Ornithorhynchus_anatinus Locus ENSOANG00000003020
snOPY snoRNA Orthological Gene Database
Ornithorhynchus_anatinus ENSOANG00000003020
Ornithorhynchus_anatinus
ENSOANG00000003020
5
SNORA7
4562..4715
24439
ATGGCCTGAGCGGGTTCTATTCCCTCACACCAAACAAAAAGGCAACAACAGCAACCGCC
AACAGGATGAATGTAGCTCTTTGTGCTGCTGGTTCCTGGAATGGCTGTTTTGCTACTTGG
AGCCAGATTTGATCTCGGGTTGCCGGGGAGGGGAGTTAATGGGGAGTTGGGGGTTGGGAC
TCTTTTCTTAGCCTGTTGTGTTAACTCCTTGGGACTGGCAGGAACCAAGAAGTGGGGAAT
GTCCTCCTCCCTGGGCCTCCATCTTTCTCAAATGTCAGAGGAAGGAATAATAATATTAAT
GATGGCATTTGTTAGGCGCTTACTATGTGGCAAGGACTGTTCGGAAGCGCTGGGGTAGAA
CCAACGTAAACACGTTNNNNNNNNNNGCTTACTATGTGCCAAGGACTGTTCTAAGCGCTG
GGGTAGATACAAGGTAATCAGGTTGTCCCATGTGGGGCTCACAGTCTTAATCCCCATTTT
ACAGATGAGGTAACTGAGGCACAGAGAAATTAAGTGACTTGCACTTAGCTGATAAGTGCA
CACAGCTGATAAGTGGCAGAGCTGGGATTAGAACCCAGGGCTTCTGACTCCCAAGCCCAT
GTTCTTTCCACTAAGCCATGCTGCTTTTAACAAATACCATTAAAATGGAAGGCTGTGTCA
GGCAGAGGAAGAGCTCCTGCCTGCCCATTCATTCATTCAATAGTATTTATTGAGCGCTTA
CTATGTGCAGAGCACTGTACTAAGCACTTGGAATGTACAAATCGGTAACAGATAGAGACA
GTCCCTGCCCTTTGACGGGCTTACAGTCTAATCGGGGGAGACAGACAAGAACAATAGCAA
TAAATAGAATCAAGGCGATGAACATCTCATTAAAACAATAGCAATAAATACAGTCCAGGT
GATGTACATCTCATTAACAAAATAAATACGGAATTTATGTCCATGGCTTCCTCTCACCAC
TATTTCTTGACCCAGTGCTTCCCCTCCATTTCCTCTGTTGCAGTGCGGCTCCAGCTGAGG
CCCGGACCTTTGGCCTGAAGTACACAGCCGGGGTGCGGGTGGACGTGGTGAAAAATGGGC
AGGCGGAAGAGACAACTAGAAATGGCAAACGGCGCTGGGCCATCTCCTCGGACACCACCC
TGAGCCTCAGCATGAACCAAGCCAGCGCCGAGGCCAGTGACCATAAGGTACGGCAGCCAA
GAAGGGCCACTTCCTTCTCCTCCTAGGCCCCCCGTTCATGCCATGCAAACCTAGTAGCCA
GTCCCGACTCACCATAAGCAATCCAAAAGACCGGCCCCCTGCCCCAGTTGTGCTTCAGGA
TACCCAGTGGACTGGAGACGATACCTGGCACTGCCCAAGGAAGGAACCGCTGCTACTGAG
TTCTACCTCAGCCCTGCCCTTAGTCCCACCCCCAGTGGCCTAATCCAAGTAGCTTCCTGG
GATTGGAGAAAGGTTCCCTCTAAAATTCTCCCCTCTCTCTCTCTCCCAAAGTGGGAATCA
TCCAGTGGCCTCCTGAGCAGAGTTTCTTCAACCTGACATTTTCTGAATCCAGTCTTATCT
GCTGTTCTAATATAGAGTGATGCTGAGACACCGATGAGGCCCCTCCTTCTCTAAGGAGGC
TTTACAAGAAATATGTCATGCCATTCATTCATTCAATCCTATTTATTGAGCACTTACTGT
GTGCAGAGCACTGTACTAAGCACTTGGGAGAGTACAATACAACAATAAATAATAAACAGA
CACATTCCCTGCCCACAATCTTCAACCTCCCTGATTCTAGTTGGCATCCTCTCACCTGAG
AATCAGCTCTGCAATAAGGAGAAACTCTCCTCCTCCCTCTGGAGCTCTGCTCAAGAGGAG
CCCGAGATGGAGGCTGAGGAAGCCGTGGAGCCCATGAGAGGCTGACTGGGTGACCAGAAC
CCCTGAGTTTGGCTCCTGGCACTCTTTCTTTCCCACAGCTGAGTGGACGGTGGTCGGGGG
AGAGAAGTTCCTTTCCCTCCCTTGGTCTCAGTTTCCCTCTCATACAGAGGAAGAAAGGGA
TCTACCTATAGAAACGTTGTTGCGAGAACTTATCAAGTCTTCCTTGACAGGCAAGCAGGG
TGGCCTAGTGGATAGAGCACAGGCCTGGGAGTCAGACGGACCTAGGTTCTAATCCCAGCT
CCGCCACTTGTCTGTTGTGTGACCACGGGCAAGTCACTTAACTTCTGTGCCTCAGTTCCC
TCATCTGTAAAACGGAGATTTAAGACTGTGAGCCCCGTGTGGGTCAGGGACTGCAGGACA
GGGACTGTGCCCAACCTGATTAGCTTGTAACAATGCTTAACATACAGTAAGCGCTTAACA
ACTGCCCTCATCATCATTATTATTATTATTATTATTTAGAAGCCAGGTGCTGAGGCTAGC
TGATGCTCTTTCTCCCACTTGAGCCTTGATCTGAGCTTAGTGTCTTGGAACATTGAGCCG
TCAGGCCTGTAGATTCCTCACCTGGCCCCCGATATTTAGTTTTCCAATGTGAAATCCCAC
TTTCCCAATCTCCAGTCCCTAAGGAAAGGTCTGAATCTTCAATAGAATCTGACAAGGAGA
GCCTCCGGCCTAAATTGGGGTGACCCAGGCTGGGACCGTCCAGCAGGACCATTGCTCAAG
TGTCTGGTTTTCTGCCTAATAAGCAGTGTGACCTATTGGAAAGAGTGTGAGCCTGAGAGT
CAGAGGATCTGGGTTCTAATCCCCGTTCTTAACATTTAATTCATTAATTCAATTGAATTT
ATTGAATGCTTACTGTGTGCAGAGCACTCTACTAAACACTTGGAATGTACAATTTGGCAA
CAGATAGAGAGAATCCCTGCCCAACAACAGGCTCACATTTGGCTTCTGTGTGAGCTTGGG
CAAGTCACTTAACTTTCCCGTGCCTCAGATACCTCATCTGTAAAATGGCGCTTAAATTTT
CCACCTTCCAACTTAGACTGTGAGCCCCATATGGGACTGGGACTGTGTCCAACCTGATAA
ACTTGTATCTGCCCCATTGCTTAGACAGTGTTTGACATATATTAAGTGATTAACAAATAC
CATAAAAAAAACACCCTGCTTACCTAGGCACAGGCCTACTTCAGGCACTACTGGTTCTTC
AGAGTTCTCTTTGGGAATTGTTATGGGCAGAAGTAGGTGAGCCCTGCTCAGGGGCACCAG
ATGACCAGGACAGCTGGCAGTTCTGGGAGGGACTCTTTTCTGCCCTGAGCTGGCCTTCTA
CTCCCCACCCTTTCCTTTCCTTGCCAGCAAAAAGCAGAAGTTGGAGGAGCTGAAGAATAG
CAACTTGGTGGGGACCTTCAGTGCAACTCTAGAGAAGTAGCAAAACTCATTCAGATACAC
TAGCAATAGTGTGGGGTAGAGTTTACCCACTGCCAGTACCTGTGGCCTAACCCCTCAATA
TTCCAGCCCACAGAGGGGGTTTTCCCAGCCCTTCACCCTAGGAAGTACCCATGGGTACAG
TCTCTTGAACCACTTTCCCTGGCTCACCCGCGCAAGTGTTCCTGGAATTGTTCCCAGGTG
TAACTGGACACATGACCTACTTCCCCTCTCACCTCTTTCTCTCCCCTCTCCCACTTTGTG
CACCCCCAGGTCACTGTCAGCTACTTCGGGGAGGAAGGGAACTTGCCAATCGACCAGGCC
GGGGTCTTCCTCACTGCCATCGGTAAGTGCGAGAGGGTTGACCGGGGTTCCTCCCAGGGG
GGTCCCCCTCTGGAATTTGCCATCACCAGCTCCAACCTGAAGAGTCCTGCACTAAACATT
AGGGTAGATATAAATTAATCAAGTTGGACACCATCCCTCTCCCATTTAGAGCTCACAATC
TTTTACAGATGAGGTAACTGAGACATAGAGGAGTGAAGTGACTTGCCCAAAGTCACACAG
CAGACAAATGGGGGAGCTGGGATTAGAACCCAGGTCCTTCTGACTCCCAGGCACGTGCTC
TATCCATAAAACCATGCTGCTTCTCAAAGCTGTGGAATTATTCACCTCCTTCTTTAGTTT
ACTGCCTGTGAGTTTTCATATAGAAAATATTCAGCCTGGATCTGCCTTAATAAATCATCC
AGATAATCCAGCCCCTCAAAATACTTTGGCTGAAATTAACTGGATAGGCAGTGTGGCTTA
GTGGATTCAGCACGGGTCCGGAAGTCAGAAGGTCATGGATTCTAATCCCAGATCTGCCAC
ATGTCTCCTATGTGACCTTGGGCAAGTCACTTCACTTCTGGGCCTCATTCGTCATGTGTA
AAATGGGGATTAAAAGTGACCCTCTGTGGGACAAGGACTGTGCCCAACCTGACTAACCTG
TCTCTTCCCCAGCACTTAGGACAGTGCTTGGCACAAAGTAAGCACTTAACAAGTACCATA
ATTAAATGTATTATTATTATTATTTTTGGAATTATTATATGTTAAGTTCTCATTATGGGG
CAAGCGCAGTACTAAATTCTGGAGTAGAAACAAGTTAATCAGATAAGACGGAGTCTGACT
TAGTTCAGTGCTTGGCCCAAAGGAAATGCTTAAAAAATATTATTATTACTATGCTGAAAT
CCCACCCCGCAGGCTCATATCTGGAGAGTTCCCAGTACCCTACCAATCTCAACTACAGGA
GGGAGAGTCAGGCAGAGGTCTATCCATTCCATTCCTAACTCTATGGATACACGACCAGAT
CAATTGCAGATGAAGGTGGGGCATTCTGAGAGAGACGTGTCCATGGCGTCACTATGGGTC
GAAGACAACTCGACGGCATAAAACAAGACCCTGAAATCAACTCTTTTCTTTCCTCCTCCC
TCCCCACTCCCTACGGCAACCAAGCAGGGCCAGGTCTAGGTATACCAACTTGGGTGGAAA
GGTCATACTTTTCAGTCTTCTGCTTCATGACCCAAGAGGGCCAAGGGTAGGATCCACTGA
GGCTCCTGCTTTTGGCCAGAATTGCAGGAGAGAAAAATCCTCAGCTGCTACAGTGGCGGC
CACGGCTGCTGCCCCCGAAAAAAGTGGGGGAAGAGGAAGAGGAGGGGTACCGTGATGCAT
GGCTGCAGTCTCCACTGTAACTAAGCTGGGCTTCCCAGGCCAGCGATTAGAGCTTCTGGC
CCCGCCAAAGAAATGTCACCCAGCTGCTGGAAAGCTCAGGTCTGATATGACTCCCAAGGT
TAATGATGATGATGTACTTGTTAAGCACTTACTATGTGTCAAGCGTTGTTCTGAACACTG
GGATAGATACTGGGGTTGAAGAAGCAGCGTGACTCAGTGGAAAGAGCACGGGCTTGGGAG
TCAGAGATCACGGGTTTGAATCCCGGCTCTGCCACTTGTCAGCTGTGTGAATGTGGGCAA
GTCTCTTAACTTCTCTGTGCCTCAGTTACCTCATCTGTAAAATGGAGATTAAAACTGTGA
GCCTCACGTGGGACAACCTGATTACCCTGTTTCTACCCCAGCACTTAGAACAGTGCTCTG
CCCATAGTAAGCGATTAACAATTACCAACATTATTATTATAATACAAGCTAATAAGGTTG
GACACTGTCCCTATCCCACCTGGGGCTCACATTCTCAATCCCCATTTTACAGATGGGGTA
ACTGAAACACAGAGAAGTTCAGTGACTTGCCCAAGGTCACAGAGCAGACAAGTGGGAGAG
CCAGTATTAGACCTCAGGTCCTTCTGACTCCCAGGCCCATGCTCTATCTCTAATAATAAT
AATAATTGTGGTATTTGTTAAGCTCCTACTATGTGCCAAGCACTGTACTAAGTGCTGGGG
TGGATACAAGGGAATCAGGTTGCAGACACGGTCCCTGTCCCTCTTGAGGCACCCAGTCTA
AATCCCTATTTTACAGATGGGGTAACTGAGGCCCAGAGATGTGAAATGACTTGCCCAAGG
CCACACAGCAAACAAGTAAGAGAAGCAGCGTGGCGCAGTGGAAAGAANNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGAAGCAGCGTGGCGCAGTGGAAAGAACA
CGGGCTTTGGAGTCAGGGCTCATGAGTTCGAATCCCAGCTCTGCCACTTGTCGGCTGTGT
GACTGTGGGCAAGTCACTTAACTTCTCTGTGCCTCAGTTCCCTCATCTGTAAAATGGGGA
TTAAGACTGTGAGCCCCACGTGGGACAACCTGATTCCCCTGTGTCTACCCCAGCGCTGAG
AACAGTGCTCTGCACATAGTAAGCGCTTAACAAATACCAACATTATTATTATTAAGTGGC
AGAGCAGGAATTAGAACTCACGACCATCTGACTCCCAGGTCCATGCTCTATCCACTACAC
CATGCCTATTTCTAGGACATGCTGTTCCCTAGGCCATGCACAGCTACACTGGTCACCAAG
CTCAGCTGGCTGGCTTCCCAGCCCAAATACCATGGCACGAGTCCCATCCTCCTAGGATCC
GCCGGTGGTTCCACCCTGGTCGCCCGGGGCCTCTGGTTGGTCCTAGTTGGCAGAGGCGAA
CCAGGCTGGCAGAACTATTTAGCTGGTTTCATACCAGTCCATCTGGTTTTCAGTTGGTTC
ATCCCCCGGGATGGTAAAGGATGCAGAGCCGGATGCTTCTATTGTGGAATTTTTCTTTTT
AACACTTCTGCTCCTGCCCTCAAGTCCAGTGGGTGTTGGGGCAAGAGGGCCTATGTTTAC
TGGGACTGGGGAGTGGGACACAATGGCTGTGGAACCAAGTGGGGTTGGGGGTCCCAGCAT
CAACACGCTCTGTAGAGTTCGTAGGTTACCTCAGGATCAGCAGGGAGCTGTCCCACGTTT
GTGAGTGCTTTCAGCGTCATCCCAGCTTGGGAGGCAGGGACTTGTCCAGGGGAACAGGCT
GGGAAACAGTGGCACCAAGGACCCCCATTGACAGGGTCTGAGGCTCTACCTGCCCCTCAC
TCTGCCCCATTCATTCATTCAATCGTATTTATTGAGCACTTACTGTGAGCAGAGCACGAC
ACTAAGCACTTGGGAGAGTATAACAATAAACAGGTGCATTCCCTGCCCACAATGAGCTTA
CAGCCTAGAGAGGGAGACAGACATTAATATAAATAAATGAATTACAAATATGTACATAAG
TGCTGTGGGGCTGGAGGGAGGGATGAATAAAGAAAGGAAGTCAAGGCGATGCAGAAGGGA
GTGAGAGAAGAGGAAAAGAGGATTTAGTCTAGGAAGGCCTCTTGGAGGAGATGTGCCTTC
AGTAAGGCTCCCTTGCTCTGCCCCTCACTCTGCCCACCCCTAGCTTCCAACATTTTTCTC
CCCTCTGAGTTCCCAAAAGTCTGTTCACATTAGGCTCTCCTCACCCCAAGTCAGTAAAGA
TATGATTAGCTGAGGGTAGGATGAGCTGCTAGGAAGAAACAGGGCCCAGACACTCCTTCC
CAAGGGAAGCCAGGGGATTGAAAGGTGAGAATTGCTGGCGGGCAAGGCTAAACCTGCCGC
CCTCCTGTGGGGCAATCAAGCTGAGCTAACTGCCCTGGGCCATGGGTTGGCCGCCGGGGG
CACAGGCCATTTGGCTGGCGACCCCAGGGTGGGAGTACAGACAGTCCCCTGGGATGGAGG
TAACAGAGGCAAGGGCGGTGAACAGAACTTCAGAGCCCAGTTCTAGGCTTCACACCCCGT
GGCAGGGACATTCTGTTCACACTCACTGCAATCCTAAACAACCATAAATTGTAAGCAAGA
AGGGTAATCTCGCAGTTGCCTAGATCTGCTTTCAGGGGGATTTACTGAACATCTACTGGG
TGCCGTGCATTGTTCTAAGCCCTTGGAATGGCACAGTAGAAGTAAGTCAGAGTCTCTGAC
CTTGAAGAGTTTCCAATTTAAGGGGCACCCCCCTGTAGCACGTGAGGCGACCGATGCAAT
GGTGGTCTGAGCACTTCCCGAATGAGAAGCACTCTGCTAAGTGTTTAGGAGATGATAATT
GAAGCAAGACACACATTCCTTCTTTTAATTCTGAGGATGACAGATGTTGTGAAGGGGACC
CAGTTTTTACTCCGACTGAGATTCCCAGGCCACATTAGTGCTGGACTTCTTGGATTGGGA
GCCCTGGGCAGCAGCTTGGCTTTCTGGAATGACTTTGGGAACGGGAGCTGGGAGATCCGG
GTTCTAGTTCCAGTTCTGCCATTGGCCCTCTGAGTGACCTTGAGCAAGTGACTTAATTGT
TCTGTGCCTACATTTCCTCATCTGTAAGAGGGGGAGAAGATACCTGTGCTCCCTCTCTCT
GAGATTTTGAGCCCCACATGAGGGTCGGGGAATGATCTGATTTTTTGTGTCTACCCTCCA
CATCTAGCACAGTGCTTGGCCCACAGTAAGTGCTCAGTAAAACCGTAATTAAGGTGTGGG
GTGTGCAAACGACATGTGTGAGGCTGTGGTACTTGCTAACTCTGTGGCCCTCAGAGACCA
ACACAGGAAAGACACTCGCATTGGAATGTGGGATAAGGAGATTTTAGTTATTATTAGTAT
TAATATTATTAATGCCGGGGTAGGTACAAGTTAAATTAAGACAGAGACAGTTCCTGTCCC
ACCTGGTCAGGTTAAGTAGGAGGGAGAACAATTACTAAATCCCCATTTTGCAGATGAGGA
AAATGAGACCCACAGAAGTGAAATGACTTGCCCAAGATCACATAGCAGGCAAGTGGCAGA
GTGGGGATTAGAACCCAAGTCCTCAGACCCCCAGGCCCATGCTCTTTCAACCAGGGCAAG
CTGTTAGTCCTCAGTTCCTTCCCTGATCCAGTGAGGGGCCCTGCCTGCTACTGATGCCGG
ATTGAAGAGGGGTGAAGAGGGAGTGTATGTTGGTTGGAGGCAGGGGGAGGGAATGGCCAA
AGCCAGGAGCCTGAGCCAGGCCGGCGCCATCACCCCGCAGGCAGGCTGCCCCGAACACAA
TCCCCCTGACATTTCCCATTAATCTGCCACTCCACGGCCACCTGACACCTCAGAGATTAT
TTTGGGTAGCTGAACTGCGGGCACATTCCTCTGGAAAGCATCCCTCTTGGAGGACCAGCT
CCAAAGCCAGACTGCCCCTCTTGCTTCCTGGGAGGGAGTTAAGGGGAGGGGTGTCTGAGG
GAGAGATGTTTGATGCTGTGGAATCACCCAGCTTCCAGCCCCTGCCCCTCTCCCCAAACC
AGTCCCTTCCCAGCTGACCCTGCAGTGGCTCTGTTGGGTCCTGAGGGAAATTAGGCTGGA
CTAGAAAGAAACTAGGCCAGGAGCAAGTCAGACCTTACTTCTGCAGGGAGCCCTCCCTAG
CTGCCCCACCCCCATCACCAGGAGCAGCCAAGAATCAGTCCAGCTACCCTCAGGGAGGGG
GCAGGGCTAGCTCCCAGCACCCACAGCCAAGGACACAGGTGCCAGCCGATGAGGTGAGCC
CAAAAGATCCCCAGTACGACCTCACTGTACACTGATTCACTCCAGCTCACGCACAAGGTG
GCCAAAATCCCTAGAAGACTCGGCAGGCAGAAAGAGAAACCCTGCCTGGTCCGGAGAGGT
GCCCCGACCACCGGCCAACCGGTTGATAACACGGCCGTGTGATGGCCGGGAGCCGAGGAT
TCTCCATCATCACTGTCCCTCTCGGGGTAAACGCTTTCCTCTTTCAATAGGGCTGATGGA
TCGGGGGTGCCCCCCTCCCATAGACCTCCACCCACCTGGGTTAGTGGTCACCAGGCGATG
AACCACTGATACTGTCTGCCTTCCTAAGGGAGGAAAAGGAGGACCCAGTAATCCGGGTCC
TTGTTTGTTTTAAGCAATTACTGGGCGTGGGGTGTACATATTGACTGTTAAACTGTGCTG
TGACCTTCAGACTGAGGCATAGTATACCGTAGTATGGTATAGTGGATAGAGCACTGGCCT
GGAAGTCAGAAGGTTATGGGTTTAAATCCCAGCTCCGCCACTTGTCTGGGCAAGTCACTT
CACTTCTCTGTGCCTCAGTTACCTCATCTTAAAATGGGGATTAAGACCGTGAGCCCTATG
CGAGACAAGGACTTTATCCAACCTGATTTGCTTGTATCCACCCCAGAACTTAGTATGGTG
CCTGACACATAGTAAGCACTTAACAAACACCATAATTATTATTATTTTTATTATTATTAT
TCTGCATTCTGTATCTAGCAGGATTTTATCCCCATGACAACTCCTCCCTGCCAACCCCTC
CCTGCCACCGCCCCCTGCACCCTCCCCCCATGCCCCCATCCCAACACACACACACACAAA
CACACACACACACACACACACACATACTACCAACCCACCTCTCAGGGGGGAGAACAAGGG
AAGGCCATTTAAGAGCCTCGGTTTAGGGTCTGGGCACTCTCCATTCAGGGTGTGGATTAG
CCAGGCTTCTGTCTCTCTTGCCCTCCTGCCAGCATTTGGGCCCTTTCCTTGCTCCCTAGA
AGTGTCCTGTGGCCCCTCACTAGGAGAAGGAGCAGGAACAATGGAAAATGAGGAAGGAAC
AGAGACTCAAATGAGCCCATATCGGTTCTCCAATATGCGATGTCTCCTATATCCCCGGAG
CCAGAGGTCAGTGGCTCTGGGGGTCGGGGAGGGAAAGAGGGTGACCCCAGTGGCTCAAAC
CGTGCATTAGGAAGCCCAGTGGGATTTCCCCTCTAGACAGCTCGTTGTGGGCCAGGAATG
TGTCCATTATACTATCGTGTTGTACCCTCCCACGTGATTTTACACCATTATACTATCATG
TTGTACTCTCCCACATGGTTATACACTGCTCTGCACACAGTAAGTGCTCAATAAGCATGA
TTGATTGATTGATTGATTGTAGCCCAGGTTCAATCTGGCCCACGCAGGCTTAGCTCCTGG
AAAGTTGGCTGCTGGATCATCTCCAGGCAGGACCGACTCGGTTCAGTAGTCAGTATTGAG
TGCTCACTCGGTGCACAGCACTGGGCTCACCAGCATGCAGGAGAGTACACTAGAGCAAGT
AGACGCGACTCTGGACCTTGAGTAGTTTACACCCACTGGCCAACTGTGTGTCCCCTGCAG
AGATCTCTCTGGACGTGGATGCAGACCGTGATGGCGTAGTGGAGAAGAACAACCCCAGGA
AGGTAACAGCCCCCATCTCTACCCCATGTCCTCTGCTCCATATGAATGCTTACCGACCCG
GCCGTCCAGAGCAGAGGTGGCCATAATGCTCAGCACCCAGAGAAAAGTGCTCCAGCCCGG
GGGAGGGAAGGGATTGTCAGGGGAATAGAAAGGCACAAAAGGAAACGAATGGAGAAAAGG
TGAGTTTAGCTAAGCTGAACTCTGTAAATCTATGCAAAGGGTGGCAACAAGTATGAGGAT
GTGGGCATAAGTGCTATGGAAGGAGAGGTGAATACTTAAGTGCTCAGGGGGTATGGACTT
CAGCACATAGTACAGAGCTCTGCTGACAGTAAGTGCTCAATAAATATGATTGACTTCAGT
GCAGAGGTGTTGCAGAAGAGAGGAGCTTGGGTGGGGAGATTAAAGGTTAGTCAGAGAAGG
CTTCCTGCAGATGTGATTTTAGCAGTACTTTGAAGATGGTGGAGGATGACGGTCTATCAG
ATATGAAGGATTTATATTGATATCTGCCTCCCCTCTTGAGAATGTAAGCTCGTTGTGGTT
GGGGAATGTATCTGTTTATTGTGTGTTTAGTACAATTCTCTGCACACAGTAAGAGTTCAG
TAAATATGGTTGAATGAATGAATAAATGATTGAAAGGGGTTGGCTGAGGTCCTGCTCATG
AGGAGTCCTCTGAGGTAGCACAGAGAAAGAATCGGGCCAGTTTCTCAAATGGGTAGGGTA
GCCCTGGAAGAAGAAGCAGTGTGACTTAGTGGAAAGATGATGGGCCTGCCAGTCAAAGGA
CCTGGCCTCTTATCCCAGCTCTGCCGCTTATCTGCTGGGTAGCCTTGGCCCAGTCACTTA
ACTTCTCCATGCTTCTGTTTCTTCATCTGTACAATGGGGATTCAATACCTGTTCTTCCTC
TGTGAGCCCCCTCCCTCTTATTTAGGTTGTGAGACCCATGTGGGGCAGGGATTTTGTCCA
ACCTGGCTATCGTCAATCTACCCCCAAGCTTAGACTGCTTAACCCTCATTACTATTATTA
TTGATTATATTATAGGGACAATACTAGTTAAGCAGTATACTAAGTACAGTGGTAAGATAG
GAGATATTAAAATGTCATTATTATTAAATTACTTATAGGAATAATGATAATAACATGTGA
GCTCTGCAGAAGCAGTAACTCAAGGCAGTTGGAGGGGGGGGTCACCTGACGTAACCACAC
CAGCCTTGCTGAAAATCCAAGATTAAGTTGCCTCTTCTCTCTCACTTCCCCTTTCTCACT
GTGGGCTCCACCCACTCTCCCCACTCCCAGTTTTAGCAGTCAGAACCCCCAGACTCAGGG
TTCCAAGTTCTTTGACTACCTACAGCCCCCCGCCCTCTGAGAAGGCAGGCCTTCGGGGCA
GGGGCTTTGGGCCTGTTGCCTCACCAGCTTCCCCAGACAGAAACGAGGCCCGGGCTTAGC
TCACTCCTCATCTCTGGGTGGTAGAAAGTGCTGTATCCTGAGCAGAAGGCCACTGTCTTC
CTTACTGAGGCCAAGAGGGACTAGGCTTCCCCTGCAACAAGAAAGATTTAAGTCAGACGA
TAAGAAGAACTTTCTGACTTTGGGTTGCGAGACCCAGGAGGGGGTAAACAGAGACCGTTG
TGAAACCTCTATAGCTGGAGCTTTTCAAGAGAAGAGGATTCTGCAATCTGCCCGGGTTTT
GTTTTTTTTTAAAATAGTAGTATTTGGTAAGCTCTTACTATGTGCCAACCGCTGTTCTGA
GCACTGTGGTAGACAAGTTAATTAGATCAGACACAGTCCCTGTCGCACATGGAGTTCACA
GTCTAAGTGGGAGGGAAAACAGGTATCTCCATTCTAAAGTTGAGGAAACTGGGGCACTGA
GCAGTTAAGGACTTTCCTCAGGTCACTAGACAGACAGCAAGAAACAATCACACTGAAGTC
CTGGAATTAAGTTAGGCTCCTATCACTGAATTACTACCCAACTGTACGACGTGGAATACA
TGAAGAGAATGGAAGACATTAAGATACCCCACCAAGGGTTATACAGTGATCTGAAATTAG
AAAACCAAACAGGGAAGTCAGAGTCCATTTCAGGTGGAGGAGGATTAGAACCCGTGTCCT
CCTGATTCCCAGGACCGTGCTCTCTCCTCAAAGCCATACTGCTTCTCTGATTCTTCCTGG
GCTTTGATTGGGTGAGGTTCTGGGGGCCTTGACAAACCCTAGTCCTCATGAGCCCCTGCC
TGCAGTGGGCATTCTTTCTGGGAAGAGTCCACCTGTCACTAGATAGCGCTCAGCGGCGAG
GTGGCCCTGCCCTTTAAGAACGATTGCGCGAGCACATGCCCCATCTGTGCATCCAGAAGA
AGCTGAAATAGAAACCCACTCTCATAAAGCCAAGATCGGCACGAGAGCATGTGTCATCTT
TGCCCAGAGCCAAAGCACGTTAAAGGCACAAACTCAGTTTAAAAAACATTACCTGGCTGT
CATCAGAGGAGTGGAGACTGATGGATAGGAAAGGAATCGCAGACTCCAGTTCTATTCCAT
CATGAACAGGCTATGTGACCTTGAGTTGAACATTTACCTTCTCTGGACCCTTAGAGTTCT
GTCTTCACCGAAGGGATGTGGGGAGGAAAGCAGGGTGATGGCTGAAGTCCAATATGGCAG
GGGAGAACAGAATGAGGCCAGCAGAGCGGGGACGGGACTGCTACAACAGGGCGGGAGTGG
ACAATTGCAACTAAGAGACCAAGTTCTCTTTTTACCAAAAGTTTTGAGTGAATCAACTTC
CCCAAGGTCACACAGCAAGCAACTGGGTGGAGCCAGGTTTAGAACCCAGGTCCTCTGACT
CCCGGGCCCATGCCTTTTCCACATGCTGCTTCTCAGTAACTGATCTTGAGGACGCTTCTG
CTCGGAAACCAAGGGCTGCCAATCAGCCATCATCATAGCTATTGAAATGGGGCCAGCGGG
GGCCCAGGGGAAGGAATGGGAGGATTTGGGCGGATGTCAGTGAGCATAATGGCCAAGCTT
CTCTCTGGTTGCTTCACTGCCAGGACAAGTTGTCTAGGATGCTAACGGTTTGCACAGCAT
CAATGGAGCTCTCTCGTCCCTACCAGTTGTGATCCTGCTGGGGCACAAAGGGCAACTGGC
AATTAAAGCAAGCTGGGGTGCTGCACATTACGACCTGCACACCAAGGCATTGGTGCGTGC
AGGCTGCATTTATGGTTGGAGGGGTGGCATAATTGTGCCTTTAGTGCCACACGACTCAGG
CAGGGTAGAATGTGGGCCTCTCCCTCTCCCTTCCACCCCTGCCTGCTGTTGTCTCTGTTG
TTTCCTCTTTCCCTTCTTCATCATCAGCCCCAAACAAATACTGGGGAATCAACCAGCCCC
GGGTTCTTTCTGGGAATGATCGGACTTTGGCCTCAACCCCGGCACTGGGTCTACTGTCCC
AGGTCCTCCCATCCAGCTCTGAGGAGCCAGCTCTCCCTGTAAGTCTCCTCTCCTTTAGAC
TGTCAACTCCTTGTAGGCAGGGAGTGTGTCTTCCAACTCTGTTGTGTTGTACTCTTCCAA
GGGCTTAGTACGGTGCTCTGCACATGGTACGTGCTCAATAAATACCATTGATTTATTGAG
GAGGAGGAGTCTGCAGGGGCTGGGAGCCCAAACAGCTCTGAGAGATGGTTGCTAATCCAC
CCAGAGGTCTTACCTCTTGGAGTACTGGCAACCCCAACTCCTTTACGCTTGGGGATTTTT
TTATGGTATTTGTTAAGTGCTTATTATGTGCCAGGCATTGTACTAAGCACTGGGGTAAAT
ACAAGCTAACCAGGTTGGACATAGACTATATCCCTCGTGGGCCTCACAGTCTTAATCTCC
TTTTTACTGATGAGATAATTGAGACAGAGGGAAGTTAAGTGACTTGCTCAAGGTGTCACA
GCAGACAAGTGACAGAGCCAGGTTTTGAATGCAGTTCCTCTGACTCCCAGCCTGACATCT
TTCCACTGGGCCATACTACTTTTCCCAAAGGGACTGTCATGCTGGATGGGCTTCTTCAAA
AGAGATTCTCCTGCCATATCTGACCTACCATTCCAGCTGAGTGTTCTGTTTTCCTCCCTC
CACCTTCCCCATCCTTCTGTAAAGAAAACTCCAGAGTTGACTTTCTGTCCTATTAGAGAG
GGCAGACATCTCCTTCTCTGGGGATCATTAGGAAGAAGAGAGACTCCCTGGAACTGATCA
GAATCAGTCCTGCCTGGTGGCAGGGGAATCTTTGGTTCAACCCCGTGGACATTGCCTTCA
GTGAGGGCCCGTCTATCTTTCAACATAGCTCACTGTGGGGAATGTATCTGTTTACTGTTG
TATTGTATTTTCCCAAGCACTAAGTACAGTGCTCTGTACACAGTAAGCGCTCAATAAATA
AGATTGAATGAATGAATGAATGAAGCCCTTGTATTGAACTGCACCAAGCAGCACAAATGA
CTACATAAACACAAACCCTGGAGTCTTTGGGAAAGGGTGCAGGAATTCAGGGATGGTGGG
GAGGGCTCTGCCCATCTGCACTCCCCTCCAGAAAGCAGCAGGAAAGGGAGATCTCGGGCC
AGCGTGGCACAACGGAACAGACATAGTTGGGGGTGGGGCAGAATGGATTGGGGTCCCGCA
GGAGGTGGAATTTCCTGGTCTTAATCACTGGTTTCCTGGTTTCCCGTCTTAATCACCGCT
CTCCTTGTGGCCACAGGGTTCTTGGACCTGGGGCCCTGATGGACAGGGGGCCATCCTGCT
GGTGAACTGTGACCGGGAGACCCCCTGGCTGCCAGAGGGGGACAGCGCCGACGAGAAGAT
CTATAGCAAGGAAGGTAGGCGGTGACGGTGGAGGCAGAGGGTGGGATCCTGGGAAGATTA
GCTTCAGGAGAGGTGGACCCCTTCCTCTGAGTCCAGAGGAACAGGGAGCAGGAGGTAAGG
GGAATGGCTTGGAGAGAAAAAAGCGGGCTGATGGGTATATTTGGCAGTTGGGTGTTCCTT
TCTCCCATTCAACTGTAAGCTCCTTGAGGGCAGAGGCTTAGTCTTTTACTTCTGTTGCGT
GTTCCTAAGGGCTTATGCTATTCTCTGATGGGTCAGGGTGGACCAGTTCAAGGTGAATTT
ATTGGAGCTGAGAGGAAGGGTTCTGGTGTCTGGGGGAGAAACCAGAGTAAACATGCCTAC
CCCTTCTGCCCAGGTTTGTCTGCCAGTCTGTTGAACCAGTATTTGAACCCGTTTCCCTCA
GAGGTCTGCTAGAACCAGAGAATTGGGAATGTGAGAAAGGCCTGAGGAGAAGGGATGGAG
AACCTGGACTTCCAATGGTCCTGACCTGTCTGTCTGTCTGCACTCCCCCCCAGATCTGAA
CGACATGTCCCGGATGATACTAAGGACGCGTGGCCCTGATAGGCTCCCGTTTGGCTACGA
GATGGTCCTCTACATCTCCATGTCAGACTCCGACAAAGTTGGCGTGTTCTACGTGGACAG
TGAGTGCCCTCCTCTGATTCATCAGCCCATNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNAAGTTGAAGAAGGAGCGGCCTGCCTACCTCCCC
AAATGTCCAGATCCTGGCTCTGTCCATGAGTTCTCAGTTTCTCCACTCATAAAACAAAGA
TCCTGGGAGATGTGGAATGGCAAAGCCCAGTAGGGAGAACCGAAAGGAAATTCTGAGGGT
TGGGTTTTGGAACGGTTAGGTAGGAAGAAACTTTTAGATTAAGATAGTAAGAGCTTAATA
CAGTGCTCTGTACACAATAAGTGTCCCATAAATACCAATGATTGATTATTGTAAACCTTT
CATTTCTCTCCTGCCTTTCTTCCAGAGTGGATTATCAATTTGTTCTCATTTATTCCTATG
ACACTCCTCTTAGCTCGGAAAGAAATGGCAATGACTAGCCCCGTTTCTCAGTGGCTCAGA
GATATTAAGGGATTTGCCAAGACCCCAACAGTACCTAAGTGGTGGTTCTGAGAAAAAAAT
GCAGGTGTCCAGGCCCACAACCCAGTGCCTTCTTCTCTAAACTCTCTGACCAAAGTCCCT
GACAGGCCTGTACTTCCAGAGGAATAGTATGAAAAGCAGCATGGTCTAGTGAGCGTGGGC
TTGGGAATCAAACAGACCTGTGTTCTAATCCTGGCTCTGCCACTTTTCTGCTGTATGACC
TTGAGCAAGTCACTTCACTTCTCTGTGCCTCACTTACCTCATCTGTAAAATGGGGATTAA
GATTGAGAGCCCTTTGTAGGACATGGTCTGTGTCTAAACTGATTACCTTTTATCTACCTC
AGTGCTTAGTACACTGCCTAGTACACAATAAGCACTTAACAAATACCACTTTTAAAAAAA
CAGTAAGTAGCATTTATTGAGCACCCATTTGGTGCATTGCACAATACTAGGCTCTTGGGA
AATACAGAATAACAAAAGGATATGTTCCCTACCCACCAGGATCTAACCCTCTAATGGGTG
TCCAGAGGACCTGCACCTGAGGCCTCAATTACGAGGTCCTGGTTTGGCATTCTGGGTAGT
TAAATTCCTCAGACCAGGAACCCCAAGGGAGGTTGAGTTGTTACTGAATGCGACTTATGG
CTTCCCCTCTGGCTGCCTAGAGCTGATGGATGAGAGTTGGGAAGAGCAGACAGACGGAAC
CCAGACGAGGGAGCCCAAGGGCAGGGCTGGAGGAGACCTCGGGCTCAGGGATCAGACGGG
CTGACTCAGGAGAACTGCATCATTGTTTGGCAGTGAGAGCTAGCGCGTGGCAGAGGCGTG
GGTGCCGAGGGGGGCCGTGCTCTCCTCCAGACAATGCCGGGACTGTTCTTCCTGATGAAT
TGACCAGCCCGGAGCTGGACCTGGGGACTCGGCCCGAGAAACAAGGTCCATTGTGGACAA
CAAGCCTGGCCTCCTTGTCTTCGTCCCCCCCTCAGACCTGAGTCAGCCCCAGGGGTGGGA
TGGGAGTCACGGGATGGTTGGGATCTTGTTTGAAGGTCCAGACTCTGTTTCCTTGGCTTC
TTCTGGCTCTTCCCCAGTGTCTGTCCCCAAGCCCTATCTCTCAGAGAAAGCACAGATTCA
TTCTGCTCCCATCTCTGCACTGAGTGTCTTGTAATGTTTTCTCTGAAGTGCCCCATTTCG
CAAGTCTCCATGAATACAGCTGTGCATCAGGATTTTTCTTTGTTCTGGATCCTAGCGACA
TTAACGAGAGCAGTTTATCCTTTGGTATTTCTGGGGAATATTTGGTCAGTGGTATGTATT
GAGTGCTCACTGTGTGCAGAGCACTGTACTAAGTGCTTGGAAAAGTACAATATCTTAGAG
TTGGTAAACATGTTCCCTGCCAACAAGGAGCTTACAGTCTTGAGGTTTGGTTTGGTTTGG
TTTCTCCCGACAGTTGGGTTCCCCCAACAGACTTTANNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAACAGAGCAAGAATCCATGTACATGGCCAC
TTCTCCTGGCCTTTGGAATAAACAGATGTTGAATTTGAAGTCAGAGCACCAAAGTCACCA
GCTGCCCTTCGATTGCTGTCAATTCAGTCAGCACAGATCTCCCACAGAAACCAACTCATT
GTAGGATCCCAGCTGGAAACCCGTGTGATTTGCCCTTCACCCACTTCTTTCTCTGGGGAG
ATCAGAGTGGCCGCAGTCATGAGCAGTTGCAGAGAAAGCCATTCTATTCATGTCACAGTT
GGCTATTCCAGCCTCTCCTAGCAGGCCCAGCACCCCTCTAGAGGCTGGAGCCCAGACAGA
TCCTATCCCTAATCCCAAAGGAGACATCCTAGCTCAGGATGTTGGATGCTTGGGCTCTGG
CTCTTAGTCTCCTAGTAACCCAGGAGCCTGCTGGGCCCTGAGCAGTAAATGCCTAGAGCG
TTTTGGCTTTCCGCCATAGGAAGGAGGGTGGCCCCATGTCGTCACTGAAGTCTTGGTAAT
TCCAAGAATCACTCTGTTGAAAGAGAACTCCAGAGATCATTTGGTGCAGTCCTCTGCCTC
CCCAACAGAACTGTATAATCCCCATTTCAGGTATATGGTTGCCTGTTTTCCAAAGGGTCA
GCACCCAACATCTCCTCACTCGGTAGCCTGTTCCAGAGGGCTAAGTGACCCCTGCAGTCA
CAGTCCATCCTTTTCATTCATTCATTCATTCAATAGTATTTATTGAGCACTTACTATGTG
CAGAGCACTGTACTAAGTGCTTGGAATGTATAATTAAGCAACAGATAGAGACAATCCCTG
CCCAGGGATGGGCTCACAGTCTAAACGGGGGAGACAGCAGAGCAAAACAGAATAAAACAA
AAAGACAACATTATCAAGATAAATAGAATCAAGGGGATATACACCTCATTAACAAAATAA
ATAGGGTAATAATAATATATACAAATGAGCACAGTGCTGAGGGAAGGGGAAGGGGGAGGA
GCAGAGGGTGGAGGGGAGGGGAGGGAAGCAGAGGGAAAGGGAGGCTCAGTCTGGGAAGGC
TTCTTGGAGGAGGTGAGCTCTCAATAGAGCTTTGAAGAGGGGAAGAGAGTTATTTTGGCA
GACTTGAGGAAGGAGGGCATTCCAGGACAGCGATAGGACGTGGGCCAGGGGTCGACAGCG
GGATAGGCGTGAACGGGGGACAGTGAGGAGGTGAGCCGCAGAGGAGCGGAGTGTACGGGG
TGGGCAGTAGAAAAAGAGAAGGGAGGTGAGGTAGAAGGGGGTAAGGTGATGGAGAGCTCT
GAAGCCAAGAGTGAGTTTTTGTTTCTTGCGAAGATTAATAGGCAGCCTCTCCTGTGCCCA
CTTCTCCCTCTGCTTCTTGTTTCATCCTCAGAGGAGGTCATCTGGATGTCCTCCTCTATT
GTGGCCCTTTCAGACTCGATCAAGGACAGTCTTCAATCGATCAGTCTTTTTATTGAGCAC
CTCTGGGACCTGAACTGAGCTTTTGGGAGAATACAGTAGAGGTAAAGACAAGGTCCCCAC
CCTCAAGGAACTTACAGGCTAATGGGTGACTTTTCTTCTCCTGGATCCTGGTCCAAGCTC
TGTTCCCTGCTCTCCACCATAATAATAATTCATTTTGGAATTTGTTAAGCGCTTACTACG
TGCCAGACACCATACTAAGTGTTGGGGTGGATACAAGCAAATCAAATTGGACACAATCTC
TGTCCCATGTGGGTTCACAGTCTTAATCCCCCTTTTACAGATAAGGTAACTGAGGTCCAG
AGAAGTTAAGTGANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNTAAGTGAAGTGAAAAATGGGGATAAGCTACTTGTTCCC
CAGCCCCTCCCTGGCCTGTGATCCCCATAGGGAACAAGGAGATTTATCACTGTGCTTAGC
ACAGTGTTTGGCACACAGTGTACTCAAATACCACGGAGTGTCAGTCCCCATGGGGTTGCG
AGGCTTCTTCCAGCTCTCGAATGGCTCATTCGCCAGTGGTGCTCTGCCCCCATCTCTCCA
GGGTGTTCCTCGGACCCCCATCTTCACAGACACTGTGACCTTCCGAGTGGCTCCGTGGAT
CATGACCCCCAACACCCTGCCTCCCGTGGATGTGTTTGTCTGCAAGTAAGAAGTGGGGTG
GGAGGTGGGGATTGGCACTCCCAGTGTGCCCCTGACCAGCTCACCCAAGTGGGCATTTCT
GGGATTCCTGCCTCCGTCTCAGGGACCATCAATCCCTGGGATCAGAGTCAAATACCCTAA
GGCACACAGAGAACTGTTTCCCTAGCCCTCCTCAATCCCCTGCCATAGGACCATTATTAT
GGGGGTACAGAGTTTGGGGTTATTAAACCACATGGGGTCCTGTTGGAGGGGCAGATGGGT
CTTAAAAGAATGTCTACATTCCACCCTTCGATCTCCCTTCCCTCCTGATAGATGCTGGCA
GCTCCGGCCACTGTACGGAGCAGGAGGGGTACCATCCCAGGCCCCTGACTGCCTCAGGGG
GTCCCTTCCCCTGTTGCCTCATGGGTGGCACCAGTCCTTCCCAGCTTGTCCACACAAAAT
CTGTGAGTGTCTTACCTCTGGCTCTGCACTCTTGCCCTTCCATCCCCCTGTCACGTTCTC
CTCAGCGTGAAGGATAACTACCTGTTCCTGAAGGAGCTGAAGAGTCTGGTGGAGAAAGCT
CGCTGCAACCTAAAGGTCTGCTTCCGGTATATGAACCGTGGGGACCGCTGGATGCAGGTG
AGGGGCCGGCCAGAGAGGTCCTGAGACATGGTTCTCCCCCATTCCAGAAGTACCGCCCAG
GACGCGATTGGCCCCCAGAAAAGGTCACCCATTCATATGGGATCAGCCTGCCTCTGCCCT
GTAGGGCATTTTCCCACTGTGCCAACTGAGTGGAGCTGCCCCAGGAGGGACTTCCTGCTT
ACCCCTTAGGATTGAGGTGGAACATTGGTGATGCTCACTAACCAGTCACCGCTGCTCTCT
CTTAACTTCCTTAAAGTGTGAGCCCCCTACCCAATTGTCTCTGAAATAGTCCAACCCTGA
TTCCGTCCCTTCAATTCTGATCTCTCGGTGGAGCTTCCAGTTTCCCTGAAAAATATGGAC
TGTTCCCCTCCCCACTCTCTCCACACCAAACAAGAACTTGTGAATGCAGGGCTTCAGTGG
GCAGTTGACCCTTTCCAGTGAGCTCCTGGAAAAGGCTCTTGTGCTGCTCAGACTGCTGGG
CTAGTGCAGCCTGGTCTGCTCTCCCTCTACCATGGTTTGAGGGAGAAGCACACCAGCCTC
TAAGGAGAGCAGAGTAAGGATAAATCCAGGGCTGAAGGTGGGAACAGTGGTCATCACAAC
AGCAAATAGATGCTAGAGGATTGGGCCAGAGGCAGTGGTGATCACAGCAGTCAGTCGGTC
AATCGTATTTACTGGAGAAGCAGCGTGGCTTAGTGGATAGAGCATGGGCCTGGGAGTCAG
AAGGTCATGAGTTCTAATCCTGGCTCTGCCACATATCTGCAAGCCAATTCACTTCTCTGT
GCCTCAGTTACCTCATCTGTAAAATGGGGATTGAGTNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1186, 3609..3681, 11160..11221, 15916..16033, 16553..16678, 17945..17965, 20405..20515, 21445..21506, 22681..22784, 23285..23439
1001..1186, 3609..3681, 11160..11221, 15916..16033, 16553..16678, 17945..17965, 20405..20515, 21445..21506, 22681..22784, 23285..23396
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved