAATAGGT
AACAAAACTGTAACACATTTGGTTTTAAAAATCTACATATGTGCTGGAATTTTAAAGTAA
ATGAACTTTGCGGCAGCTTTATCCTCTCATTTGGGGTCTCGAGTTTCACAAATGACAAAA
TCAGATTTGCTGGCTCGATGCTATTTGTGGAACTATTAGAAGTTTAGAAAAATCCATTGA
TACTCATGGTAGTTGTGTTTTGTTTTTTAAATAAAGGCAGGTGATACGTGTAACTGCAGA
TAAATACTTTGGTTGAAAATGGCTTCTCACCTGCAAGTCATTTGCATTATGTTTAATCAC
TGAGAAGAAAAGTAAAATGTAAAACGATTCCTTTGTTGGTTAGATTTTGTCACCTGTGGC
CCCCCCCCCCCCCCCCCAGACAATTGGGTGAACTAGGTTTTATCTTCCATTATGGGTTTC
AATCAATCAGTGATTTTGAGTGCTTAGTGTTCTGCAGGACACGGTACTAAGCACTTGGGA
AAGTACAGTACAATAGTTGTTGACCTGATCCCTTCCCACGAGCAGCTTACCCCATACAGG
GTGAGACAGACTTTAAAAGCAATTAAAAATCTGTCCTCCTTTAAAATCATATAGCTGAAT
TTTTTTATTGAAATATCAGTTTTCCTCCCTCTTGTGTAACTTTATCTTTTTAAATTTATA
TCATTTTAGGAAACTTTTTAAGAAAACCATTATATTCAATTATTTGTTAAATCTATGCAA
CTTGCAGAACTGGATGAAGAAAAAGTGAAACTGGCCTACTAACCTACTCTTTCTACTCTT
GTTGGGAGAAAAATGGAAAAAAAAAAGTTACATAGCATATATAAATAACTAAAAGGTCTT
GACTTGTTAATTTGAGAGAGAAAAAAGTGCTTTTATGGACCACTTTTTTGAGACCTCAAA
ATTTAAACTTACCGAGTCCTGATTTTGATGCGCCTTGTATATGAGGCATTATGCAAAGTA
AATTTTTTTACTTTGGCGCTCAGTCACCCTAGTCTGGTGGTTTTATGAACTGGACTTTCA
TAATAGAACATTATTGCAAAGGGAACTATTCAATCGTAATTTCTTTGGATTTGTTATCTT
TGATCTCTCTCGACCTTAATTGAGGGACAAATTACATTTTTTACAAGAAATACAGATTGA
GAGCATTTATTTTAGAAAATCCTGAAATGTGCCAGACTGATGGATGCATAGGGGTTAATT
TTCTAATCCGTAGATCCGGAATAGAATTTTGAGCCAATTTAAAATTATAGGTTACCGAGA
CAAGAGTTATTTTTTTATCAGCACAGATCGGGCCAGGAAACCTCTTTCTGTTGTGGGTGA
GAAAGTGATCTGTTATTCATTTCTATCATAAACTTCTTCTCAGATCTGTTTATGTGGTAG
AACCTTTTGTACACAAAGAATTATAATTGGAAAAGATCTCTCTACTCCATTGCACGTGGA
CCATGCAAGAGGAAGAAATATAAATAGGACTTCATGGACGTGAGAAGCTAACGCAGTTGT
TTGGGCAACTAGCATTTCCAATCTCCTGTTAGAGGTCTCCAGCCTCCCATATTTATTAAG
ACAAACAATAAAGTTTGGTAATAACATTCTGCATTCCTTTTCAGAGATATACTAATGCAT
ATATAGAAGGTAAATTCAGGGCTTATAAAAGTAAACAGCAGGCAAAACCATTGTGAGATT
TTATTTTTATTCATTACGATGGTCTGAGTTGCCCAACTGGATCCCAACAGATCTTCGTTT
TACTTATGTCCAGAATGTTTGAAAGCATTCATTGGTGAAGCACAGTGGCTGCATCCAAGC
ACGGTTTGGATTTTGAGCCTAGGGGCAACGGTTTCCTTTTCACAATTAAAACTGCTGGCT
TTTTTTGGTTGTTAACTCTTTTAACTGATTAGCTGTTGTGTTTTAAAATATACAGGAACA
AGATTAAATTGTAAATACTTTGTAAACATAAACATTTGTACTTGAAATGTAGGATTTTAA
AGAGCATTGGCATCCTACCAAGCTAAAGATATAATAAAGTGTCCTTTTTTATATTTCCGT
GTCCCGTCTTTCTTGGGTAGCAAAGGGCAACATTTTCGTCATCGCAGAACGCTCAGTGCT
TATTCAGTGGGATCTGCAAAACAGTATAACATTCCAAAACCTCTTGAATGTAAGGAATTT
TTGATTAATCATTCAGTAATGTTTTTGAGTGCCTATTGAGTGTGCAGATCATGATACCAA
GTTCCTACATACCATTTTCCTAAATAATAATAATGTTGGTATTTGTTAAGCGCTTACTAT
GTGCAGAGCACTGTTCTAAGCGCTGGGGTAGATACAGGGTAATCAGATTGTCCCACGTGA
GGCTCACGATCTTCATCCCCATTTTACAGATGAGGTAACTGAAGCACAGAGAAGTTAAGT
GGCTTGCCCACAGTCACACAGCTGACGTGGCAGAGCTTGGATTCGAACCCATGACCTATG
ACTCCCAAGCCCGTGCTCTTTCCACTGAACCATGCTGCTTCCCATAAAAGCTGTGGCTGC
ATCATGAATGACCGAATCGTGGAGTATGCTTTCCCATCGATAAAGCAATTGGATTCCGTT
TCAGAACTAGTCCTGGAATGATGGCCAAAGCTGCCTTTTTTCCCCCACCAATATTCACTA
GTATTTATCGAGCGCTTACTATGTGCAGAGCACTGTACTAAGTACAATTTGGCAACAGAT
AGAGACCATCCCACCCAATGACGGGCTCACAGTCTAAACGGGGGAGACAGAAAGCAAAGC
AAAACAGAATGAAACAAAACAAGACCTCATCAAGATAAAATGAATTAAGGAGATGTACAC
CTCATTAACAAAATAAATAGGGTAATAAATAATATATACAAATGACCACAGTGCTGAAGG
GGAGGGGGGGAGCAGAGGGTAAGGGGGGCTCAGTCTGGGAAGGCCTCCTGGAGGAGGTGA
CCTCTCAGTAGGGCTTTGAAGAGGGGAAGAGAGTTTGGCTAACATTGATCACCCCTATCC
TTACAGAGCACAGAGTACAGAATACAGAGCACTGTACTAAGTTTTTG
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1121, 1225..1394, 2412..2608, 3477..3588, 3853..3996, 4185..4338, 5026..5114, 6047..6175, 13967..14011, 14093..14246, 14808..15049, 15409..15582, 18033..18169, 18349..18405, 18715..18793, 24539..24742, 26722..26767, 26856..26965, 28441..28645, 28797..28969, 31301..31543, 31710..31905, 34142..34263, 34487..34633, 36671..36748, 37548..40926
1001..1121, 1225..1394, 2412..2608, 3477..3588, 3853..3996, 4185..4338, 5026..5114, 6047..6175, 13967..14011, 14093..14246, 14808..15049, 15409..15582, 18033..18169, 18349..18405, 18715..18793, 24539..24742, 26722..26767, 26856..26965, 28441..28645, 28797..28969, 31301..31543, 31710..31905, 34142..34263, 34487..34633, 36671..36748, 37548..37811
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved